Changes in the expression of mexB, mexY, and oprD in clinical Pseudomonas aeruginosa isolates

Abstract

Changes in expression levels of drug efflux pump genes, mexB and mexY, and porin gene oprD in Pseudomonas aeruginosa were investigated in this study. Fifty-five multidrug-resistant P. aeruginosa (MDRP) strains were compared with 26 drug-sensitive strains and 21 strains resistant to a single antibiotic. The effect of the efflux inhibitor Phe-Arg-β-naphthylamide on drug susceptibility was determined, and gene expression was quantified using real-time quantitative real-time reverse transcription polymerase chain reaction. In addition, the levels of metallo-β-lactamase (MBL) and 6′-N-aminoglycoside acetyltransferase [AAC(6′)-Iae] were investigated. Efflux pump inhibitor treatment increased the sensitivity to ciprofloxacin, aztreonam, and imipenem in 71%, 73%, and 29% of MDRPs, respectively. MBL and AAC(6′)-Iae were detected in 38 (69%) and 34 (62%) MDRP strains, respectively. Meanwhile, 76% of MDRP strains exhibited more than 8-fold higher mexY expression than the reference strain PAO1. Furthermore, 69% of MDRP strains expressed oprD at levels less than 0.01-fold of those in PAO1. These findings indicated that efflux pump inhibitors in combination with ciprofloxacin or aztreonam might aid in treating MDRP infections.

1. Introduction

Pseudomonas aeruginosa infections, particularly those in immune-compromised patients, often result in life-threatening disease.^1),2) The low permeability of bacterial membranes facilitates their high inherent resistance to many antibiotics and disinfectants.^3)–5) Bacterial drug resistance can be increased quantitatively and qualitatively by the acquisition of additional drug resistance factors.^6),7) This intrinsic resistance in P. aeruginosa makes it difficult to eradicate this opportunistic pathogen from hospital environments. Multidrug-resistant P. aeruginosa (MDRP) (Table 1) strains invulnerable to major antipseudomonal agents such as carbapenems, quinolones, and aminoglycosides have become prevalent recently,^8),9) and they caused nosocomial outbreaks in Japan.^10),11) Few antibiotics including colistin are available for treating MDRP infections.¹²⁾ Tateda et al.¹³⁾ recommended the breakpoint checkerboard plate for selecting effective combinations among available antibiotics as an alternative solution to this problem.

Table 1. Abbreviations used in the text, tables, and figures

Abbreviation	Definition	Note
mexB	Multiple efflux B	Drug efflux pump gene
mexY	Multiple efflux Y	Drug efflux pump gene
oprD	Outer membrane protein D	Porin gene
MBL	Metallo-β-lactamase	Enzyme capable of hydrolyzing virtually all classes of β-lactams, excluding aztreonam
AAC(6′)-Iae	6′-N-aminoglycoside acetyltransferase	Enzyme capable of inactivating aminoglycoside antibiotics by acetylating amino groups
PAO1	Pseudomonas aeruginosa strain 1	Frequently used reference strain of Pseudomonas aeruginosa
SP	Drug-sensitive Pseudomonas aeruginosa	Isolates sensitive to all three agents (amikacin, ciprofloxacin, and imipenem)
RP	Drug-resistant Pseudomonas aeruginosa	Isolates resistant to one or two of the three agents (amikacin, ciprofloxacin, and imipenem)
MDRP	Multidrug-resistant Pseudomonas aeruginosa	Isolates resistant to all three agents (amikacin, ciprofloxacin, and imipenem)
MIC	Minimum inhibitory concentration	Minimum concentration of antibiotic needed to inhibit the growth of target bacteria
AMK	Amikacin	Aminoglycoside antibiotic
CIP	Ciprofloxacin	Quinolone antibiotic
IPM	Imipenem	Carbapenem antibiotic
ATM	Aztreonam	Monobactam antibiotic
PAN	Phe-Arg-β-naphthylamide	Efflux pump inhibitor
DPA	Dipicolinic acid	Metallo-β-lactamase inhibitor

MDRP isolates possess complex drug resistance mechanisms.^14)–17) Several barriers are known to attenuate β-lactam activity. First, the bacterium’s rather impermeable outer membrane decreases the access of most hydrophilic β-lactams to their target proteins in the periplasm. The outer membrane porin protein OprD allows the entry of carbapenems,^18),19) and oprD downregulation is among the most important mechanisms of resistance to this class of drugs.^20)–22) Second, chromosomal and transferable β-lactamases inactivate β-lactams in the periplasm. Among various β-lactamases identified in P. aeruginosa, metallo-β-lactamases (MBLs, class B)²³⁾ in particular can hydrolyze virtually all classes of β-lactams, excluding aztreonam (ATM).^24)–26) Finally, multidrug efflux pumps, especially resistance–nodulation–cell division (RND) family pumps, can decrease the sensitivity of P. aeruginosa to various toxic compounds.^27),28) The action of RND pumps alone can confer multidrug resistance (MDR).

