Inhibition of p38 Mitogen-Activated Protein Kinases Attenuates Methylmercury Toxicity in SH-SY5Y Neuroblastoma Cells

Abstract

Methylmercury (MeHg) is a toxic metal that causes irreversible damage to the nervous system, making it a risk factor for neuronal degeneration and diseases. MeHg activates various cell signaling pathways, particularly the mitogen-activated protein kinase (MAPK) cascades, which are believed to be important determinants of stress-induced cell fate. However, little is known about the signaling pathways that mitigate the neurotoxic effects of MeHg. Herein, we showed that pretreatment with a p38 MAPK-specific inhibitor, SB203580, attenuates MeHg toxicity in human neuroblastoma SH-SY5Y cells, whereas pretreatment with the extracellular signaling-regulated kinase inhibitor U0126 and the c-Jun N-terminal kinase inhibitor SP600125 does not. Specifically, we quantified the levels of intracellular mercury (Hg) and found that pretreatment with SB203580 reduced Hg levels compared to MeHg treatment alone. Further analysis showed that pretreatment with SB203580 increased multidrug resistance-associated protein 2 (MRP2) mRNA levels after MeHg treatment. These results indicate that detoxification of MeHg by p38 MAPK inhibitors may involve an efflux function of MeHg by inducing MRP2 expression.

INTRODUCTION

Methylmercury (MeHg) is one of the most hazardous environmental pollutants and is known to cause neurological deficits in humans.^1,2) It accumulates in the aquatic food chain, reaching maximal concentrations in predatory fish and marine mammals, including tuna, swordfish, whales, and dolphins. Many of us ingest MeHg-contaminated fish and seafood on a daily basis, making it the primary source of MeHg in humans. After ingestion, MeHg is easily absorbed in the intestine, rapidly distributed to various tissues, and accumulated in high concentrations in the brain. MeHg is highly neurotoxic to the developing brain and causes neural stem cell dysfunction and neurodevelopmental abnormalities. Recent studies investigated the effects of low concentrations of MeHg on various health conditions in adults and children.^3–5) These studies revealed that MeHg may also have adverse effects on fetal growth, neonatal function, the heart and vascular system, and immune function.

Cellular uptake of MeHg occurs as a complex with cysteine owing to its structural similarity to methionine⁶⁾ and is presumably mediated by the L-type large neutral amino acid transporters (LATs) LAT1 (SLC7A5) and LAT2 (SLC7A8).⁷⁾ After incorporation into cells, MeHg interacts with thiol groups on intracellular proteins and glutathione (GSH).^8,9) The MeHg-GSH conjugate can be a substrate for multidrug-resistance-associated proteins (MRPs), which are membrane transport proteins belonging to the ATP-binding cassette family. MRP1 (encoded by ABCC1)¹⁰⁾ and MRP2 (encoded by ABCC2)^11,12) are reportedly involved in the efflux of MeHg-GSH conjugates out of cells. Based on these observations, MRP-mediated efflux of MeHg is expected to play a key role in the elimination of MeHg from cells.

The molecular mechanisms linked to MeHg cytotoxicity are yet to be fully understood; however, several studies have demonstrated the activation of mitogen-activated protein kinase (MAPK) pathways,^13,14) the nuclear factor erythroid 2-related factor 2 pathway,^15,16) the PTEN/protein kinase B (Akt)/cAMP response element binding protein (CREB) pathway,^17,18) and autophagy¹⁹⁾ following MeHg exposure in vitro and/or in vivo. MAPKs play important roles in various cellular functions and determine cell fate in response to various stimuli.²⁰⁾ They consist of at least three families, including extracellular signal-regulated kinases 1/2 (ERKs 1/2), c-Jun N-terminal kinases (JNKs), and p38 MAPKs. ERKs 1/2 are activated in response to growth factors, cytokines, and proinflammatory stimuli, whereas JNKs and p38 MAPKs are activated in response to various environmental stressors and are important mediators promoting cell death.²¹⁾ MeHg has been shown to activate all three MAPK families, ERK 1/2, JNKs, and p38 MAPKs.^13,14) Accumulating evidence has demonstrated that activated p38 MAPKs are involved in MeHg-induced apoptosis in various cell lines; therefore, inhibiting p38 MAPKs results in the attenuation of MeHg cytotoxicity.^14,22) Among all MAPKs, p38 MAPKs are important activators of caspases through exogenous and endogenous pathways to execute apoptosis.^23,24) However, the mechanism through which MAPKs mitigate MeHg toxicity remains unclear and requires further elucidation.

