CRISPR-Cas9-Edited SNCA Knockout Human Induced Pluripotent Stem Cell-Derived Dopaminergic Neurons and Their Vulnerability to Neurotoxicity

Abstract

Parkinson’s disease (PD) is an age-related disorder with selective dopaminergic (DA) neuronal degeneration in the substantia nigra pars compacta. The presence of mainly α-synuclein-composed Lewy bodies in DA neurons is among the disease hallmarks in the brain of patients with PD. Human induced pluripotent stem cells (hiPSCs) are powerful tools to investigate PD pathophysiology and understand its molecular and cellular mechanisms better. In this study, we generated an α-synuclein-null hiPSC line introducing a nonsense mutation in the α-synuclein-encoding SNCA alleles using clustered regularly interspaced short palindromic repeats CRISPR-associated protein 9 (CRISPR-Cas9)-mediated gene editing. Our Western blotting analysis revealed the lack of α-synuclein protein expression in SNCA knockout hiPSC-derived cells. In addition, SNCA knockout hiPSCs retained healthy cell morphology, undifferentiated marker gene (e.g., NANOG, POU5F1, and SOX2) expression, and differentiation ability (based on the marker gene expression levels of the three germ layers). Finally, SNCA knockout hiPSC-derived DA neurons exhibited reduced vulnerability to the DA neurotoxin, 1-methyl-4-phenylpyridinium. In conclusion, the SNCA knockout hiPSC line we generated would provide a useful experimental tool for studying the physiological and pathological role of α-synuclein in PD.

INTRODUCTION

Parkinson’s disease (PD) is a common neurodegenerative disorder caused by dopaminergic (DA) neuronal dysfunctionality in the substantia nigra pars compacta (SNpc). DA neuronal degeneration leads to the onset of motor symptoms such as tremors, rigidity, and akinesia in patients with PD.¹⁾ A postmortem study of patients with PD revealed the appearance of Lewy bodies in the DA neurons, containing α-synuclein as a main component.²⁾ α-Synuclein accumulation and aggregation are among the causes of DA neuronal depletion in the SNpc. Furthermore, α-synuclein aggregates propagate through the brain in a prion-like manner with a pattern corresponding to synucleinopathy staging.³⁾ However, α-synuclein aggregates reportedly induce neurotoxicity through autophagy inhibition in mammalian cells.⁴⁾ Therefore, α-synuclein is pivotal to PD pathogenicity.

The clustered regularly interspaced short palindromic repeats CRISPR-associated protein 9 (CRISPR-Cas9) system is an advanced tool of gene editing technology allowing for gene knockout or knock-in even in mammalian cells.^5,6) The CRISPR-Cas9 system makes highly specific and efficient target gene editing design markedly easier. In this study, we engineered hiPSCs using the CRISPR-Cas9 technology to generate an SNCA knockout cell line by introducing a nonsense mutation in the α-synuclein-encoding SNCA alleles. SNCA knockout hiPSCs displayed healthy cell morphology, gene expression, and differentiation capacity toward all three germ layers. In addition, α-synuclein protein expression was indeed abolished in DA neurons differentiated from the SNCA knockout hiPSC line. Finally, we revealed that SNCA knockout hiPSC-derived DA neurons exhibited reduced vulnerability to 1-methyl-4-phenylpyridinium (MPP⁺)-induced neurotoxicity. This cell line could be successfully used for studying the biological function and modeling of α-synuclein-related neurodegeneration.

MATERIALS AND METHODS

Human iPSC Culture

The hiPSC line (1231A3) we used in this study was provided by the RIKEN Bioresource Research Center (Tsukuba, Japan) through the National BioResource Project of the Ministry of Education, Culture, Sports, Science and Technology (MEXT)/Japan Agency for Medical Research and Development (AMED), Japan.⁷⁾ hiPSCs were maintained as previously described.⁸⁾ The experiments involving hiPSCs were approved by the Ethical Review Committee for Medical and Health Research Involving Human Subjects at Kyoto Pharmaceutical University.