Of the wide range of efflux pumps predicted from the P. aeruginosa genomic sequence,⁴⁾ 12 intrinsic efflux systems belong to the RND family. Of these, the MexAB–OprM and MexXY efflux systems are expressed constitutively.^29),30) By contrast, MexCD–OprJ upregulation is correlated with increased ciprofloxacin (CIP) resistance concomitant with higher susceptibility to certain β-lactams and aminoglycosides.³¹⁾ Similarly, we found that the transfer of plasmid-encoded mexEF–oprN increased the susceptibility of a major efflux pump deletion mutant to CIP (unpublished). Overproduction of minor efflux pumps is known to sometimes reduce drug resistance in P. aeruginosa. In addition to the aforementioned mechanisms, resistance to quinolones can occur because of mutations in DNA gyrase and/or topoisomerase IV.³²⁾ The expression of enzymes that modify aminoglycosides or their target sites on the ribosome³³⁾ can also confer aminoglycoside resistance. Increased efflux might additively or synergistically affect these mechanisms to further enhance resistance.³⁴⁾ The abundance of factors influencing the antibiotic susceptibility of P. aeruginosa makes it extremely difficult to evaluate all of them simultaneously. This accounts for some of the problems faced by clinicians attempting to rapidly detect MDRP strains.

Previous studies investigating the overexpression of efflux pump genes and decreased expression of oprD in some drug-resistant P. aeruginosa strains suggested a role for pumps and porin in MDR.^35)–37) However, this suggestion may not be substantiated because of insufficient data regarding the expression of these genes in sensitive strains. Therefore, to evaluate the suitability of efflux pumps and porin genes as MDR markers, we reasoned that it would be important to simultaneously examine the differences in mexB, mexY, and oprD expression in a large sample of drug-sensitive and drug-resistant strains.

MexB is known to export CIP and ATM, whereas MexY is known to export amikacin (AMK) and CIP.²⁸⁾ Imipenem (IPM) is unique among these drugs in that OprD porin mediates its transit through the outer membrane. oprD expression was compared among strains with differences in IPM susceptibility, as efflux pumps proved to have almost no effect on IPM resistance.^19),28) MBL and 6′-N-aminoglycoside acetyltransferase [AAC(6′)-Iae]^10),38),39) production was checked simultaneously. Phe-Arg-β-naphthylamide (PAN)⁴⁰⁾ was utilized to determine the effect of the efflux pumps on each drug resistance. PAN is a broad-spectrum inhibitor capable of inhibiting the efflux pumps of many bacteria, including P. aeruginosa and Escherichia coli, and it is effective in combination with many antibiotics. These findings strongly suggested that analyses of efflux pump activity and OprD status will aid in determining drug susceptibility. In this study, we evaluated mexB, mexY, and oprD expression in drug-resistant and drug-sensitive strains.

2. Materials and methods

2.1. Bacterial strains.

Based on the breakpoints recommended by CLSI, MDRP was defined as a strain that grew in the presence of 16 mg/L AMK, 2 mg/L CIP, and 8 mg/L IPM. Strains isolated from clinical specimens in the laboratories of BML, Inc. (Kawagoe, Japan) in 2007 were divided into three groups: MDRP, resistant to all three compounds; resistant P. aeruginosa (RP), resistant to one or two of the three agents; and sensitive P. aeruginosa (SP), sensitive to all three agents. Strains isolated from the same hospital that displayed similar sensitivity patterns were excluded from the list. We tested 55 MDRP, 21 RP, and 26 SP strains. PAO1 was used as a reference strain for quantitative real-time reverse transcription polymerase chain reaction (qRT-PCR). P. aeruginosa IMCJ2.S1 was provided by Dr. T. Kirikae and used as a reference strain producing AAC(6′)-Iae.³⁹⁾

2.2. Antimicrobial agents.

Antimicrobials included AMK (Banyu Pharmaceutical Co.), CIP (Meiji Seika Kaisha, Ltd., Tokyo, Japan), IPM (Banyu), and ATM (Eisai, Tokyo, Japan). Dipicolinic acid (DPA, Sigma-Aldrich, Tokyo, Japan)²⁶⁾ was used as an MBL inhibitor. PAN (Sigma-Aldrich)⁴⁰⁾ was used as an efflux pump inhibitor.

2.3. Determination of minimum inhibitory concentrations (MICs) and detection of MBL.

MICs were determined in the laboratories of BML, Inc. using the conventional agar dilution method (CLSI) with or without 50 mg/L PAN or 200 mg/L DPA. A strain exhibiting greater than 4-fold decreases in the MIC of IPM in the presence of DPA was defined as an MBL producer.

2.4. Detection of AAC(6′)-Iae.

AAC(6′)-Iae producers were identified using an immunochromatographic assay developed by Kitao et al.⁴¹⁾ The assay kit was generously provided by Mizuho Medy Co., Ltd. (Tosu, Saga, Japan).

2.5. Gene transcription analysis by qRT-PCR.

The expression of mexB, mexY, and oprD was evaluated by qRT-PCR. Strains were cultured overnight in BBL™ Trypticase™ soy broth (BBL: Becton, Dickinson and Company, Japan) and then inoculated into fresh broth until the culture reached an OD₆₀₀ of 0.6. Total RNA was isolated using a NucleoSpin RNA II kit (Nippon Genetics Co. Ltd., Tokyo, Japan), reverse-transcribed using TaqMan reverse transcription reagents, and analyzed using an ABI Prism 7000 Sequence Detection System (Applied Biosystems Japan, Tokyo, Japan) with a KAPA™ SYBR Fast qPCR kit (Nippon Genetics Co. Ltd.). The qRT-PCR primers (Table 2) were used as previously described.^35),37) Samples were run in duplicate. Mean gene expression levels were normalized to that of the ribosomal gene rpsL and compared after calculating the ratios of their levels to those of the reference strain PAO1. We evaluated the effects of PAN (50 mg/L) on gene expression in several strains.