In this study, we investigated the effect of p38, ERK, and JNK MAPK inhibitors on MeHg-induced cell death in SH-SY5Y cells. We also examined the effect of pretreatment with MAPK inhibitors on intracellular mercury (Hg) levels and the effect of MAPK inhibitors on the expression of LAT and MRP mRNA after MeHg treatment. The results showed that SB203580, a p38 MAPK-specific inhibitor, attenuated MeHg toxicity and reduced intracellular Hg levels. Furthermore, pretreatment with SB203580 promoted MeHg-induced MRP2 expression. Therefore, p38 MAPK inhibitors may protect cells from MeHg toxicity through increased efflux of MeHg via the induction of MRP2 production.

MATERIALS AND METHODS

Chemicals

Methylmercury chloride (MeHg) (Tokyo Kasei, Tokyo, Japan) was dissolved in dimethyl sulfoxide (DMSO) to make a 25 mM stock solution and stored at 4 °C. The mitogen-activated protein/extracellular signal-regulated kinase kinase (MEK) inhibitor U0126, p38 inhibitor SB203580 (Promega, Madison, WI, U.S.A.), and JNK inhibitor, SP600125 (Sigma-Aldrich, St. Louis, MO, U.S.A.), were dissolved in DMSO to make 10 mM stock solutions and stored at −20 °C. The MRP2 inhibitor MK-571 (Thermo Fisher Scientific, Rockford, IL, U.S.A.) was dissolved in DMSO to make a 50 mM stock solution. In all the experiments, the control group was treated with the same amount of DMSO.

Cell Culture

Human neuroblastoma SH-SY5Y cells were obtained from the American Type Culture Collection (Manassas, VA, U.S.A.) and cultured as previously described.²⁵⁾ Cells were grown in Dulbecco’s Modified Eagle’s Medium (Nacalai Tesque, San Diego, CA, U.S.A.) supplemented with 10% fetal bovine serum (Tissue Culture Biologicals, Seal Beach, CA, U.S.A.), 100 units/mL penicillin, and 100 µg/mL streptomycin in an incubator at 37 °C and a 5% CO₂ atmosphere. For MAPK inhibitor experiments, cells were pretreated for 1 h with 10 µM of each drug, followed by 1 µM MeHg.

Cell Viability Assay

Cell viability was measured using a Cell Counting Kit-8 (CCK-8, Dojindo, Kumamoto, Japan) assay, as previously reported.^25,26) Briefly, SH-SY5Y cells were seeded in 96-well plates (3 × 10⁴ cells/well) and incubated with different concentrations of MeHg (0.25, 0.5, and 1 µM) for 24 h. After treatment, 10 µL of tetrazolium salt WST-8 was added to each well, and the cells were incubated at 37 °C for 2 h. The number of viable cells was quantified by measuring absorbance at 450 nm using an iMark microplate absorbance reader (Bio-Rad, Hercules, CA, U.S.A.). Each CCK-8 assay was performed in triplicate. Cell viability was defined by the following equation:

  

Immunoblot Analysis

Cells were harvested and lysed in Radio-immunoprecipitation assay (RIPA) buffer (20 mM Tris pH 7.4, 0.1% sodium dodecyl sulfate (SDS), 1% sodium deoxycholate, 1% Nonidet P-40) containing a protease/phosphatase inhibitor cocktail (Cell Signaling Technology, Danvers, MA, U.S.A.) and sonicated for 10 s on ice. The protein concentration was determined using a Bio-Rad DC Protein Assay kit (Bio-Rad). The cell lysate was resolved via SDS-polyacrylamide gel electrophoresis and transferred to polyvinylidene difluoride membranes. The membranes were incubated with the following specific primary antibodies (sourced from Cell Signaling unless overwise specified): anti-phospho-ERK1/2 (#9661; 1 : 1000), anti-phospho-JNK (#9251; 1 : 1000), anti-total-JNK (#9252; 1 : 1000), anti-phospho-p38 (#9211; 1 : 1000), anti-total p38 (#9212; 1 : 1000), anti-total-ERK (sc-94; 1 : 1000; Santa Cruz, Inc., Heidelberg, Germany), anti-glyceraldehyde 3-phosphate dehydrogenase (GAPDH, sc-25778; 1 : 2000, Santa Cruz), and horseradish peroxidase-conjugated anti-rabbit secondary antibody (NA934V; 1 : 8000; GE Healthcare, Buckinghamshire, U.K.). Immunoblots were visualized on an Amersham Imager 680 (GE Healthcare) using enhanced chemiluminescence detection reagents. Quantification of blots was performed using ImageQuant TL (GE Healthcare).

