2026 年 51 巻 7 号 p. 367-377
Chronic hyperlipidemia and/ or hyperglycemia can impair various organs, such as the liver, kidney, and pancreas, through metabolic abnormalities. Metabolic dysfunction-associated steatohepatitis (MASH), related from nonalcoholic steatohepatitis (NASH), exhibits complex pathophysiological features, and animal models of MASH are essential for elucidating its underlying mechanisms. This study aimed to induce MASH-like lesions in obese type 2 diabetic mice by feeding them a high-fat/high-sucrose/high-cholesterol (HFSC) diet. C57BL/6J, db/db, and KK-Ay mice at 6 weeks of age were fed an HFSC diet for 8 weeks. Collected samples were subjected to hematobiochemical, gene expression, and histopathological analyses. At 14 weeks of age, both diabetic mouse models showed hyperglycemia and hyperlipidemia, with hypercholesterolemia observed in HFSC-fed groups. HFSC-fed db/db and KK-Ay mice showed increased hepatic steatosis, and KK-Ay mice also showed partial hepatic fibrosis in pericentral venous and perivascular areas. mRNA analysis revealed upregulation of hepatic genes involved in lipid synthesis, inflammation, and fibrosis in diabetic mice fed the HFSC diet. Obese type 2 diabetic mice fed a high-fat/high-sucrose/high-cholesterol diet showed early indications of MASH-like lesions, supporting their utility as MASH animal models.
Metabolic abnormalities in obesity and diabetes systemically cause histological changes and organ damage, which are exacerbated by lipotoxicity and/or glucotoxicity under prolonged dyslipidemia and hyperglycemia. These toxicities contribute to the development of diabetic complications such as metabolic dysfunction-associated steatohepatitis (MASH), diabetic kidney disease (DKD), and cardiovascular disease (CVD) (Zhang et al., 2022; Zhou et al., 2022; Karwi et al., 2022). In 2023, nonalcoholic steatohepatitis (NASH) and nonalcoholic fatty liver disease (NAFLD) were redefined as metabolic dysfunction-associated steatohepatitis (MASH) and metabolic dysfunction-associated steatotic liver disease (MASLD), respectively (Rinella et al., 2024).
Prolonged dyslipidemia and hyperglycemia are major risk factors in the progression from metabolic dysfunction-associated steatotic liver disease (MASLD) to MASH. This process involves multiple mechanisms, such as lipid accumulation, oxidative stress, and inflammatory/immune responses (Zhang et al., 2022; Tilg et al., 2017; Bedi et al., 2021; Clement et al., 2022). Oxidative stress associated with chronic dyslipidemia and hyperglycemia leads to inflammation and aggravates renal interstitial fibrosis (Zhou et al., 2022). Similarly, oxidative stress and inflammation alter myocardial energy metabolism, promoting heart failure in obesity and diabetes (Karwi et al., 2022; Buchanan et al., 2005; Mazumder et al., 2004). Chronic oxidative stress and inflammation in pancreatic islets reduce β-cell mass through increased apoptosis, a key factor in the development and progression of type 2 diabetes (Donath et al., 2008; Donath and Shoelson, 2011; Inoue et al., 2018; Ježek et al., 2019).
The mechanism underlying MASLD/MASH development is complex and driven by glucose and lipid metabolic abnormalities. Animal models are essential for elucidating these mechanisms. db/db mice and KK-Ay mice are widely used models that exhibit obesity, diabetes, insulin resistance, and dyslipidemia. Although hepatic steatosis occurs in these mice, hepatic fibrosis is not observed with standard diet feeding (Fang et al., 2022; Martín-Grau et al., 2025). In this study, we aimed to induce MASH-like lesions in db/db mice and KK-Ay mice by dietary modification using a high-fat/high-sucrose/high-cholesterol (HFSC) diet to induce chronic hyperlipidemia and hyperglycemia.