Table 2. Primer sequences used for quantitative real-time reverse transcription-PCR

Gene	Primer	Sequence	Length	Reference
mexB	F	GTGTTCGGCTCGCAGTACTC	244	37
	R	AACCGTCGGGATTGACCTTG
mexY	F	CCGCTACAACGGCTATCCCT	246	37
	R	AGCGGGATCGACCAGCTTTC
oprD	F	CTCGACGGCACCTCCGACAAGAC	232	35
	R	AGCCCTTCGAATTCGCTGCTCTG
rpsL	F	GCAAGCGCATGGTCGACAAGA	201	35
	R	CGCTGTGCTCTTGCAGGTTGTGA

3. Results

3.1. Antimicrobial susceptibility of 102 clinical isolates and evaluation of the effects of PAN and DPA.

The effects of PAN on the cumulative MIC distribution of each antimicrobial agent are listed by strain and antimicrobial agent (Fig. 1). The effect of DPA on the IPM susceptibility of MDRP strains is also presented in Fig. 1-c-3. PAN significantly increased the susceptibility of 39 (71%) and 40 (73%) MDRP strains to CIP (Fig. 1-c-2) and ATM (Fig. 1-c-4), respectively. PAN also increased the susceptibility of 19 (90%) and 15 (71%) RP strains to CIP (Fig. 1-b-2) and ATM (Fig. 1-b-4), respectively. PAN decreased the ATM MICs of two (9.5%) RP strains and nine (16.4%) MDRP strains by more than 16-fold. PAN also increased the susceptibility of 16 (29%) MDRP strains to IPM, although this effect was not as significant as that achieved using the MBL inhibitor DPA (Fig. 1-c-3). Conversely, PAN decreased the AMK susceptibility of many strains by 2–4-fold (Fig. 1-a-1, b-1, c-1), and its antagonistic effect was easily detected in sensitive strains (Fig. 1-a-1).

Fig. 1.

Cumulative MICs for each antimicrobial agent in the presence or absence of the inhibitors. AMK, CIP, IPM, and ATM + PAN: combination treatment with PAN; +DPA: combination treatment with DPA. a)-1–a)-4 SP: 26 drug-sensitive strains; b)-1–b)-4 RP: 21 drug-resistant strains excluding MDR, and c)-1–c)-4 MDRP: 55 MDR strains. The horizontal axis shows the MIC concentration of each antibacterial agent (mg/L), and the vertical axis shows the cumulative percentage of isolates whose growth was inhibited at the corresponding MIC concentration of each antibacterial agent. MIC, minimum inhibitory concentration; AMK, amikacin; CIP, ciprofloxacin; IPM, imipenem; ATM, aztreonam; PAN, Phe-Arg-β-naphthylamide; DPA, dipicolinic acid; SP, drug-sensitive Pseudomonas aeruginosa; RP, drug-resistant Pseudomonas aeruginosa; MDRP, multidrug-resistant Pseudomonas aeruginosa.

3.2. MBL production.

DPA increased IPM susceptibility by more than 4-fold in 38 MDRP strains (69%, Fig. 1-c-3). These MBL producers were highly resistant to IPM, but some were not resistant to ATM. MDRP strains were divided into two groups based on MBL production. The effect of PAN on IPM or ATM susceptibility was compared in these groups (Fig. 2). IPM is a poor pump substrate, and ATM is a MexB-specific substrate. PAN exerted a greater effect on the ATM susceptibility of MBL-producing strains than on non-producing strains (mean MIC change 0.222-fold vs. 0.438-fold, t = −2.60, df = 22, p < 0.05). However, this did not hold for IPM sensitivity. These findings suggested that MBL-producing strains express higher levels of MexB not only at the transcriptional level (Table 3) but also at the translational level. Furthermore, MDRP isolates were the only strains found to produce MBL.

Fig. 2.

MBL production and effect of PAN on the cumulative MICs for IPM and ATM. The horizontal axis shows the MIC concentration of each antibacterial agent (mg/L), and the vertical axis shows the cumulative percentage of isolates whose growth was inhibited at the corresponding MIC concentration of each antibacterial agent. MBL, metallo-β-lactamase; PAN, Phe-Arg-β-naphthylamide; MIC, minimum inhibitory concentration; IPM, imipenem; ATM, aztreonam.

Table 3. Distribution of the expression of mexB, mexY, and oprD in each susceptibility group

Gene/factor	Expression ratio to PAO1	SP (26)* N (%)	RP (21)* N (%)	MDRP (55)* N (%)	MDRP (−)MBL (17)* N (%)	MDRP (+)MBL (38)* N (%)
mexB	<2	10 (38)	8 (38)	10 (18)	7 (41)	3 (7.9)
	2–4	6 (23)	5 (24)	16 (29)	5 (29)	11 (29)
	4–8	7 (27)	6 (29)	16 (29)	4 (24)	12 (32)
	>8	3 (12)	2 (10)	13 (24)	1 (5.9)	12 (32)
mexY	<2	6 (23)	2 (9.5)	2 (3.6)	0	2 (5.3)
	2–4	8 (31)	1 (4.8)	4 (7.3)	1 (5.9)	3 (7.9)
	4–8	7 (27)	5 (24)	7 (13)	2 (12)	5 (13)
	>8	5 (19)	13 (62)	42 (76)	14 (82)	28 (74)
oprD	>0.5	13 (50)	6 (29)	6 (11)	3 (18)	3 (7.9)
	0.1–0.5	1 (3.8)	6 (29)	10 (18)	4 (24)	6 (16)
	0.01–0.1	4 (15)	1 (4.8)	1 (1.8)	1 (5.9)	0
	<0.01	8 (31)	8 (38)	38 (69)	9 (53)	29 (76)
MBL		0	0	38 (69)	0	38 (100)
AAC(6′)-Iae		0	0	34 (62)	2 (12)	32 (84)
mexB	>4	10 (38)	8 (38)	29 (53)	5 (29)	24 (63)
mexY	>8	5 (19)	13 (62)	42 (76)	16 (94)	33 (87)
oprD	<0.01	8 (31)	8 (38)	38 (69)	9 (53)	29 (76)

*, number of strains in each group; N, number of strains.