CRISPR-Cas9 Gene Editing

SNCA exon 3-targeting guide RNA (gRNA) was designed using the CHOPCHOP web tool (https://chopchop.cbu.uib.no/). The targeting sequence was annealed using AAAGGACGAAACACCGTGGTGCATGGTGTGGCAAC and TTCTAGCTCTAAAACGTTGCCACACCATGCACCAC, then inserted into a BbsI (New England BioLabs, Ipswich, MA, U.S.A.)-digested pSpCas9(BB)-2A-Puro (PX459) V2.0 plasmid (#62988, Addgene, Watertown, MA, U.S.A.)⁹⁾ using InFusion HD (TaKaRa Bio Inc., Kusatsu, Japan). The Neon transfection system (Thermo Fisher Scientific, Waltham, MA, U.S.A.) was used under optimized conditions (1550 V, 10 ms, 3 plus) to introduce 1 µg of the gRNA plasmid into the hiPSCs (1.0 × 10⁵ cells). Next, the cells were plated onto iMatrix-511 silk (Nippi, Tokyo, Japan)-coated plates with Essential 8 medium (Thermo Fisher Scientific) supplemented with 10 µM Y27632 (Selleck Chemicals, Houston, TX, U.S.A.). Finally, after positive selection with 0.2 µg/mL puromycin (TaKaRa Bio), we isolated a clone carrying homologous mutations with a frameshift in the target site.

DNA Sequencing

The genomic DNA of putative SNCA knockout clones was extracted with 50 mM NaOH, and then boiled at 95 °C for 5 min after vortex. The samples were naturalized using 1M Tris–HCl (pH 8.0). PCR was performed using the KOD One PCR Master Mix (TOYOBO Co., Ltd., Osaka, Japan). PCR products of putative SNCA knockout clones were inserted into the linearized pUC19 vector using InFusion HD and transformed into XL-10GOLD competent Escherichia coli (Agilent Technologies, Inc., Santa Clara, CA, U.S.A.). Transformed cells were selected using 100 µg/mL ampicillin on Luria–Bertani (LB) agar plates. Ten colonies were randomly picked and the plasmid content was extracted from each colony followed by amplification in liquid LB supplemented with 100 µg/mL ampicillin. Plasmids were extracted and sent for Sanger sequencing to Eurofins Genomics (Tokyo, Japan).

Western Blotting

Cell pellets were lysed in RIPA buffer (FUJIFILM Wako Pure Chemical Corporation, Osaka, Japan) containing Protease Inhibitor Cocktails (Sigma-Aldrich, St. Louis, MO, U.S.A.). Proteins were separated by sodium dodecyl sulfate–polyacrylamide gel electrophoresis using a 12.5% gel, and then transferred onto a polyvinylidene fluoride membrane. Membranes were then blocked with Bullet Blocking One for Western blot (Nacalai Tesque, Kyoto, Japan) followed by incubation with primary antibodies at 4 °C overnight. The primary antibodies used were as follows: β-actin (mouse, 1 : 5000, A5441, Sigma-Aldrich) and human α-synuclein (mouse, 1 : 5000, sc-58480, Santa Cruz Biotechnology Inc., Dallas, TX, U.S.A.). The membranes were then incubated with horseradish peroxidase-conjugated horse anti-mouse immunoglobulin G (IgG) antibody (1 : 2000, cell Signaling Technology, Danvers, MA, U.S.A.) at room temperature for one hour. Signal detection was visualized using Chemi–Lumi One Super (Nacalai Tesque) and imaged using Image Quant LAS500 (Cytiva, Tokyo, Japan).

Embryoid Body (EB) Formation and Differentiation

Single-cell dissociated hiPSCs were seeded on low-attached dishes at a density of 500000 cells/mL and EBs were formed for 14 d in a differentiation medium containing Glasgow’s minimum essential medium (Thermo Fisher Scientific) supplemented with 8% knockout serum replacement (Thermo Fisher Scientific), 1% sodium pyruvate (FUJIFILM Wako Pure Chemical Corporation), 1% non-essential amino acids (FUJIFILM Wako Pure Chemical Corporation), 0.1 mM 2-mercaptoethanol (FUJIFILM Wako Pure Chemical Corporation), and 1% penicillin/streptomycin (FUJIFILM Wako Pure Chemical Corporation). The culture was supplemented with 10 µM Y27632 for the first 24 h. The medium was changed once every other day.

