2016 Volume 39 Issue 5 Pages 712-720
Bisphosphonates (BPs) are used against diseases involving increased bone-resorption. Among BPs, nitrogen-containing BPs (N-BPs) have much stronger anti-bone-resorptive effects than non-nitrogen-containing BPs (non-N-BPs). However, N-BPs carry the risk of inflammatory/necrotic effects, including osteonecrosis of jawbones. When injected into mouse ear-pinnas, N-BPs induce inflammatory/necrotic effects within the ear-pinna. We previously found that (a) the non-N-BPs clodronate and etidronate can reduce such side effects of N-BPs, and (b) phosphonoformate (an inhibitor of the phosphate transporters SLC20 and SLC34) can reduce the inflammatory/necrotic effects of zoledronate (the N-BP with the highest reported risk of side effects). However, it is not clear (i) whether phosphonoformate can reduce the side effects of other N-BPs, too, and (ii) whether other phosphonocarboxylates have such inhibitory effects. Here, using the mouse ear-pinna model, we compared the effects of etidronate, clodronate, and four phosphonocarboxylates on the inflammatory/necrotic effects of N-BPs of the alkyl type (alendronate) or cyclic type (zoledronate and minodronate). Like phosphonoformate, the other three phosphonocarboxylates protected against the inflammatory/necrotic effects of all the N-BPs. The protective potencies were clodronate>etidronate>phosphonoacetate>phosphonoformate>phosphonopropionate>phosphonobutyrate. With a similar order of potencies, these agents reduced the amount of 3H-alendronate retained within the ear-pinna after its injection therein. The mRNAs of SLC20 and SLC34 were detected in untreated ear-pinnas. These findings suggest that the inhibition of phosphate transporters by phosphonocarboxylates, as well as by etidronate and clodronate, might be a useful preventive strategy against the side effects of both alkyl- and cyclic-type N-BPs.
Bisphosphonates (BPs), which are widely used anti-bone-resorptive drugs, are of two types: nitrogen-containing BPs (N-BPs) and non-nitrogen-containing BPs (non-N-BPs) (Fig. 1). Because N-BPs have much stronger effects than non-N-BPs,1,2) they are used clinically much more than non-N-BPs. Structurally, there are alkyl and cyclic types of N-BPs, alendronate being an example of the former, and zoledronate and minodronate examples of the latter (Fig. 1). Unfortunately, both types of N-BPs carry the risk of inflammatory/necrotic side effects. These include fever and osteomyelitis, and also osteonecrosis of jawbones (ONJ) with ensuing exposure of the necrotic jawbones.3) Indeed, many cases of N-BP-related osteonecrosis of the jaw (BRONJ) have been reported among patients given intravenous N-BPs, while oral treatment of osteoporosis with N-BPs can also cause ONJ.4) With oral N-BPs, there is a risk of gastrointestinal injuries, too.5) Because of the usefulness of N-BPs against bone-resorptive diseases, strategies to overcome their side effects would be welcomed by clinicians and patients alike.

Bisphosphonates (BPs), with a non-hydrolysable P-C-P structure, are the analogs of pyrophosphate (PPi), which has a hydrolysable P-O-P structure. There are two types of BPs, the nitrogen-containing BPs (N-BPs) and the non-nitrogen-containing BPs (non-N-BPs). Alendronate, zoledronate, and minodronate are N-BPs, while etidronate and clodronate are non-N-BPs. Four phosphonocarboxylates are also shown. Among them, phosphonoformate (PFA) is a well-known inhibitor of the phosphate transporter SLC34, although at higher concentrations it inhibits SLC20, too.15 The relative potencies of the anti-bone-resorptive effects of BPs are shown within parentheses.
The anti-bone-resorptive effects of N-BPs result from intracellular inhibition of farnesyl pyrophosphate synthase in the mevalonate cholesterol-biosynthesis pathway within osteoclasts.2) This inhibition results in decreases in active-signaling proteins (such as small guanosine 5′-triphosphatases (GTPases)) and the production of cytotoxic metabolites.2) A given BP, whether it is a N-BP or non-N-BP, binds strongly to bone hydroxyapatite, and accumulates within the bone upon repeated administration. At the site of bone-resorption (i.e., beneath osteoclasts), where conditions are strongly acidic, the accumulated BP is released and enters the osteoclasts, leading to decreased bone-resorption.2) Importantly, however, the mevalonate pathway exists widely in eukaryotic cells. Thus, if an N-BP is able to enter cells, it will exhibit cytotoxicity in many cell-types, not just in osteoclasts.