MBL, metallo-β-lactamase; AAC(6′)-Iae, 6′-N-aminoglycoside acetyltransferase; SP, drug-sensitive Pseudomonas aeruginosa; RP, drug-resistant Pseudomonas aeruginosa; MDRP, multidrug-resistant Pseudomonas aeruginosa.

3.3. Production of AAC(6′)-Iae.

Detectable levels of AAC(6′)-Iae were observed in 34 (62%) MDRP strains. Only two of these strains did not produce MBL. AAC(6′)-Iae and MBL were not produced by RP or SP strains. However, 15 (27%) MDRP strains did not produce MBL or AAC(6′)-Iae.

3.4. Expression of mexB, mexY, and oprD in relation to MDR in P. aeruginosa.

The mean mexB, mexY, and oprD levels compared with that of rpsL in PAO1 were 0.054, 0.0042, and 0.37, respectively. The ratio of the levels of the three genes in the tested strains to those in PAO1 revealed four distinguishable groups (Table 3). Significant changes were defined as differences greater than 4-fold for mexB, greater than 8-fold for mexY, and less than 0.01-fold for oprD versus the findings in the reference strain. The distribution patterns of concomitant changes in expression of these resistance factors are illustrated in Fig. 3. MDRP strains were divided into two groups based on MBL production. Concurrent changes in the expression of the three genes were especially common in MBL-producing MDRP strains. Although more changes in gene expression tended to occur in MDRP strains, we did not ignore extreme changes in gene expression in some SP strains. We found that PAN suppressed gene expression to some extent, and these changes were correlated with measurable growth suppression. However, the effect of PAN on the expression of the three genes was non-significant (data not shown).

Fig. 3.

Combinatorial patterns of resistance factors among the resistance groups. By defining the effective expression changes as greater than 4-fold for mexB, greater than 8-fold for mexY, and less than 0.01-fold for oprD, frequencies of zero, one, two, or three changes in the expression of the genes are presented for each group. SP: 26 drug-sensitive strains; RP: 21 drug-resistant strains excluding MDR; MDRP (−)MBL: 17 MDR strains that did not produce MBL; MDRP (+)MBL: 38 MDR strains producing MBL. MDR, multidrug resistance; MDRP, multidrug-resistant Pseudomonas aeruginosa; MBL, metallo-β-lactamase.

3.5. Correlation between drug susceptibility and the levels of mexB, mexY, and oprD.

The relationship between gene expression and resistance levels with respect to each antimicrobial agent is illustrated in Figs. 4–6. Although the correlation between mexB expression and CIP (r = 0.0739) or ATM (r = 0.0738) resistance levels was unclear, a correlative trend between mexY expression and AMK (r = 0.2747) or CIP (r = 0.3686) resistance levels was discerned. However, some sensitive strains displayed higher expression of these genes (Figs. 4 and 5). A negative correlation was observed between oprD expression and IPM resistance levels (r = −0.2426), although some sensitive strains displayed atypically lower oprD expression (Fig. 6).

Fig. 4.

Correlation between the levels of mexB and the MICs for CIP or ATM. Gene levels are presented as ratios of the test strain value to that of the reference strain PAO1. MIC, minimum inhibitory concentration; CIP, ciprofloxacin; ATM, aztreonam.

Fig. 5.

Correlation between the levels of mexY and the MICs for AMK or CIP. Gene levels are presented as ratios of the test strain value to that of the reference strain PAO1. MIC, minimum inhibitory concentration; AMK, amikacin; CIP, ciprofloxacin.

Fig. 6.

Correlation between the levels of oprD and MICs for IPM. Gene levels are presented as ratios of the test strain value to that of the reference strain PAO1. The dashed rectangle denotes decreased expression of oprD in sensitive strains. MIC, minimum inhibitory concentration; IPM, imipenem.

4. Discussion

We evaluated the effects of PAN, a multiple-efflux pump inhibitor in Gram-negative bacteria,^33),40) on the drug susceptibility of P. aeruginosa. Three different classes of major antipseudomonal agents, AMK, CIP, and IPM, were used in combination with PAN. In addition, ATM was tested as the only β-lactam resistant to hydrolysis by MBL.^25),26) In parallel, MBL producers were analyzed with respect to whether DPA significantly altered IPM susceptibility in relation to AAC(6′)-Iae production^10),38) as determined by an immunochromatographic assay.⁴¹⁾ We also determined the expression of mexB and mexY using qRT-PCR and evaluated the frequency of efflux pump overproduction in relation to drug resistance. oprD expression was tested simultaneously in drug-sensitive and drug-resistant strains. PAN increased the susceptibility of MDRP and RP strains to all drugs excluding AMK, suggesting that increased efflux contributes to drug resistance in P. aeruginosa. However, PAN also increased the susceptibility of SP strains to CIP and ATM. Efflux pump inhibitors can potentiate the basal activity of these agents against SP strains. The effect of PAN was significant in combination with either CIP or ATM. PAN also exerted a detectable effect on the IPM susceptibility of RP and MDRP strains. Although IPM is not a MexB or MexY substrate²⁸⁾ it might act through a weak membrane-permeabilizing effect of PAN on strains with lower oprD expression. However, a contribution by MexF⁴²⁾ cannot be dismissed by our data. MBL and AAC(6′)-Iae production was detected only in MDRP strains. The functions of several resistance factors in MDRP strains were also demonstrated.