RT-PCR

Total RNA was extracted from SH-SY5Y cells using an RNA extraction kit (NucleoSpin RNA kit; Macherey-Nagel, Bethlehem, PA, U.S.A.) according to the manufacturer’s protocol and then subjected to reverse transcription using the PrimeScript RT Master Mix (TaKaRa, Shiga, Japan). Real-time PCR was performed using PowerUp SYBR Green Master Mix (Thermo Fisher Scientific) and was run on a CFX-96 thermal cycler system (Bio-Rad). The mRNA levels of the housekeeping gene Gapdh were used to normalize cDNA levels. The primer sequences used are listed in Table 1. The results were evaluated using the Bio-Rad CFX Manager software (version 3.1; Bio-Rad). The quantification cycle value was recorded, and the relative expression of the target gene was determined via the 2^−∆∆Ct method.

Table 1. Primer Sequences Used for Real-Time Quantitative Reverse Transcriptase PCR (qRT-PCR)

GenesGeneBank No.	Primers (5′-3′)	Amplification size (bp)
LAT1	Sense: GCTGCTCATCATCCGGCCTT	140
NM_003486	Antisense: TGAGCAGCAGCACGCAGAG
LAT2	Sense: AGGCACCGAAACAACACCGA	150
NM_012244	Antisense: GCCGATGATGTTCCCTACGATGA
MRP1	Sense: CCGCTCTGGGACTGGAATGT	90
NM_004996	Antisense: ACAAGGCACCCACACGAGGA
MRP2	Sense: TGCACAAGCAACTGCTGAAC	122
NM_000392	Antisense: AGGCAGGGTGTCATCCACT
MRP3	Sense: TGGAGGAGAAGGACCTCTGG	123
NM_003786	Antisense: GTGCTGCTGAAGCCTTGTG
MRP4	Sense: GCGTGTTCTTCTGGTGGCTC	106
NM_005845	Antisense: AGGTGCTGTGAGCGGTCTTC
MRP5	Sense: CAAGGAAGCGGGAACACCAC	109
NM_005688	Antisense: TGGAGAGGGCGTAGATGCTG
MRP6	Sense: TCCAATACGGCAGGGTGAAGG	94
NM_001171	Antisense: CAGAGGAAGAGGAAGAGTGCGT
MRP7	Sense: AACAGATGGCAAGGTGAGGC	112
NM_001198934	Antisense: TGAAGCAGTGGCCTGTGGTG
MRP8	Sense: GTCAGCGGGAACATCAGGGA	143
NM_032583	Antisense: CCCCGCTCTCCAATCTCTGT
GAPDH	Sense: GCCAAGGTCATCCATGACAACT	95
NM_002046	Antisense: GAGGGGCCATCCACAGTCTT

Transfection of Small Interfering RNA (siRNA)

The Silencer Select Pre-Designed siRNA against human ABCC2/Mrp2 mRNA (siRNA ID: s3227) and the control siRNA (Silencer Select Negative Control, 4390843) were purchased from Thermo Fisher Scientific. HeLa cells were seeded in 6-well plates (2 × 10⁵ cells/well). Cells were transfected with siRNAs at 30 pmol using Lipofectamine RNAiMAX (Thermo Fisher Scientific) in Opti-MEM I Reduced Serum Medium (Thermo Fisher Scientific). At 48 h after transfection, cells were treated with 8 µM MeHg for 24 h and quantitative real-time PCR was performed to confirm the specific gene silencing and measured intracellular mercury content.

Mercury Analysis

Cells in 6-well plates were lysed with RIPA buffer, and the intercellular mercury content in the cell lysate was determined using a Mercury Analyzer MA-2 (Nippon Instruments Co., Tokyo, Japan) as previously described.²⁶⁾

Statistical Analysis

Quantitative data are expressed as means ± standard deviation (S.D.). Data were analyzed by one-way ANOVA, follwed by Tukey’s honestly significant difference (HSD) test (p<0.05) or Dunnett’s multiple comparison test. Two-group comparisons were analyzed by Welch’s two sample t-test in R software (ver. 4.0.5).