In mice, N-BPs induce inflammation/necrosis in various soft tissues at the injection site, but such effects of non-N-BPs (etidronate and clodronate) have not been detected.6–10) Actually, etidronate and clodronate are protective against the inflammatory/necrotic effects of N-BPs.8,10–13) Concerning the mechanism underlying this protective effect, we hypothesized that (i) N-BPs enter soft-tissue cells via phosphate transporters, and (ii) etidronate and clodronate can inhibit the entry of N-BPs into cells. These hypotheses were supported by our recent finding in mice that among various BP-related substances and inhibitors of various transporters, only etidronate, clodronate, and phosphonoformate (a well-known inhibitor of the phosphate-transporter families SLC34 and/or SLC20)14,15) protected against the inflammatory/necrotic effects of zoledronate (a cyclic-type N-BP that has the highest reported risk of side effects among N-BPs).16) However, it is not clear (i) whether phosphonoformate can reduce the side effects of other N-BPs, too, and (ii) whether other phosphonocarboxylates can exhibit an inhibitory effect such as that of phosphonoformate. Here, we focused on these questions.
BALB/c mice were bred in our laboratory. All experiments complied with the Guidelines for Care and Use of Laboratory Animals in Tohoku University. Minodronate was synthesized for basic studies by Chengdu D-Innovation Pharmaceutical Co., Ltd. (Chengdu, China). Zoledronate and clodronate were from Toronto Research Chemicals Inc. (North York, ON, Canada) and Sigma (St. Louis, MO, U.S.A.), respectively. Etidronate, phosphonoformate, phosphonoacetate, phosphonopropionate, and phosphonobutyrate were purchased from Wako Pure Chemical Industries, Ltd. (Osaka, Japan). 2,3-3H-Alendronate (20–40 Ci/mmol) was purchased from Moravek Biochemicals and Radiochemicals (Brea, CA, U.S.A.). The above drugs were dissolved in sterile saline, with the pH of the solutions being adjusted to 7 with NaOH. Experimental protocols are described in the text or in the legend to the figure relating to each experiment.
Inflammatory and Necrotic Effects of N-BPsFemale mice (6–8 weeks of age) were anesthetized with ethyl ether, and a BP solution was injected subcutaneously into both the right and the left pinna (inside) near the root of the ear (20 µL each ear). The concentrations used are indicated in the relevant experiments. As described below, the inflammatory and necrotic actions of BPs were evaluated daily.10) All experiments were terminated on day 7.
(a) InflammationThe length and width of the area of inflammation (Fig. 2) at the back of the ear (detectable as a red area) were recorded, and length×width (mm2) was used as an indicator of inflammation.

Zoledronate (2 mM) was subcutaneously injected into an ear-pinna (inside) near the root of the ear (20 µL each ear).
After maximum inflammation (estimated as described above) had been attained, the center of the inflammatory site became necrotic [detectable as a change of color from red to dark brown (or black) or as a tissue defect] (Fig. 2). At the start of the necrosis, we stopped measuring inflammation, and in each group of mice we recorded the number of ears with and the number without necrosis [expressed as the incidence of necrosis (e.g., maximum incidence is 8 in a group of 4 mice)].