DA Neural Differentiation

DA neuronal differentiation was performed according to previous reports with modifications.^10,11) Briefly, single-cell dissociated hiPSCs were plated onto iMatrix511 silk-coated dishes at a density of 500000 cells/cm² in the above-described differentiation medium supplemented with 10 µM Y27632 for the first 24 h. DA neural induction was performed in the medium supplemented with LDN193189 (200 nM, days 0–11, Selleck Chemicals), A83-01 (500 nM, days 0–6, FUJIFILM Wako Pure Chemical Corporation), purmorphamine (2 µM, days 0–11, Selleck Chemicals), and CHIR99021 (3 µM, days 3–11, Selleck Chemicals). Cells were replated onto a dish coated with poly-L-ornithine (100 µg/mL; Sigma-Aldrich)/laminin (10 µg/mL; Sigma-Aldrich)/fibronectin (1 µg/mL; FUJIFILM Wako Pure Chemical Corporation) in Neurobasal medium with B27 supplement vitamin A minus (Thermo Fisher Scientific) and GlutaMax (Thermo Fisher Scientific) on day 11. Cell sorting with anti-CORIN antibody for floorplate progenitor purification was not performed in this study, although it was used for cell sorting to purify floorplate progenitors in the previous paper.¹⁰⁾ The medium was supplemented with ascorbic acid (200 µM, days 11–80, Sigma-Aldrich), dibutyryl cAMP (400 µM, days 11–80, Selleck Chemicals), DAPT (10 µM, days 11–80, Selleck Chemicals), brain-derived neurotrophic factor (20 ng/mL, days 16–80, PeproTech Inc., Rocky Hill, NJ, U.S.A.), and glial cell line-derived neurotrophic factor (10 ng/mL, days 16–80, PeproTech), The differentiation medium was changed once every 2–3 d.

Immunofluorescence

Immunostaining was performed according to a previous report.⁸⁾ The primary antibodies used were FOXA2 (goat, 1 : 500, AF2400, R&D Systems, Minneapolis, MN, U.S.A.), human α-synuclein (mouse, 1 : 1000, sc-58480, Santa Cruz Biotechnology Inc.), TH (rabbit, 1 : 500, AB152, Millipore), and TH (mouse 1 : 500, MAB318, Millipore). Signals were detected using either Alexa Fluor 488- or 555-conjugated donkey secondary antibodies (1 : 500, Thermo Fisher Scientific). Nuclei were then stained using Hoechst 33342 (1 µg/mL; Dojindo, Kumamoto, Japan) for 15 min at room temperature. Images were captured using an LSM800 laser confocal microscope (Carl Zeiss, Jena, Germany). TH⁺ area in neurospheres was calculated using ImageJ software (National Institute of Health, Bethesda, MD, U.S.A.).

PCR

PCR and quantitative PCR analysis were performed according to a previous report.¹²⁾ Table 1 summarizes the primer sequences used in this study.

Table 1. PCR Primers

Target	Forward (5′-3′)	Reverse (5′-3′)
FOXA2	TTCAGGCCCGGCTAACTCT	AGTCTCGACCCCCACTTGCT
GAPDH	TTGAGGTCAATGAAGGGGTC	GAAGGTGAAGGTCGGAGTCA
HAND1	CTCATTTTCAGCCTTGCCCG	CCCTATTAACGCCGCTCCAT
LMX1A	TCTCAGGCTCCTCAGACAGG	GGTTTCCCACTCTGGACTGC
NANOG	ACAACTGGCCGAAGAATAGCA	GGTTCCCAGTCGGGTTCA
NR4A2	CAGCTCCGATTTCTTAACTCCAG	GGTGAGGTCCATGCTAAACTTGA
PAX6	TGGTATTCTCTCCCCCTCCT	TAAGGATGTTGAACGGGCAG
POU5F1	AGGGCCCCATTTTGGTACC	TCAGTTTGAATGCATGGGAGAGC
SOX2	CAAGATGCACAACTCGGAGA	GCTTAGCCTCGTCGATGAAC
SOX17	CGCTTTCATGGTGTGGGCTAAGGACG	TAGTTGGGGTGGTCCTGCATGTGCTG
TH	CTGGTTCACGGTGGAGTTC	TCTCAGGCTCCTCAGACAGG