Female db/db and KK-Ay mice (CLEA-Japan, Tokyo, Japan) were used. Female C57BL/6J mice (CLEA-Japan, Tokyo, Japan) served as controls. KK-Ay mice exhibit obesity, hyperinsulinemia, hyperglycemia and insulin resistance, along with hyperphagia due to the Ay mutation. db/db mice carry a loss-of-function mutation in the leptin receptor, resulting in severe obesity, hyperphagia, hyperglycemia, and insulin resistance. Both strains have been widely used as murine models of obesity-associated type 2 diabetes. At 6 weeks of age, mice were divided into two groups: a normal chow (NC) diet group (CE-2, 3.4 kcal/g, CLEA-Japan) and an HFSC diet group (14% fat, 25% sucrose, and 2% cholesterol based on total calories, 4.06 kcal/g, CLEA-Japan). Mice were fed the respective diets from 6 to 14 weeks of age. They were housed individually in plastic cages under climate-controlled conditions (24 ± 2°C, 50 ± 10% humidity, 10 hr light/14 hr dark cycle) with free access to water. All animals were necropsied at 14 weeks of age. The C57BL/6J mice fed the NC diet were the same as those used in the previous report (Oki et al., 2025).
Biological parametersAt 14 weeks, body weight, liver weight, and blood biochemical parameters, such as serum glucose, insulin, triglycerides (TG), total cholesterol (TC), aspartate aminotransferase (AST), and alanine aminotransferase (ALT), were measured. Blood was collected from the abdominal vena cava under isoflurane anesthesia. Serum parameters were analyzed using commercial kits (Roche Diagnostics, Tokyo, Japan) and an automatic analyzer (Hitachi). Serum insulin was measured with ELISA kits (Morinaga Institute of Biological Science, Yokohama, Japan).
Tissue sampling and histopathologyAt 14 weeks, mice were euthanized via cervical dislocation following exsanguination under isoflurane anesthesia. Liver samples were collected for mRNA and histopathological analyses. Samples for mRNA analysis were stored in RNAlater (Sigma-Aldrich R0901) at -20°C. For pathology, livers were fixed in 10% neutral-buffered formalin, paraffin-embedded, and sectioned at 4 μm. Sections were stained with hematoxylin and eosin for evaluation of hepatic steatosis and Sirius red/fast green for hepatic fibrosis.
Hepatic fat area was measured using Image J (Schneider et al., 2012). Sections (20 μm × 20 μm) were analyzed, classifying areas with a lipid droplet ratio ≥0.196 (equivalent to a 0.25 inscribed circle) as macrovesicular steatosis. Remaining steatotic were defined as microvesicular. Total steatosis was calculated as the sum of macro- and microvesicular steatosis.
Fibrotic areas were also quantified using Image J with Colour Deconvolution 2, TurboReg, and StackReg Plugins (Schneider et al., 2012; Landini et al., 2021; Thévenaz et al., 1998). Sirius red-stained areas within 30.27 μm of the portal and central veins were measured. Periportal and pericentral fibrosis were combined to define the perivascular fibrosis area.
mRNA quantificationTotal liver RNA was extracted using Sepasol-RNA I Super G (Nacalai Tesque) per the manufacturer’s instructions. cDNA was synthesized using ReverTra Ace quantitative real-time PCR (qPCR) Master Mix (Toyobo, Osaka, Japan). qPCR was performed using Thunderbird SYBR qPCR Mix (Toyobo). All procedures were performed according to the manufacturer’s instructions. Gene expression was quantified using the following primers: fatty acid synthase (Fas) forward: ATCCTGGAACGAGAACACGATCT, reverse: AGAGACGTGTCACTCCTGGACTT, tumor necrosis factor-α (Tnfα) forward: TCGTAGCAAACCACCAAGTG, reverse: AGATAGCAAATCGGCTGACG, α-smooth muscle actin (αSma) forward: GTCCCAGACATCAGGGAGTAA, reverse: TCGGATACTTCAGCGTCAGGA, collagen 1a1 (Col1a1) forward: GAACTGGACTGTCCCAACCC, reverse: CTTGGGTCCCTCGACTCCTA, cyclophilin (internal control) forward: TGGCTCACAGTTCTTCATAACCA, reverse: ATGACATCCTTCAGTGGCTTGTC.