Quantitative Real-Time Polymerase Chain Reaction (PCR) Analysis of Phosphate Transporters mRNAUsing Trizol reagent (Invitrogen, CA, U.S.A.), total RNA was extracted from the ear-pinnas of mice. cDNA was prepared with the aid of a Transcriptor First Strand cDNA Synthesis Kit (Roche, Indianapolis, IN, U.S.A.) and subjected to quantitative real-time PCR analysis using SsoFast EvaGreen Supermix (Bio-Rad, Hercules, CA, U.S.A.). Gene-specific primers (Table 1) were designed using DNAStar software (DNASTAR, Inc., Madison, WI, U.S.A.). The internal control primers for EF1α1 were F5′-ATT CCG GCA AGT CCA CCA CAA-3′ and R5′-CAT CTC AGC AGC CTC CTT CTC AAA C-3′. Quantitative real-time PCR was performed using the iQ5 real-time detection system (Bio-Rad). The PCR profile was 3 min at 95°C for initial melting; 20 s at 95°C, 30 s at 58°C for 50 cycles; 30 s at 95°C for 1 cycle; and then 1 min at 55°C followed by stepwise temperature increases from 55 to 95°C to generate the melt curve. Standard curves and PCR efficiencies were determined for each primer-set using control cDNA and a 10-fold dilution series ranging from 1000 to 1 ng/mL. Relative expression levels of phosphate transporters were calculated as a function of EF1α1 expression.17)
| Target gene | Accession# | Forward primer (5′→3′) | Reverse primer (5′→3′) | Product size |
|---|---|---|---|---|
| Slc20a1 | NM_015747 | GGGCCAAAGTGAGCGAAACC | TGCCACAAGGGAGAAACCAATG | 200 bp |
| Slc20a2 | NM_011394 | GTGC CGGCCCTGCTTAC | CAATGCCTCTGCTTTCGTTCT | 190 bp |
| Slc20a3 | NM_153150 | GCGGGTGCAGCCAGTGTC | AGCCGCAGTCCAGGGTGTT | 103 bp |
| Slc34a1 | NM_011392 | TAATGTCCTGCAGAGCCGAAGTC | CTAGGGGGAAGTTGGGGTGAA | 165 bp |
| Slc34a2 | NM_011402 | GCTTGACTTAGGGCAGGTGTGG | AGGGGCTCAGTTTGGCATCTC | 104 bp |
| Slc34a3 | NM_080854 | GCCGGCTCAAAACTCACAGACT | GCCAAAGGGGAAGGGAAAATC | 174 bp |
| Slc17a1 | NM_009198 | ACCCGTATATGAGCAGCAGTGAGA | AAATGTCGGCGTGTATGTAACCAG | 185 bp |
| Slc17a2 | NM_144836 | AGTACCCGGGCTGCTGTCTA | ACCAAAATCACCCCAAAGTCA | 209 bp |
| Slc17a3 | NM_134069 | ACACGCCATCACCAAGAGGAGT | CAGGTAGGTGGCCCCGAGTTAT | 154 bp |
| Slc17a4 | NM_177016 | ATTGCTCCCTGGGCTGGTCT | CACTATCTCGGAGGTTTGCTTGAA | 165 bp |
| Slc17a5 | NM_172773 | GGTTGGCCCTGCGGTTTT | GAAGCCTCCCAGCGTCGTG | 100 bp |
| Slc17a6 | NM_080853 | CTCCCTCCCCTCTCCAACTCA | CCCGGGGCCAAAATCCT | 190 bp |
| Slc17a7 | NM_182993 | AGCAGCCCGCGTTCACTATG | GCCAGCCGACTCCGTTCTAAG | 132 bp |
| Slc17a8 | NM_182959 | GGAGCCGCCATCTTCTTGACA | CCATGGCAGGCAGGGTAGGT | 134 bp |
| Slc17a9 | NM_183161 | TAAGACAGGCCCACTAGAAACACC | GCCAACCCAGGACACATCAGTA | 186 bp |
First, 3H-alendronate (0.2 µCi), either alone or in a mixture with a test substance, was injected into both ear-pinnas (20 µL each ear) in mice anesthetized with diethyl ether. Then, the ear-pinnas were taken at the indicated time and the amount of 3H-alendronate retained within them was counted as follows. Each ear-pinna was homogenized in a tube containing 1.5 mL of solubilizer (Soluen-350: PerkinElmer, Inc., Waltham, MA, U.S.A.). The homogenate was solubilized by keeping the tube at 50°C for 3 h. The solubilized sample was put into a glass vial containing 10 mL scintillation cocktail (Pico-Fluor 40: PerkinElmer, Inc.), and radio-activity was counted using a scintillation counter.
Tissue Preparation and ImmunohistochemistryAuricles were resected and immediately fixed by immersion in 4% paraformaldehyde in 0.1 M phosphate buffer, pH 7.4, at 4°C overnight. After being dehydrated using a graded series of ethanol solutions and infiltrated with xylene, specimens were embedded in paraffin. Serial sections of 5-µm thickness were cut and used for immunohistochemistry, which was performed by following a previously reported protocol.18) After deparaffinization, antigen retrieval was performed using proteinase K solution (Roche; 20 µg/ml in Tris-ethylenediaminetetraacetic acid (TE) buffer, pH 8.0) for 5 min at 37°C, and tissue sections were blocked for endogenous peroxidase activity with 0.3% hydrogen peroxide in methanol for 15 min at room temperature (r.t.). Sections were incubated at 4°C overnight with the primary antibody for SLC20a1 (dilution 1 : 1000; abcam, Cat. #: ab104687) or SLC20a2 (dilution 1 : 100; Bioss, Cat. # bs-8610R) diluted with 5% normal goat serum in phosphate buffered saline (PBS) containing 0.05% Triton-X and 5% bovine albumin. Next, the sections were incubated with the secondary antibody (1 : 1000, biotinylated goat anti-rabbit antibody; Vector) for 1 h at r.t., and then visualized using a Vectastain ABC kit (Vector Laboratories, Funakoshi Co., Tokyo, Japan). Sections were counterstained with methyl green solution.