The correlations between the expression of these genes and resistance to a specific antibiotic were less than definitive. However, mexY upregulation was more pronounced than that of mexB and more frequent among the MDRP strains tested. A high percentage of MDRP strains exhibited relatively low expression of oprD. The ATM susceptibility of MBL-producing MDRP strains, in contrast to that of MDRP strains that did not produce MBL, was affected by PAN. This finding correlated with the relatively higher expression of mexB in MBL-producing MDRPs. MexAB–OprM is regarded as the major and most efficient efflux pump for the extrusion of various antibiotics. Thus, small increases in its expression might significantly alter drug susceptibility. By contrast, the transcription levels of minor pumps may need to be strongly upregulated to affect antibiotic susceptibility. When we defined significant changes as more than 4-fold for mexB, more than 8-fold for mexY, and less than 0.01-fold for oprD relative to the findings in the reference strain, the coincidence of these changes was high (47%) in MBL-producing MDRPs. One explanation of these findings might be that drug-resistant strains acquire resistance factors more readily than drug-sensitive strains.

Aminoglycosides are known substrates of MexY, but not MexB.²⁸⁾ A major mechanism responsible for resistance to aminoglycosides in P. aeruginosa is overproduction of the MexXY efflux pump.⁴³⁾ In addition, the antagonistic effects of PAN on the antipseudomonal activity of aminoglycosides have been reported, and MexY is required for antagonism between aminoglycosides and PAN (or a divalent cation).⁴⁴⁾ The findings of this study illustrated that although MexY overproduction was roughly correlated with decreased susceptibility to AMK, PAN antagonized the AMK susceptibility of many strains in the absence of mexY upregulation. Furthermore, we could not discern antagonism between AMK and PAN in one CIP-sensitive strain that expressed mexY at a level less than 0.1% of that in PAO1. As PAN is cationic, it could possibly compete with polycationic aminoglycosides for binding to the outer membrane and inhibit their penetration into cells. This barrier might not be strong, and antagonism was not observed in the absence of MexY.

A recent analysis of P. aeruginosa clinical isolates exhibiting moderate resistance to CIP obtained from patients who received fluoroquinolone therapy revealed increased MexCD–OprJ expression. This was correlated with heightened resistance to CIP, cefepime, and chloramphenicol. However, greater sensitivity to ticarcillin, ATM, IPM, and aminoglycosides was simultaneously observed.³¹⁾ Stickland et al.⁴⁵⁾ isolated a novel P. aeruginosa nfxB mutant that overexpressed the MexCD–OprJ efflux pump, thereby causing metabolic dysregulation characterized by pleiotropic proteomic changes and a striking defect in competitive fitness. These findings led us to suggest that MexXY overexpression can cause similar defects. Of course, other factors might either contribute to or solely account for the antagonism between PAN and AMK.

Intriguingly, all of our recent isolates that were sensitive to all antibiotics exhibited decreased membrane permeability, increased expression of mexB and mexY, or decreased expression of oprD. We analyzed genomic DNA using real-time PCR, and we could dismiss the possibility of sequence variation in oprD⁴⁶⁾ that may result in decreased sensitivity of qRT-PCR assays for sensitive strains exhibiting lower oprD expression (data not shown). Although the transcription level of a gene does not always correspond to the level of its translational product, we found it difficult to ignore mexB and mexY overexpression in some SP strains. The data reported by El Amin et al.⁴⁷⁾ supported our findings, although they analyzed fewer strains. Low permeability rates of antibiotics represent an advantage in instances in which a secondary resistance mechanism exists. Although it is almost silent in drug-sensitive strains, overexpression of efflux pumps might easily cause increased drug resistance when another resistance factor is acquired.

Our findings demonstrated the universal occurrence of efflux pump overproduction in clinical isolates, even in drug-sensitive strains. They offer hope for overcoming drug resistance in well-armed MDRP strains by treatment with efflux pump inhibitors in combination with CIP or ATM. Clinicians still face difficult practical problems involved in testing P. aeruginosa isolates for drug sensitivity using assays for efflux pump activity or OprD loss. One promising approach to this problem might involve testing for MBL or AAC(6′)-Iae, which are potentially strong markers of MDRP strains.⁴⁸⁾ Although not all MDRP strains may be affected, it appears reasonable to conclude that significant numbers of patients can benefit. Nevertheless, we are clearly faced with the challenge of developing novel rapid drug sensitivity detection tests that consider the multiplicity of resistance mechanisms in P. aeruginosa.

Acknowledgements

We are grateful to Dr. Teruo Kirikae for providing P. aeruginosa IMCJ2.S1, and also to Mizuho Medy Co., Ltd. for providing AAC(6′)-Iae immunochromatographic assay kits.