Vulnerability Assays

Cell viability and cytotoxicity were evaluated using hiPSC-derived DA neurospheres on day 56. Briefly, hiPSCs were dissociated into single cells and reseeded at a density of 9000 cells/well on ultra-low attachment V-bottom 96-well plates (Thermo Fisher Scientific) in the above-described differentiation medium and maintained until day 56. After 72 h of MPP⁺ (10–1000 µM) incubation, cell viability was analyzed using the cell Counting Kit-8 assay (Dojindo, Kumamoto, Japan), and cytotoxicity was quantified using supernatant by the lactate dehydrogenase (LDH) Cytotoxicity Assay Kit (Nacalai Tesque) according to the manufacturer’s protocol.

Statistical Analysis

The values are presented as the mean ± standard error of the mean (S.E.M.). The means of two and multiple groups were compared using independent samples Student’s t-test and two-way ANOVA with Bonferroni’s post-hoc test, respectively. All statistical analyzes were conducted using Prism 9 (GraphPad, San Diego, CA, U.S.A.).

RESULTS

To generate the SNCA knockout hiPSC line, we designed SNCA exon 3-targeting guide RNA and cloned into the pSpCas9(BB)-2A-Puro (PX459) V2.0 vector⁹⁾ (Fig. 1A). The plasmid was transiently introduced in the hiPSCs using electroporation. Six clones were picked and sequenced for the exon 3 target region. Finally, we selected a clone with mutated alleles carrying a homozygous frameshift-related premature stop codon (Figs. 1B, C). The morphology of SNCA knockout hiPSCs showed normal as same as wild-type (WT) hiPSCs (Figs. 1D, D′). The undifferentiated iPSC markers NANOG, POU5F1, and SOX2 expression levels were the same in WT and SNCA knockout hiPSCs (Fig. 1E). We then conducted an EB formation assay to investigate the hiPSC potential to differentiate into the three germ layers using quantitative PCR. We observed significantly induced ecto-, meso-, and endodermal marker PAX6, HAND1, and SOX17 expressions, respectively, with no difference in the expression level between WT and SNCA knockout hiPSCs (Fig. 1F).

Fig. 1. SNCA Knockout hiPSC Line Generation Using the CRISPR-Cas9 System and Characterization

(A) CRISPR-Cas9-mediated genome editing scheme for SNCA exon 3. (B) Sanger sequencing data of the genome-edited site in SNCA exon 3. (C) Amino acid sequence prediction in WT and SNCA knockout hiPSCs. (D) Undifferentiated iPSC morphology. Scale bar, 100 µm. (E) Pluripotent stem cell marker NANOG, POU5F1, and SOX2 gene expression comparison in undifferentiated hiPSCs. (F) Three germ layer marker PAX6 (ectoderm), HAND1 (mesoderm), and SOX17 (endoderm) gene expression comparison followed by EB formation and differentiation on day 15. The values are represented as the mean ± S.E.M. (n = 3). Significance (Student’s t-test): * p < 0.05, ** p < 0.01, *** p < 0.001 vs. D0. ns, non-significant; D0, Day 0; EB.