Data AnalysisExperimental values for inflammation are given as the mean±standard deviation (S.D.). The statistical significance of the difference between two means was evaluated using a Bonferroni multiple-comparison test. For differences in incidence between 2 experimental groups at a given time, analysis was by the Fisher exact probability test. p Values less than 0.05 were considered to be significant. Data were analyzed using Instat software (GraphPad Software Inc., La Jolla, CA, U.S.A.).
We used alendronate, zoledronate, and minodronate as the test N-BPs (Fig. 1). Alendronate is an alkyl N-BP, while minodronate and zoledronate are cyclic N-BPs. Minodronate’s anti-bone-resorptive effect and inflammatory/necrotic effects in mice are similar to, or greater than, those of zoledronate.19) As shown in Fig. 3, minodronate and zoledronate induced inflammatory/necrotic effects at 2 mM, while alendronate did so at 32 mM. The non-N-BPs etidronate and clodronate were each able to reduce or prevent the inflammatory/necrotic effects of all three of the N-BPs. The main features of the data shown in Fig. 2 may be summarized as follows. (i) The relative potencies for the induction of inflammatory/necrotic effects by the N-BPs were minodronate≥zoledronate>alendronate. (ii) The relative potencies with which the non-N-BPs reduced the inflammatory/necrotic effects of the N-BPs were clodronate>etidronate. (iii) Higher concentrations of clodronate and etidronate may be required to reduce the inflammatory/necrotic effects of alendronate (which here were induced by a concentration higher than those used for zoledronate and minodronate). The inhibitory effects of etidronate and clodronate on the inflammation and necrosis were essentially the same. Thus, the data relating to inflammation have been omitted from the following sections.

Zoledronate (Zol), minodronate (Min), and alendronate (Ale), were injected either alone or in a mixture with etidronate (Eti) or clodronate (Clo). Injections were made into ear-pinnas at the indicated concentrations, and the inflammatory areas and the incidence of necrosis were evaluated (see Materials and Methods). n=6 to 8 ears/per group. * p<0.05 vs. the relevant N-BP alone.
As shown in Fig. 4, all four of the phosphonocarboxylates tested in the present study reduced or prevented the necrotic effects of 2 mM zoledronate. Phosphonoformate at 20 mM completely prevented the necrotic effect of zoledronate. Unexpectedly, phosphonoacetate at 5 and 10 mM almost completely prevented the necrotic effect of zoledronate, indicating that its protective effect against the necrotic effects of zoledronate may be greater than that of phosphonoformate, which is a well-known inhibitor of SLC20/34. Complete prevention of the necrosis induced by zoledronate could also be achieved with phosphonopropionate and phosphonobutyrate, but in each case at a higher concentration (50 mM). These results indicate that the relative potencies with which phosphonocarboxylates reduce or prevent the necrotic effects of zoledronate are phosphonoacetate>phosphonoformate>phosphonopropionate≥phosphonobutyrate (Table 2).

Injections were made of Zol alone and of Zol in a mixture with phosphonoformate (PFA), phosphonoacetate (PAA), phosphonopropionate (PPA), or phosphonobutyrate (PBA) at the indicated concentrations (mM). Injections were made into ear-pinnas and the inflammatory areas and the incidence of necrosis were evaluated (see Materials and Methods). n=8 ears/per group. * p<0.05 vs. Zol alone.
| Zol (2 mM) | Min (2 mM) | Ale (24 or 32 mM)* | Data from | |
|---|---|---|---|---|
| Clo | 8 | 10 | >32 | Fig. 2 |
| Eti | 8 | >10 | >32 | Fig. 2 |
| PFA | 20 | 50 | >100 | Fig. 3–5 |
| PAA | 10 | 50 | 80 | Fig. 3–5 |
| PPA | 50 | 100 | >100 | Fig. 3–5 |
| PBA | 50 | >100 | >100 | Fig. 3–5 |
* In the experiments involving non-N-BPs and phosphonocarboxylates, the concentrations of Ale were 32 and 24 mM, respectively. The data indicate that the relative potencies of the protective effects are Clo>Eti>PAA>PFA>PPA>PBA.