This study was supported by a Grant for Promotion of Fundamental Studies in Health Sciences of the National Institute of Biomedical Innovation (Project ID 07-03); the Research Program for CORE lab and CORE²-A lab of “Dynamic Alliance for Open Innovation Bridging Human, Environment and Materials” in “Network Joint Research Center for Materials and Devices”; the Center of Innovation Program (COI) and Core Research for Evolutional Science and Technology (CREST) from the Japan Science and Technology Agency (JST); Japan Agency for Medical Research and Development (AMED); Grants-in-Aid, Network Joint Research Center for Materials and Devices, and Dynamic Alliance for Open Innovation Bridging Human, Environment and Materials of the Ministry of Education, Culture, Sports, Science and Technology of Japan (MEXT); Grant-in-Aid for Scientific Research (B) (Kakenhi 17H03983, 23H02631), Challenging Research (Exploratory) (Kakenhi 18K19451, 22K19831) and Grant-in-Aid for Early-Career Scientists (Kakenhi 18K14902, 21K16318) from the Japan Society for the Promotion of Science (JSPS); Takeda Science Foundation; International Joint Research Promotion Program of Osaka University; The Nippon Foundation-Osaka University Project for Infectious Disease Prevention.

Notes

Edited by Shigekazu NAGATA, M.J.A.

Correspondence should be addressed to: K. Nishino, SANKEN (The Institute of Scientific and Industrial Research), Osaka University, 8-1 Mihogaoka, Ibaraki, Osaka 567-0047, Japan (e-mail: [e-mail]).

Footnotes

These authors contributed equally to this study.