Next, we differentiated SNCA knockout hiPSCs into midbrain DA neurons according to previously reported protocols with modifications.^10,11) Our gene expression analysis revealed that both SNCA knockout and WT hiPSC-derived DA neurons expressed ventral midbrain markers LMX1A, FOXA2, NR4A2, and DA marker TH on day 25 (Fig. 2A). Both cell lines formed complex neuronal networks on day 60 (Fig. 2B). Moreover, we confirmed that SNCA knockout hiPSC-derived cells did not express the human α-synuclein protein on day 60 while WT hiPSC-derived DA cells did (Fig. 2C). Finally, we confirmed that α-synuclein was expressed in WT hiPSC-derived but not in SNCA knockout hiPSC-derived TH⁺ neurons on day 80 (Fig. 2D). Next, we generated hiPSC-derived neurospheres which emerged FOXA2⁺ and TH⁺ DA neurons from either WT or SNCA knockout hiPSCs by long-term differentiation (Figs. 2E, F). Representative images showed that the TH⁺ region covered 45.7 and 43.6% per entire neurospheres in WT and SNCA knockout hiPSC-derived neurospheres, respectively (Fig. 2E). On day 56, we performed vulnerability assays to address cell viability and DA neurotoxin MPP⁺ cytotoxicity in SNCA knockout hiPSC-derived DA neurospheres. The toxicological assays revealed that the cell viability was significantly reduced by treatment with MPP⁺ in a concentration dependent manner in both WT and SNCA knockout hiPSC-derived DA neurospheres (Figs. 2G, H). Moreover, the vulnerability to MPP⁺-induced cytotoxicity in SNCA knockout hiPSC-derived DA neurospheres was reduced compared to WT hiPSC-derived DA neurospheres (Fig. 2G). In addition, the cytotoxicity assay also revealed reduced MPP⁺-induced LDH release in SNCA knockout hiPSC-derived DA neurospheres compared to that in WT hiPSC-derived DA neurospheres (Fig. 2H). These results suggest that SNCA knockout hiPSCs could be used for investigating the functional role of α-synuclein in DA neuron toxicology.

Fig. 2. DA Neuronal Differentiation from SNCA Knockout hiPSCs

(A) RT-PCR gene expression analysis on days 0 and 25 in WT and SNCA knockout hiPSCs. DW, distilled water. (B) Phase contrast images of hiPSC-derived DA neurons on day 60. Scale bar, 50 µm. (C) Western blotting analysis of human α-synuclein expression in hiPSC-derived cells on day 60. (D) TH and human α-synuclein immunofluorescence in hiPSC-derived DA neurons on day 80. Scale bar, 50 µm. (E) Immunofluorescence of TH in hiPSC-derived DA neurospheres on day 56. The value represented TH⁺ area per neurosphere. Scale bar, 500 µm. (F) TH and FOXA2 immunofluorescence in hiPSC-derived DA neurospheres on day 56. Scale bar, 50 µm. MPP⁺-induced injury-related vulnerability test in hiPSC-derived DA neurospheres through cell viability (G) and LDH release (H) assays on day 56. The cells were MPP⁺-treated for 72 h. The values are represented as the mean ± S.E.M. (n = 3). Significance (two-way ANOVA with Bonferroni’s test): * p < 0.05, ** p < 0.01, *** p < 0.001 vs. WT at each concentration; ^†† p < 0.01, ^†††p < 0.001 vs. vehicle (WT); ^§§ p < 0.01, ^§§§ p < 0.001 vs. vehicle (KO).