Statistical analysisStatistical analyses were performed with consultation from a biostatistician using EZR software (Jichi Medical University Saitama Medical Center, Saitama, Japan). Data are expressed as mean + standard deviation. One-way ANOVA was used for comparisons between groups by strain or diet. When significant differences were observed, appropriate post hoc tests were applied. Statistical significance was defined as P < 0.05.
Changes in biological parameters in female C57BL/6J, db/db, and KK-Ay mice are shown in Fig. 1. Both db/db and KK-Ay mice exhibited hyperglycemia, hyperinsulinemia, and hyperlipidemia compared to C57BL/6J controls (Fig. 1A–D). Notably, KK-Ay mice showed more pronounced hyperinsulinemia (Fig. 1B). Serum insulin levels were 124.19 ± 45.25 ng/mL (NC) and 63.88 ± 32.52 ng/mL (HFSC) in KK-Ay mice, 1.98 ± 1.94 ng/mL (NC) and 2.62 ± 1.27 ng/mL (HFSC) in db/db mice, and 0.70 ± 0.37 ng/mL (NC) and 0.70 ± 0.12 ng/mL (HFSC) in C57BL/6J mice. Serum total cholesterol (TC) levels significantly increased in both diabetic mouse models following HFSC diet feeding (Fig. 1D). Additionally, serum triglyceride (TG) levels were elevated in KK-Ay mice on the HFSC diet compared to those on the normal chow (NC) diet, whereas in db/db mice, serum TG levels were decreased in the HFSC group compared to the NC group (Fig. 1C).

Changes in biological parameters at 14 weeks of age in female C57BL mice, db/db mice, and KK-Ay mice fed normal chow (NC) diet or high-fat/high-sucrose/high-cholesterol (HFSC) diet (A) Blood glucose levels, (B) Blood insulin levels, (C) Blood triglyceride (TG) levels, (D) Blood total cholesterol (TC) levels, (E) Blood aspartate aminotransferase (AST) levels, (F) alanine aminotransferase (ALT) levels, (G) Body weights, (H) Absolute liver weights. Data represent means + standard deviation (n=5). *p<0.05, **p<0.01; significant difference between C57BL mice and db/db mice or KK-Ay mice in each diet. †p<0.05, ††p<0.01; significant difference between NC diet and HFSC diet in each strain. ##p<0.01; significant difference between db/db mice fed HFSC diet and KK-Ay mice fed HFSC diet.
AST and ALT levels were slightly elevated in db/db mice compared with C57BL/6J mice under NC diet feeding (Fig. 1E and F). The AST and ALT levels in diabetic mice tended to be slightly increased following HFSC diet feeding, suggesting the decreased liver function induced by HFSC diet.
Body weights and liver weights in diabetic mice increased compared with those of C57BL mice under NC diet feeding. Moreover, increases in body weight and liver weight of diabetic mice were enhanced after HFSC diet feeding (Fig. 1G and H). Data in glucose, insulin, TG, TC levels, and body weight from C57BL/6J mice fed the NC diet were quoted from a previous report (Oki et al., 2025).
Histopathological analysesHepatic steatosis was quantified by separating microvesicular and macrovesicular components. The relative areas of microvesicular steatosis, macrovesicular steatosis, and total steatosis are shown in Fig. 2, and representative histological images are presented in Fig. 3. Both types of steatosis were observed in diabetic mice than in C57BL/6J mice and were significantly exacerbated by HFSC diet feeding (Fig. 2A, B). Total steatosis increased approximately six-fold in db/db mice (NC: 6.79 ± 1.41%; HFSC: 37.3 ± 25.9%) and ten-fold in KK-Ay mice (NC: 3.37 ± 1.32%; HFSC: 40.4 ± 25.9%) (Fig. 2C). Mild inflammatory cells infiltration was observed in the HFSC-fed db/db and KK-Ay mice (Fig. 3, arrows).