References

• 1)   Hakki,  M.,  Limaye,  A.P.,  Kim,  H.W.,  Kirby,  K.A.,  Corey,  L. and  Boeckh,  M. (2007) Invasive Pseudomonas aeruginosa infections: high rate of recurrence and mortality after hematopoietic cell transplantation. Bone Marrow Transplant. 39, 687–693.
• 2)   Wagner,  V.E. and  Iglewski,  B.H. (2008) P. aeruginosa biofilms in CF infection. Clin. Rev. Allergy Immunol. 35, 124–134.
• 3)   Nikaido,  H. (1994) Prevention of drug access to bacterial targets: permeability barriers and active efflux. Science 264, 382–388.
• 4)   Schweizer,  H.P. (2003) Efflux as a mechanism of resistance to antimicrobials in Pseudomonas aeruginosa and related bacteria: unanswered questions. Genet. Mol. Res. 2, 48–62.
• 5)   Pagès,  J.M.,  James,  C.E. and  Winterhalter,  M. (2008) The porin and the permeating antibiotic: a selective diffusion barrier in Gram-negative bacteria. Nat. Rev. Microbiol. 6, 893–903.
• 6)   Henrichfreise,  B.,  Wiegand,  I.,  Pfister,  W. and  Wiedemann,  B. (2007) Resistance mechanisms of multiresistant Pseudomonas aeruginosa strains from Germany and correlation with hypermutation. Antimicrob. Agents Chemother. 51, 4062–4070.
• 7)   Giske,  C.G.,  Buarø,  L.,  Sundsfjord,  A. and  Wretlind,  B. (2008) Alterations of porin, pumps, and penicillin-binding proteins in carbapenem resistant clinical isolates of Pseudomonas aeruginosa. Microb. Drug Resist. 14, 23–30.
• 8)   Kirikae,  T.,  Mizuguchi,  Y. and  Arakawa,  Y. (2008) Investigation of isolation rates of Pseudomonas aeruginosa with and without multidrug resistance in medical facilities and clinical laboratories in Japan. J. Antimicrob. Chemother. 61, 612–615.
• 9)   Sekiguchi,  J.,  Teruya,  K.,  Horii,  K.,  Kuroda,  E.,  Konosaki,  H.,  Mizuguchi,  Y. et al. (2007) Molecular epidemiology of outbreaks and containment of drug-resistant Pseudomonas aeruginosa in a Tokyo hospital. J. Infect. Chemother. 13, 418–422.
• 10)   Sekiguchi,  J.,  Asagi,  T.,  Miyoshi-Akiyama,  T.,  Kasai,  A.,  Mizuguchi,  Y.,  Araake,  M. et al. (2007) Outbreaks of multidrug-resistant Pseudomonas aeruginosa in community hospitals in Japan. J. Clin. Microbiol. 45, 979–989.
• 11)   Satoh,  R.,  Tsukada,  H.,  Tanabe,  Y.,  Tamura,  Y.,  Yamamoto,  T.,  Takano,  M. et al. (2008) An outbreak and isolation of drug-resistant Pseudomonas aeruginosa at Niigata University Hospital, Japan. J. Infect. Chemother. 14, 325–329.
• 12)   Aoki,  N.,  Tateda,  K.,  Kikuchi,  Y.,  Kimura,  S.,  Miyazaki,  C.,  Ishii,  Y. et al. (2009) Efficacy of colistin combination therapy in a mouse model of pneumonia caused by multidrug-resistant Pseudomonas aeruginosa. J. Antimicrob. Chemother. 63, 534–542.
• 13)   Tateda,  K.,  Ishii,  Y.,  Matsumoto,  T. and  Yamaguchi,  K. (2006) “Break-point Checkerboard Plate” for screening of appropriate antibiotic combinations against multidrug-resistant Pseudomonas aeruginosa. Scand. J. Infect. Dis. 38, 268–272.
• 14)   Mesaros,  N.,  Nordmann,  P.,  Plésiat,  P.,  Roussel-Delvallez,  M.,  Van Eldere,  J.,  Glupczynski,  Y. et al. (2007) Pseudomonas aeruginosa: resistance and therapeutic options at the turn of the new millennium. Clin. Microbiol. Infect. 13, 560–578.
• 15)   Strateva,  T. and  Yordanov,  D. (2009) Pseudomonas aeruginosa - a phenomenon of bacterial resistance. J. Med. Microbiol. 58, 1133–1148.
• 16)   Livermore,  D.M. (2002) Multiple mechanisms of antimicrobial resistance in Pseudomonas aeruginosa: our worst nightmare? Clin. Infect. Dis. 34, 634–640.
• 17)   Lister,  P.D.,  Wolter,  D.J. and  Hanson,  N.D. (2009) Antibacterial-resistant Pseudomonas aeruginosa: clinical impact and complex regulation of chromosomally encoded resistance mechanisms. Clin. Microbiol. Rev. 22, 582–610.
• 18)   Huang,  H. and  Hancock,  R.E. (1993) Genetic definition of the substrate selectivity of outer membrane porin protein OprD of Pseudomonas aeruginosa. J. Bacteriol. 175, 7793–7800.
• 19)   Köhler,  T.,  Michea-Hamzehpour,  M.,  Epp,  S.F. and  Pechere,  J.C. (1999) Carbapenem activities against Pseudomonas aeruginosa: respective contributions of OprD and efflux systems. Antimicrob. Agents Chemother. 43, 424–427.
• 20)   Maniati,  M.,  Ikonomidis,  A.,  Mantzana,  P.,  Daponte,  A.,  Maniatis,  A.N. and  Pournaras,  S. (2007) A highly carbapenem-resistant Pseudomonas aeruginosa isolate with a novel blaVIM-4/blaP1b integron overexpresses two efflux pumps and lacks OprD. J. Antimicrob. Chemother. 60, 132–135.
• 21)   Quale,  J.,  Bratu,  S.,  Gupta,  J. and  Landman,  D. (2006) Interplay of efflux system, ampC, and oprD expression in carbapenem resistance of Pseudomonas aeruginosa clinical isolates. Antimicrob. Agents Chemother. 50, 1633–1641.
• 22)   Ballestero,  S.,  Fernández-Rodríguez,  A.,  Villaverde,  R.,  Escobar,  H.,  Pérez-Díaz,  J.C. and  Baquero,  F. (1996) Carbapenem resistance in Pseudomonas aeruginosa from cystic fibrosis patients. J. Antimicrob. Chemother. 38, 39–45.
• 23)   Nordmann,  P. and  Poirel,  L. (2002) Emerging carbapenemases in Gram-negative aerobes. Clin. Microbiol. Infect. 8, 321–331.
• 24)   Senda,  K.,  Arakawa,  Y.,  Nakashima,  K.,  Ito,  H.,  Ichiyama,  S.,  Shimokata,  K. et al. (1996) Multifocal outbreaks of metallo-β-lactamase-producing Pseudomonas aeruginosa resistant to broad-spectrum β-lactams, including carbapenems. Antimicrob. Agents Chemother. 40, 349–353.
• 25)   Koh,  T.H.,  Yamaguchi,  K. and  Ishii,  Y. (2008) Characterisation of the metallo-β-lactamase VIM-6 and its genetic support. Int. J. Antimicrob. Agents 32, 446–449.
• 26)   Kimura,  S.,  Ishii,  Y. and  Yamaguchi,  K. (2005) Evaluation of dipicolinic acid for detection of IMP- or VIM-type metallo-β-lactamase-producing Pseudomonas aeruginosa clinical isolates. Diagn. Microbiol. Infect. Dis. 53, 241–244.