DISCUSSION

In this study, we aimed to generate an SNCA knockout hiPSC line as a tool for investigating the biological function of α-synuclein and PD pathology. Using CRISPR-Cas9-mediated gene editing, we successfully established a hiPSC line with a nonsense mutation in the SNCA alleles encoding for α-synuclein. We confirmed that the SNCA knockout hiPSCs were optimally differentiated into DA neurons and never expressed α-synuclein. Therefore, our SNCA knockout hiPSCs could be used as potential human resources to investigate the role of α-synuclein in PD pathology. As a further application, SNCA knockout hiPSCs could be also applied in the toxicity analysis of exogenous DA neurotoxins to understand better PD pathogenesis. For instance, MPP⁺ is reportedly incorporated into DA neurons via dopamine transporter (DAT) and subsequently leads to cytotoxicity by generating free radicals following inhibition of the mitochondrial complex I.¹³⁾ DAT⁺ cells appeared in hiPSC-derived neurons with long-term culture,¹⁴⁾ and hiPSC-derived DA neurons were used to assess the toxicity of MPP⁺.^15,16) In addition, MPP⁺ promotes α-synuclein aggregation, accelerating cytotoxicity coordinated with mitochondrial dysfunction.¹⁷⁾ Furthermore, α-synuclein aggregates also induce neurotoxicity by inhibiting autophagy in mammalian cells and might explain PD pathogenicity.⁴⁾ However, α-synuclein null mice exhibited resistance against 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP)-induced DA neuron degeneration.^18,19) In addition, α-synuclein knockdown human neuronal-like cells were also MPTP toxicity-resistant.²⁰⁾ Our data indicated that SNCA knockout hiPSC-derived DA neurons also displayed reduced vulnerability to MPP⁺-induced neurotoxicity. Therefore, the results obtained using SNCA knockout hiPSC-derived DA neurons were consistent with previous findings. These results showed that hiPSC-derived DA neurons allow us to investigate the research to be able to mimic the pathology of human disease, and propose new alternative human cell resources in addition to animal models and cell lines.

In conclusion, we generated an SNCA knockout hiPSC line using the CRISPR-Cas9 technology, thereby proposing a novel cell line that would be a suitable resource to study the physiological function of α-synuclein and PD pathology.

Acknowledgments

The study was supported by Grants-in-Aids from the Private University Research Branding Project for Ministry of Education, Culture, Sports, Science and Technology, the Kyoto Pharmaceutical University Fund for the Promotion of Scientific Research (KN), the Ichiro Kanehara Foundation for the Promotion of Medical Sciences and Medical Care (KN), the Suzuki Memorial Foundation (KN), the SENSHIN Medical Research Foundation (KN), the Kobayashi Foundation (KT), the Smoking Research Foundation (KT), and the Japan Society for the Promotion of Science (JSPS) KAKEN (Grant Nos.: 19K07854 and 22K07382 to KN, 20H03569 to KT).

Conflict of Interest

The authors declare no conflict of interest.