Changes in hepatic steatosis area at 14 weeks of age in female C57BL mice, db/db mice, and KK-Ay mice fed NC diet or HFSC diet (A) Relative area of microvesicular steatosis, (B) Relative area of macrovesicular steatosis, (C) Relative area of steatosis. Data represent means + standard deviation (n=5). *p<0.05, **p<0.01; significant difference between C57BL mice and db/db mice or KK-Ay mice in each diet. †p<0.05, ††p<0.01; significant difference between NC diet and HFSC diet in each strain.

Histological photographs of liver at 14 weeks of age in C57BL mice, db/db mice, and KK-Ay mice (A) Female C57BL mouse fed NC diet, (B) Female db/db mouse fed NC diet, (C) Female KK-Ay mouse fed NC diet, (D) Female C57BL mouse fed HFSC diet, (E) Female db/db mouse fed HFSC diet, (F) Female KK-Ay mouse fed HFSC diet. Hematoxylin and Eosin staining, Bar = 200µm. Arrows indicate inflammatory cells infiltration.
Hepatic fibrosis was analyzed in three anatomical regions: periportal, pericentral, and combined perivascular areas (Fig. 4). Representative fibrosis images are shown in Fig. 5. HFSC diet feeding was associated with increased fibrosis in all mice strains. Notably, in KK-Ay mice, pericentral fibrosis increased from 6.44 ± 2.06% (NC) to 11.2 ± 2.1% (HFSC), P = 0.059), and perivascular fibrosis increased from 5.94 ± 1.86% (NC) to 10.4 ± 1.5% (HFSC), P = 0.093), indicating a trend toward fibrosis development with HFSC diet.

Changes in hepatic fibrosis area at 14 weeks of age in C57BL mice, db/db mice, and KK-Ay mice fed NC diet or HFSC diet (A) Periportal Sirius red positive area, (B) Pericentral vein Sirius red positive area, (C) Perivascular Sirius red positive area. Data represent means + standard deviation (n=5).

Histological photographs of liver at 14 weeks of age in C57BL mice, db/db mice, and KK-Ay mice (A) Female C57BL mouse fed NC diet, (B) Female db/db mouse fed NC diet, (C) Female KK-Ay mouse fed NC diet, (D) Female C57BL mouse fed HFSC diet, (E) Female db/db mouse fed HFSC diet, (F) Female KK-Ay mouse fed HFSC diet. Sirius red staining, Bar = 200 µm.
Hepatic mRNA levels of genes related to lipid synthesis, inflammation, and fibrosis are shown in Fig. 6. Fas mRNA level increased in KK-Ay mice fed HFSC diet as compared with C57BL/6J mice fed HFSC diet or KK-Ay mice fed NC diet (Fig. 6A). Tnfα mRNA level increased in C57BL/6J mice fed HFSC diet as compared with C57BL/6J mice fed NC diet, and the level in diabetic mice fed HFSC diet tended to increase compared with that in diabetic mice fed NC diet (Fig. 6B). No significant changes were observed in αSma mRNA levels, although a tendency toward increased expression was observed under HFSC feeding (Fig. 6C). Col1a1 mRNA level increased in KK-Ay mice fed HFSC diet as compared with C57BL/6J mice fed HFSC diet, and the Col1a1 mRNA levels in both diabetic mice were increased after HFSC diet feeding (Fig. 6D).