As shown in Fig. 5, we found that all four of phosphonoformate, phosphonoacetate, phosphonopropionate, and phosphonobutyrate reduced or prevented the necrotic effect of 2 mM minodronate. Phosphonoformate and phosphonoacetate completely prevented the necrotic effect of minodronate when they were given at 50 mM, while with phosphonopropionate 100 mM was needed for complete prevention. Any effects of phosphonobutyrate were marginal. Thus, the relative potencies of phosphonocarboxylates against the necrotic effect of minodronate were similar to those found against the necrotic effect of zoledronate (Table 2).

Injections, into ear-pinnas, were made of Min alone and of Min in a mixture with phosphonoformate (PFA), phosphonoacetate (PAA), phosphonopropionate (PPA), or phosphonobutyrate (PBA) at the indicated concentrations (mM). The inflammatory areas and the incidence of necrosis were evaluated (see Materials and Methods). n=8 ears/per group. * p<0.05 vs. Min alone.
As shown in Fig. 6, the necrotic effects of 24 mM alendronate were reduced or tended to be reduced by the phosphonocarboxylates tested. Among these agents, only phosphonoacetate (at 80 mM) completely prevented the necrotic effect of alendronate, while the prevention by phosphonoformate was partial even at 100 mM. No significant preventive effects were detected with either phosphonopropionate or phosphonobutyrate. Thus, the relative antinecrotic potencies of phosphonocarboxylates were similar against alendronate as against zoledronate and minodronate (Table 2).

Injections, into ear-pinnas, were made of Ale alone and of Ale in a mixture with phosphonoformate (PFA), phosphonoacetate (PAA), phosphonopropionate (PPA), or phosphonobutyrate (PBA) at the indicated concentrations (mM). The inflammatory areas and the incidence of necrosis were evaluated (see Materials and Methods). n=8 ears/per group. * p<0.05 vs. Ale alone.
2,3-3H-alendronate was the only radio-isotope-labeled N-BP we could obtain commercially. As shown in Fig. 7A, the 3H-alendronate (2 µCi) injected into ear-pinnas was largely lost within 1 h, although a low level was retained even 24 h after its injection, possibly reflecting the amount that had entered cells in the ear-pinna. The necrotic effects of N-BPs, including alendronate, are not detectable at one or two days after their injection (see Figs. 3 to 6). Therefore, we examined whether etidronate, clodronate, phosphonoformate, or phosphonoacetate might reduce the amount of 3H-alendronate still present within ear-pinnas at 24 h after its injection. As shown in Fig. 7B, each of these agents did so, with their relative effects being clodronate>etidronate>phosphonoacetate>phosphonoformate. This order is similar to that obtained for their abilities to reduce the inflammatory/necrotic effects of N-BPs (see above).

(A) 3H-Ale (0.2 µCi in 20 µL saline) was injected into ear-pinnas and the amount retained within the ear-pinnas was measured (see Materials and Methods) at the indicated times after its injection. n=3 ears per time-point. (B) Injections, into ear-pinnas, were made of saline alone, and of 3H-Ale (0.2 µCi in 20 µL saline) either alone or in a mixture containing 25 mM etidronate (Eti), clodronate (Clo), phosphonoformate (PFA), or phosphonoacetate (PAA). Twenty-four hours later, the ear-pinnas were subjected to measurements of the amount of 3H-Ale retained within them. Experimental values are given as the mean±S.D. n=8 ears per group. * p<0.05, ** p<0.001 vs. 3H-Ale alone.