REFERENCES

• 1) Lang AE, Lozano AM. Parkinson’s disease. N. Engl. J. Med., 339, 1130–1143 (1998).
• 2) Spillantini MG, Schmidt ML, Lee VM-Y, Trojanowski JQ, Jakes R, Goedert M. α-Synuclein in Lewy bodies. Nature, 388, 839–840 (1997).
• 3) Braak H, Del Tredici K, Rüb U, De Vos RAI, Jansen Steur ENH, Braak E. Staging of brain pathology related to sporadic Parkinson’s disease. Neurobiol. Aging, 24, 197–211 (2003).
• 4) Winslow AR, Chen CW, Corrochano S, Acevedo-Arozena A, Gordon DE, Peden AA, Lichtenberg M, Menzies FM, Ravikumar B, Imarisio S, Brown S, O’Kane CJ, Rubinsztein DC. α-Synuclein impairs macroautophagy: implications for Parkinson’s disease. J. Cell Biol., 190, 1023–1037 (2010).
• 5) Cong L, Ran FA, Cox D, Lin S, Barretto R, Habib N, Hsu PD, Wu X, Jiang W, Marraffini LA, Zhang F. Multiplex genome engineering using CRISPR/Cas systems. Science, 339, 819–823 (2013).
• 6) Mali P, Yang L, Esvelt KM, Aach J, Guell M, DiCarlo JE, Norville JE, Church GM. RNA-guided human genome engineering via Cas9. Science, 339, 823–826 (2013).
• 7) Nakagawa M, Taniguchi Y, Senda S, Takizawa N, Ichisaka T, Asano K, Morizane A, Doi D, Takahashi J, Nishizawa M, Yoshida Y, Toyoda T, Osafune K, Sekiguchi K, Yamanaka S. A novel efficient feeder-free culture system for the derivation of human induced pluripotent stem cells. Sci. Rep., 4, 3594 (2014).
• 8) Amimoto N, Nishimura K, Shimohama S, Takata K. Generation of striatal neurons from human induced pluripotent stem cells by controlling extrinsic signals with small molecules. Stem Cell Res., 55, 102486 (2021).
• 9) Ran FA, Hsu PD, Wright J, Agarwala V, Scott DA, Zhang F. Genome engineering using the CRISPR-Cas9 system. Nat. Protoc., 8, 2281–2308 (2013).
• 10) Doi D, Samata B, Katsukawa M, Kikuchi T, Morizane A, Ono Y, Sekiguchi K, Nakagawa M, Parmar M, Takahashi J. Isolation of human induced pluripotent stem cell-derived dopaminergic progenitors by cell sorting for successful transplantation. Stem Cell Reports, 2, 337–350 (2014).
• 11) Kriks S, Shim JW, Piao J, Ganat YM, Wakeman DR, Xie Z, Carrillo-Reid L, Auyeung G, Antonacci C, Buch A, Yang L, Beal MF, Surmeier DJ, Kordower JH, Tabar V, Studer L. Dopamine neurons derived from human ES cells efficiently engraft in animal models of Parkinson’s disease. Nature, 480, 547–551 (2011).
• 12) Nishimura K, Nitta T, Doi K, Takata K. Rapid conversion of human induced pluripotent stem cells into dopaminergic neurons by inducible expression of two transcription factors. Stem Cells Dev., 31, 269–277 (2022).
• 13) Cleeter MWJ, Cooper JM, Schapira AHV. Irreversible inhibition of mitochondrial complex I by 1-methyl-4-phenylpyridinium: evidence for free radical involvement. J. Neurochem., 58, 786–789 (1992).
• 14) Samata B, Doi D, Nishimura K, Kikuchi T, Watanabe A, Sakamoto Y, Kakuta J, Ono Y, Takahashi J. Purification of functional human ES and iPSC-derived midbrain dopaminergic progenitors using LRTM1. Nat. Commun., 7, 13097 (2016).
• 15) Kikuchi T, Morizane A, Doi D, Okita K, Nakagawa M, Yamakado H, Inoue H, Takahashi R, Takahashi J. Idiopathic Parkinson’s disease patient-derived induced pluripotent stem cells function as midbrain dopaminergic neurons in rodent brains. J. Neurosci. Res., 95, 1829–1837 (2017).
• 16) Pamies D, Wiersma D, Katt ME, Zhao L, Burtscher J, Harris G, Smirnova L, Searson PC, Hartung T, Hogberg HT. Human IPSC 3D brain model as a tool to study chemical-induced dopaminergic neuronal toxicity. Neurobiol. Dis., 169, 105719 (2022).
• 17) Hung KC, Huang HJ, Lin MW, Lei YP, Lin AMY. Roles of autophagy in MPP⁺-induced neurotoxicity in vivo: the involvement of mitochondria and α-synuclein aggregation. PLOS ONE, 9, e91074 (2014).
• 18) Dauer W, Kholodilov N, Vila M, Trillat AC, Goodchild R, Larsen KE, Staal R, Tieu K, Schmitz Y, Yuan CA, Rocha M, Jackson-Lewis V, Hersch S, Sulzer D, Przedborski S, Burke R, Hen R. Resistance of α-synuclein null mice to the parkinsonian neurotoxin MPTP. Proc. Natl. Acad. Sci. U.S.A., 99, 14524–14529 (2002).
• 19) Klivenyi P, Siwek D, Gardian G, Yang L, Starkov A, Cleren C, Ferrante RJ, Kowall NW, Abeliovich A, Beal MF. Mice lacking alpha-synuclein are resistant to mitochondrial toxins. Neurobiol. Dis., 21, 541–548 (2006).
• 20) Fountaine TM, Venda LL, Warrick N, Christian HC, Brundin P, Channon KM, Wade-Martins R. The effect of α-synuclein knockdown on MPP⁺ toxicity in models of human neurons. Eur. J. Neurosci., 28, 2459–2473 (2008).