mRNA expressions of liver at 14 weeks of age in C57BL mice, db/db mice, and KK-Ay mice fed NC diet or HFSC diet (A) Fas expression in female mice, (B) Tnf-α expression in female mice, (C) α-Sma expression in female mice, (D) Col1a1 expression in female mice. Data represent means + standard deviation (n=5). *p<0.05; significant difference between C57BL mice and db/db mice or KK-Ay mice in each diet. †p<0.05, ††p<0.01; significant difference between NC diet and HFSC diet in each strain. FAS; Fatty acid synthase, TNF-α; Tumor necrosis factor-α, α-SMA; α-Smooth muscle actin.
Steatotic liver disease (SLD) encompasses a spectrum ranging from MASLD to MASH, which may progress to cirrhosis and hepatocellular carcinoma. MASH is histologically characterized by hepatic cellular injury such as fatty degeneration, ballooning degeneration, inflammatory cell infiltration, and fibrosis (Bedossa, 2016; Yu et al., 2016; Brunt et al., 1999; Dowman et al., 2011). It is essential to develop animal models reflecting the pathophysiology and histopathology of human MASLD/MASH. MASLD/MASH rodent models, including genetic and diet-induced models, have been characterized (Zhong et al., 2020; Martin-Grau et al., 2022; Saigo et al., 2024).
In this study, we investigated the pathophysiological and histological features of two types of obese type 2 diabetic mice, db/db and KK-Ay mice, fed HFSC diet. The HFSC diet consisted of Quick Fat, a high-calorie feed for diabetes and obesity research (CLEA Japan Inc.), supplemented with 2% cholesterol, as used in our previous study (Toriniwa et al., 2018). Female mice were used because female KK-Ay mice exhibit significantly higher insulin levels compared to male (insulin levels of male KK-Ay mice in a separate study, 14.5 ± 6.5 ng/mL (n=5)). The HFSC diet did not increase blood glucose levels but increased lipid levels, especially cholesterol levels. Both diabetic mice fed the HFSC diet showed significant progression of hepatic steatosis, and KK-Ay mice fed the HFSC diet showed localized hepatic fibrosis. Hepatic lipid accumulation triggers lipotoxicity and induces MASH-like lesions (Li et al., 2024; Cao et al., 2025).
Blood cholesterol levels in diabetic mice fed the HFSC diet were markedly elevated, suggesting that hypercholesterolemia contributes to the development of fibrosis in diabetic mice. Dietary cholesterol intake is reportedly associated with the development of MASH in animal models (Toriniwa et al., 2018; Tous et al., 2006). Free cholesterol accumulates in the livers of cholesterol-loaded animal models, resulting in the progression of hepatic inflammation and development of hepatic fibrosis (Toriniwa et al., 2018; Wouters et al., 2008). In diabetic mice, mRNA expressions of an inflammatory gene (Tnfα) and a fibrotic gene (Col1a1) were increased or tended to increase following HFSC diet feeding. Moreover, excess lipid reportedly causes activation of hepatic stellate cells, which are involved in development of fibrosis (Scorletti and Carr, 2022; Yan et al., 2021), and in this study, db/db mice fed HFSC diet showed a mild increase in mRNA expression of αSma, which is a marker of activated hepatic stellate cells. In KK-Ay mice, although variability was high—partly due to an elevated value in an NC-fed sample—αSma expression tended to increase under HFSC feeding. The underlying reason for this variability remains unclear.
The present model exhibited key histopathological components of MASH, including hepatic steatosis, inflammatory cells infiltration, and fibrosis. Hepatic steatosis was robust, whereas inflammatory cell infiltration and fibrosis were limited and focal. These findings suggest that HFSC feeding in these mouse strains induces early-stage MASH-like pathology rather than fully developed disease. Further studies with longer feeding durations will be necessary to determine whether more advanced and progressive features of MASH can be established in this model. In addition, fibrosis appeared to be less pronounced in db/db mice than in KK-Ay mice. This difference may be related, at least in part, to impaired leptin signaling in db/db mice, as previous studies have demonstrated a role for leptin in promoting hepatic fibrogenesis (Imajo et al., 2012).