Among the SLC transporter families, three families (SLC17, SLC20, and SLC34) are known to be phosphate transporters. The SLC17 family includes 9 members, while SLC20 family has 3 members (one pseudo) and the SLC34 family also has 3 members.20–22) Finally, therefore, we examined whether these transporters might be present within the untreated ear-pinnas of mice. As shown in Fig. 8, we could detect the mRNAs of all of these transporters in ear pinnas. Among these phosphate transporter families, SLC20 and/or SLC34 have been suggested to be involved in the transport of N-BPs.16) Among the antibodies that would be required to detect them by immunostaining, antibodies against only SLC20a1 and SLC20a2 are commercially available. Figure 9 shows immunostaining results obtained using those two antibodies. The findings indicate that SLC20a1 and SLC20a2 are distributed widely in ear-pinnas. Actually, the mRNAs of SLC20 family members can be detected ubiquitously among various human tissues.23)

The mRNA of each member of three families of phosphate transporters [SLC20 (a1, a2, a3), SLC34 (a1, a2, a3), and SLC17 (a1– a9)] was measured as described in Materials and Methods. Experimental values are given as the mean±S.D. n=2 ears.

(A) Hematoxylin–eosin staining. (B) Skeletal muscle and basal layer of epidermis each show intense immunoreactivity (brown) with anti-SLC20a1, while faint-to-moderate immunoreactivity is observed overall, including in sebaceous glands and connective tissues. (C) Intense immunoreactivity (brown) with anti-SLC20a2 can be seen in skeletal muscle, basal layer of epidermis, and sebaceous glands, while faint immunoreactivity is observed overall. (D) No immunoreactivity is observed in negative control sections performed without the use of the above primary antibodies. Bars=200 µm.
The main findings made in the present study may be summarized as follows. Like etidronate and clodronate, some phosphonocarboxylates protected against the inflammatory/necrotic effects of N-BPs (zoledronate, minodronate, and alendronate) in mouse ear-pinnas. The rank order of protective potencies was clodronate>etidronate>phosphonoacetate>phosphonoformate>phosphonopropionate>phosphonobutyrate. With a similar rank order of potencies, the first four in that list reduced the amount of 3H-alendronate retained within ear-pinnas after its injection therein. The mRNAs of SLC20 and SLC34 were detected in mouse ear-pinnas. These findings support the hypotheses that (i) N-BPs may enter soft-tissue cells via SLC20 and/or SLC34 transporters, and (ii) inhibition of these phosphate transporters might be a useful strategy in future attempts to prevent and/or treat various side effects of N-BPs. However, it should be noted that phosphonoformate (also known as “foscarnet”) has activities other than its inhibition of SLC34 and SLC20. These include: (i) anti-viral activity via an inhibition of viral DNA synthesis due to its interaction with viral DNA polymerase or reverse transcriptase24) and (ii) inhibition of calcium deposition.25) Thus, we cannot rule out the possibility that these effects might also contribute to the results observed in the present study via mechanisms whose details remain unknown.
Significance of the Experimental SystemOral N-BPs directly injure esophageal and gastrointestinal epithelial tissues,26) and N-BPs (as well as non-N-BPs) accumulate within bones,1,12) especially in bones exhibiting inflammation.27) Thus, it is very likely that if jawbone-accumulated N-BPs are released from the bone, they will directly injure the surrounding soft-tissue cells.28) It is conceivable that such release of N-BPs from jawbones results from the bone destruction caused by tooth extraction and/or infection and when osteoclasts are killed by N-BPs. Support for such release into soft tissues comes from the detection of zoledronate in the saliva of zoledronate-treated patients.29) In the present study, injection of N-BPs into mouse ear-pinnas directly induced inflammation and necrosis at the injection site. Since the mevalonate pathway exists widely in eukaryotic cells, and if an N-BP is able to enter cells, it is likely to exhibit cytotoxicity in a wide variety of cell types, not just in osteoclasts. Thus, experiments like ours may be considered a convenient way to obtain information concerning the inflammatory and/or necrotic profiles of N-BPs in the soft tissues that surround bone tissues.