• 27)   Ryan,  B.M.,  Dougherty,  T.J.,  Beaulieu,  D.,  Chuang,  J.,  Dougherty,  B.A. and  Barrett,  J.F. (2001) Efflux in bacteria: what do we really know about it? Expert Opin. Investig. Drugs 10, 1409–1422.
• 28)   Masuda,  N.,  Sakagawa,  E.,  Ohya,  S.,  Gotoh,  N.,  Tsujimoto,  H. and  Nishino,  T. (2000) Substrate specificities of MexAB-OprM, MexCD-OprJ, and MexXY-oprM efflux pumps in Pseudomonas aeruginosa. Antimicrob. Agents Chemother. 44, 3322–3327.
• 29)   Llanes,  C.,  Hocquet,  D.,  Vogne,  C.,  Benali-Baitich,  D.,  Neuwirth,  C. and  Plésiat,  P. (2004) Clinical strains of Pseudomonas aeruginosa overproducing MexAB-OprM and MexXY efflux pumps simultaneously. Antimicrob. Agents Chemother. 48, 1797–1802.
• 30)   Morita,  Y.,  Kimura,  N.,  Mima,  T.,  Mizushima,  T. and  Tsuchiya,  T. (2001) Roles of MexXY- and MexAB-multidrug efflux pumps in intrinsic multidrug resistance of Pseudomonas aeruginosa PAO1. J. Gen. Appl. Microbiol. 47, 27–32.
• 31)   Jeannot,  K.,  Elsen,  S.,  Köhler,  T.,  Attree,  I.,  van Delden,  C. and  Plésiat,  P. (2008) Resistance and virulence of Pseudomonas aeruginosa clinical strains overproducing the MexCD-OprJ efflux pump. Antimicrob. Agents Chemother. 52, 2455–2462.
• 32)   Akasaka,  T.,  Tanaka,  M.,  Yamaguchi,  A. and  Sato,  K. (2001) Type II topoisomerase mutations in fluoroquinolone-resistant clinical strains of Pseudomonas aeruginosa isolated in 1998 and 1999: role of target enzyme in mechanism of fluoroquinolone resistance. Antimicrob. Agents Chemother. 45, 2263–2268.
• 33)   Poole,  K. (2005) Aminoglycoside resistance in Pseudomonas aeruginosa. Antimicrob. Agents Chemother. 49, 479–487.
• 34)   Nakajima,  A.,  Sugimoto,  Y.,  Yoneyama,  H. and  Nakae,  T. (2002) High-level fluoroquinolone resistance in Pseudomonas aeruginosa due to interplay of the MexAB-OprM efflux pump and the DNA gyrase mutation. Microbiol. Immunol. 46, 391–395.
• 35)   Dumas,  J.L.,  van Delden,  C.,  Perron,  K. and  Köhler,  T. (2006) Analysis of antibiotic resistance gene expression in Pseudomonas aeruginosa by quantitative real-time-PCR. FEMS Microbiol. Lett. 254, 217–225.
• 36)   Mesaros,  N.,  Glupczynski,  Y.,  Avrain,  L.,  Caceres,  N.E.,  Tulkens,  P.M. and  Van Bambeke,  F. (2007) A combined phenotypic and genotypic method for the detection of Mex efflux pumps in Pseudomonas aeruginosa. J. Antimicrob. Chemother. 59, 378–386.
• 37)   Yoneda,  K.,  Chikumi,  H.,  Murata,  T.,  Gotoh,  N.,  Yamamoto,  H.,  Fujiwara,  H. et al. (2005) Measurement of Pseudomonas aeruginosa multidrug efflux pumps by quantitative real-time polymerase chain reaction. FEMS Microbiol. Lett. 243, 125–131.
• 38)   Sekiguchi,  J.,  Asagi,  T.,  Miyoshi-Akiyama,  T.,  Fujino,  T.,  Kobayashi,  I.,  Morita,  K. et al. (2005) Multidrug-resistant Pseudomonas aeruginosa strain that caused an outbreak in a neurosurgery ward and its aac(6′)-Iae gene cassette encoding a novel aminoglycoside acetyltransferase. Antimicrob. Agents Chemother. 49, 3734–3742.
• 39)   Kitao,  T.,  Miyoshi-Akiyama,  T. and  Kirikae,  T. (2009) AAC(6′)-Iaf, a novel aminoglycoside 6′-N-acetyltransferase from multidrug-resistant Pseudomonas aeruginosa clinical isolates. Antimicrob. Agents Chemother. 53, 2327–2334.
• 40)   Lomovskaya,  O.,  Warren,  M.S.,  Lee,  A.,  Galazzo,  J.,  Fronko,  R.,  Lee,  M. et al. (2001) Identification and characterization of inhibitors of multidrug resistance efflux pumps in Pseudomonas aeruginosa: novel agents for combination therapy. Antimicrob. Agents Chemother. 45, 105–116.
• 41)   Kitao,  T.,  Miyoshi-Akiyama,  T.,  Shimada,  K.,  Tanaka,  M.,  Narahara,  K.,  Saito,  N. et al. (2010) Development of an immunochromatographic assay for the rapid detection of AAC(6′)-Iae-producing multidrug-resistant Pseudomonas aeruginosa. J. Antimicrob. Chemother. 65, 1382–1386.
• 42)   Ochs,  M.M.,  McCusker,  M.P.,  Bains,  M. and  Hancock,  R.E. (1999) Negative regulation of the Pseudomonas aeruginosa outer membrane porin OprD selective for imipenem and basic amino acids. Antimicrob. Agents Chemother. 43, 1085–1090.
• 43)   Islam,  S.,  Jalal,  S. and  Wretlind,  B. (2004) Expression of the MexXY efflux pump in amikacin-resistant isolates of Pseudomonas aeruginosa. Clin. Microbiol. Infect. 10, 877–883.
• 44)   Mao,  W.,  Warren,  M.S.,  Lee,  A.,  Mistry,  A. and  Lomovskaya,  O. (2001) MexXY-OprM efflux pump is required for antagonism of aminoglycosides by divalent cations in Pseudomonas aeruginosa. Antimicrob. Agents Chemother. 45, 2001–2007.
• 45)   Stickland,  H.G.,  Davenport,  P.W.,  Lilley,  K.S.,  Griffin,  J.L. and  Welch,  M. (2010) Mutation of nfxB causes global changes in the physiology and metabolism of Pseudomonas aeruginosa. J. Proteome Res. 9, 2957–2967.
• 46)   Chevalier,  S.,  Bodilis,  J.,  Jaouen,  T.,  Barray,  S.,  Feuilloley,  M.G. and  Orange,  N. (2007) Sequence diversity of the OprD protein of environmental Pseudomonas strains. Environ. Microbiol. 9, 824–835.
• 47)   El Amin,  N.,  Giske,  C.G.,  Jalal,  S.,  Keijser,  B.,  Kronvall,  G. and  Wretlind,  B. (2005) Carbapenem resistance mechanisms in Pseudomonas aeruginosa: alterations of porin OprD and efflux proteins do not fully explain resistance patterns observed in clinical isolates. APMIS 113, 187–196.
• 48)   Motoshima,  M.,  Yanagihara,  K.,  Yamamoto,  K.,  Morinaga,  Y.,  Matsuda,  J.,  Sugahara,  K. et al. (2008) Quantitative detection of metallo-beta-lactamase of blaIMP-cluster-producing Pseudomonas aeruginosa by real-time polymerase chain reaction with melting curve analysis for rapid diagnosis and treatment of nosocomial infection. Diagn. Microbiol. Infect. Dis. 61, 222–226.