Blood ALT and AST levels—markers of liver injury—increased or tended to increase in diabetic mice fed the HFSC diet, suggesting mild hepatic injury, consistent with the presence of mild fibrosis observed histologically. The increase in liver weight in KK-Ay mice fed the HFSC diet was greater than that in db/db mice, and insulin resistance (hyperinsulinemia) may be involved in the background of this change. In addition, blood TG levels increased in KK-Ay mice fed the HFSC diet, suggesting a relationship with lipid accumulation in the liver.
The gut-liver axis is reportedly involved in the progression of liver diseases, including MASH (Jeyaraman et al., 2024). The gut and liver are interlinked through portal circulation and intestinal contents, including intestinal bacteria and their metabolites. The gut metabolites reach the liver directly via the portal vein. The intestine has barrier mechanisms, and disruption of the intestinal barrier function is one of the exacerbation factors of MASH (Brandl et al., 2017; Fukui, 2021). In this study, histopathological analysis of the intestine and expression analysis of tight junction-related factors were performed; however, no obvious changes were observed. Intestinal mRNA expression of CD36, which is involved in the uptake of fatty acids, was high in all mice fed the HFSC diet (data not shown). Because CD36 in the intestine plays a key role in altering lipid metabolism owing to excess fatty acid supply, it may be involved in lipid accumulation and insulin resistance due to obesity and high-fat diets (Glatz and Luiken, 2017). Elevated small intestinal CD36 levels are thought to play a role in lipotoxicity induction.
HFSC-fed db/db mice exhibited a reduction in serum triglyceride levels despite similar hepatic lipid accumulation to KK-Ay mice. Given that triglycerides are primarily exported from the liver as very low-density lipoproteins (VLDL), this discrepancy suggests differences in hepatic lipid handling between the two models. In KK-Ay mice, severe insulin resistance is accompanied by increased adipose tissue lipolysis and enhanced free fatty acid flux to the liver, which drive triglyceride synthesis and sustain VLDL production. (Hirano, 2018) In contrast, despite comparable hepatic lipid accumulation, db/db mice did not show an increase in serum TG levels under HFSC feeding, indicating impaired export of triglycerides from the liver. This suggests a defect in VLDL assembly or secretion. A possible mechanism is disruption of endoplasmic reticulum function by excessive lipid loading, particularly free fatty acid and cholesterol, which can impair apolipoprotein B lipidation and reduce VLDL output (Caviglia et al., 2011). Further studies are required to clarify the underlying mechanisms.
In conclusion, db/db mice and KK-Ay mice exhibited MASH-like lesions via chronic dislipidemia following high-fat/high-sucrose/high-cholesterol diet feeding, suggesting that obese type 2 diabetic mice may serve as animal model of early-stage MASH.
We wish to thank Mr. Masaaki Handa and Mr. Yoshinobu Doi (CLEA Japan) for providing animal and feed supplies, and thank Editage (www.editage.jp) for English language editing.
FundingThe authors received no specific funding for this work.
Conflict of interestThe authors declare no conflicts of interest.
Data availabilityThe data in this study are included in the article/supplementary materials. Contact the corresponding authors directly to request the underlying data.
Author contributionsConceptualization: Uno K, Ohta T, Miyajima K
Data curation: Uno K, Sasase T, Sugimoto M
Formal analysis: Uno K, Sugimoto M
Investigation: Shirasaka K, Muro Y, Kuroki F, Nishida M, Sekiguchi K, Yamaguchi K, Mandai K, Sasase T
Methodology: Ohta T
Project administration: Ohta T
Resources: Shinohara M
Software: Sugimoto M
Supervision: Maekawa T, Miyajima K, Ohta T
Validation: Uno K
Visualization: Uno K, Ohta T
Writing - original draft: Ohta T, Uno K
Writing - review & editing: Ohta T, Uno K.
Ethics approvalAll experimental protocols and animals were used in strict compliance with the Kyoto University guidelines for animal experimentation (Approval No. 31-107).
Patient consent for publicationNot applicable.