Mechanism Underlying the Side Effects of N-BPsIn addition to ONJ, N-BPs have several undesirable side effects (such as influenza-like fever, increase in acute-phase proteins, gastrointestinal lesions, and ophthalmic inflammation).3) The inhibition by N-BPs of farnesyl pyrophosphate synthase results in (a) a decrease in cholesterol, which is an essential structural component of cell membranes, (b) decreases in isoprenoids, which are necessary for the prenylation of small GTPases, leading to the functional disruption of these signaling proteins, (c) increases in the substrates for that enzyme (isopentenyl pyrophosphate and dimethylallyl pyrophosphate), which are converted into cytotoxic ATP analogs within cells, and (d) activation of a human population of γδ T cells (Vγ9Vδ2 T cells) via stimulation by isopentenyl pyrophosphate.2,30) Moreover, N-BPs induce an enhanced production of interleukin (IL)-1β,31,32) an effect that is mediated by mechanism (b).33,34) Thus, we suppose that all four of the above effects (a–d) might be causally involved in the inflammatory and/or necrotic effects of N-BPs. Although denosumab [a monoclonal antibody against the receptor activator of nuclear factor-κB ligand (RANKL)] lacks such inflammatory and cytotoxic effects, this potent inhibitor of osteoclasts has also been reported to cause ONJ,35) suggesting that decreased bone-resorption may be an essential cause of BRONJ. However, reduced osteoclastic activity cannot be the only cause of ONJ, because BRONJ-like ONJ has not been described in osteopetrosis, in which osteoclasts are naturally inhibited.35) Thus, other factors—possibly, infection or impairment of the defense mechanisms against infection—might be the common, and most important, factor leading to the induction of ONJ by N-BPs and denosumab.28,35,36) We previously reported that lipopolysaccharide (LPS), a potent inflammatory component of the cell walls of Gram-negative bacteria, augments both the production of the inflammatory cytokine IL-1 and the induction of the histamine-forming enzyme histidine decarboxylase.31,32) Possibly, such an increased production of IL-1 might act in conjunction with that induced by N-BPs (see above a–d). Be that as it may, it should be noted that the inflammatory and/or necrotic effects of N-BPs are most likely caused by their entry into soft-tissue cells.
Current Strategies Against N-BP-Induced ONJGuidelines (or position papers) for BRONJ in several countries state that the precise incidence, clinical backgrounds, and pathogenesis of BRONJ are unclear, and that appropriate strategies for its prevention and treatment have not been established.37–39) Such guidelines also point out that the basal strategies are conservative (mouthwash and use of analgesics and antibiotics), and the only other strategy is debridement aimed at removal of necrotic bone (when this is possible). It should also be remembered that there are considerable resource costs associated with the diagnosis and management of BRONJ.40) In view of this background, McClung et al. proposed a strategy based on a “drug holiday.”41)
ProposalsBecause N-BPs are considered to be indispensable drugs in the fields of oncology and osteoporosis, the best strategy at present may be to try to prevent or reduce their side effects while retaining their strong anti-bone-resorptive effects. As described above, the side effects of N-BPs most likely result from their entry into soft-tissue cells. Phosphonocarboxylates are structural analogs of non-N-BPs (Fig. 1), and our studies strongly suggest that phosphonocarboxylates and non-N-BPs antagonize the retention of N-BPs within soft tissues. In contrast to the complicated mechanism underlying the side effects of N-BPs, the mechanism by which phosphonocarboxylates and non-N-BPs protect against these side effects in mice seems to be very simple. Thus, our present findings suggest that inhibition of the uptake of N-BPs by soft-tissue cells might become a basis for a useful strategy aimed at preventing and/or treating BRONJ, as well as other inflammatory side effects of N-BPs.
The present findings support the hypothesis that in mice, phosphonocarboxylates (especially phosphonoacetate and phosphonoformate), clodronate, and etidronate may inhibit the entry of N-BPs into soft-tissue cells via SLC34 and/or SLC20 phosphate transporters in a competitive inhibitory manner, and moreover that it may be in this way that they can reduce or prevent the inflammatory/necrotic side effects of N-BPs. We propose that future strategies for the prevention of the side effects of N-BPs might involve not only use of etidronate and clodronate,11,12) but also appropriate use of phosphonocarboxylates or their analogs.
The present study does not provide direct evidence (i) that SLC20 and/or SLC34 families can transport N-BPs and the non-N-BPs etidronate and clodronate, or (ii) that etidronate, clodronate, and phosphonocarboxylates can competitively inhibit the transport of N-BPs. This limitation is due to the fact that (i) specialized techniques (such as an appropriate cell-culture system and/or a Xenopus oocytes expression system) are needed for direct measurement of the transportation of these substances, and such techniques were not available to us, and (ii) the only commercially available isotope-labeled bisphosphonate is 3H-alendronate. However, we hope to be able to perform the necessary experiments in the near future.
This work was supported by Grants from the Japan Society for the Promotion of Science (24659835, 24592978, and 25861910) and Dainippon Sumitomo Pharma Co., Ltd. (Tokyo, Japan). The authors are grateful to Dr. Robert Timms (Birmingham, U.K.) for English language editing.
The authors declare no conflict of interest.