RESULTS

Effect of MeHg on SH-SY5Y Cell Morphology and Viability

To determine the effect of MeHg on SH-SY5Y cells, cell morphology was assessed at various time points (0, 6, 9, 18, and 24 h) after exposure to different MeHg concentrations (0.5, 0.75, 1, 1.5, and 2 µM). Treatment with low MeHg concentrations (0.5, 0.75, and 1 µM) did not cause drastic changes in cell morphology or detached cell numbers after 6, 9, and 18 h of exposure. However, after 24 h, these concentrations resulted in a slight rounding of the cells and a few detached cells. At concentrations of 1.5 and 2 µM, changes in cell morphology started earlier, with the cells becoming rounded after only 6 h, and the number of cells attached to the plate decreased at 18 and 24 h (Fig. 1A). Next, we confirmed the toxic effects of MeHg on SH-SY5Y cells by measuring cell viability. A slight reduction in cell viability was observed at low concentrations (0.5, 0.75, and 1 µM) in a concentration-dependent manner. As a result of exposure to high concentrations (1.5 and 2 µM), cell viability significantly decreased after 6 h and reached approximately 20% by 24 h of exposure (Fig. 1B). Based on the data shown in Figs. 1A and B, 1 µM MeHg was used for all subsequent experiments as we aimed to address the role of MAPKs during cell treatment with lightly cytotoxic MeHg concentrations, representative of typical MeHg exposure.

Fig. 1. Effect of Methylmercury (MeHg) on Cell Morphology and Viability of SH-SY5Y Cells over Time

(A) Changes in cell morphology, as observed under a phase contrast microscope, after treatment with different concentrations of MeHg and periods of time (the red scale bar represents 20 µm). (B) Cell viability over time following treatment with various concentrations of MeHg for 24 h. Data are expressed as the mean ± S.D. from three independent experiments. Significant differences were determined by one-way ANOVA with multiple comparisons corrected by Dunnett’s test. *** p < 0.001, ** p < 0.01, and * p < 0.05.

Inhibition of p38 MAPKs Significantly Attenuates MeHg-Induced Cell Death

Our previous study demonstrated that MeHg activates MAPKs in mouse embryonic fibroblast cells.¹⁹⁾ We further examined whether MeHg activates MAPKs in SH-SY5Y cells as well. Western blot analysis of phospho-p38, phospho-ERK, and phospho-JNK, the active forms of each respective MAPK family, was performed to examine the effect of MeHg on MAPKs activation. The data revealed that the exposure of SH-SY5Y cells to MeHg increased the levels of phospho-p38 and phospho-JNK between 3–9 h and 6–9 h, respectively; however, the levels of total p38 and JNK remained unchanged over time (Fig. 2A). We then examined whether the inhibition of MAPKs affects MeHg toxicity. As shown in Fig. 2B, the specific inhibition of p38 MAPK activity with SB203580 attenuated MeHg-induced cell death. Unlike the p38 inhibitor, treatment with MEK or JNK inhibitors, in addition to MeHg, decreased cell viability compared to treatment with MeHg alone. To determine whether the inhibition of p38 mediates intracellular Hg levels, cells were co-treated with MeHg and SB203580 for 24 h, following which intracellular Hg levels were measured. Treatment with SB203580 significantly decreased the intracellular Hg levels in MeHg-treated cells by approx. 60% compared to those not treated with an inhibitor (Fig. 2C). These results indicate that the inhibition of p38 MAPK is important for the attenuation of MeHg-induced cell death. Furthermore, the results suggest that p38 MAPK inhibition may affect the expression of molecules that regulate intracellular Hg content.

Fig. 2. Inhibition of p38 MAPKs Significantly Attenuates MeHg-Induced Cell Death

(A) Phosphorylation of MAPKs (p38, ERK, and JNK) in SH-SY5Y cells after treatment with 1 µM MeHg for different time periods. (B) Effects of MAPK inhibitors on MeHg cytotoxicity. Cells were pretreated with or without inhibitors against ERK, JNK, and p38 for 1 h followed by treatment with 1 µM MeHg for 24 h. Cell viability was assessed using the CCK-8 assay. (C) Effects of MAPK inhibitors on intracellular MeHg concentrations. Cells were pretreated with or without inhibitors against ERK, JNK, and p38 for 1 h followed by treatment with 1 µM MeHg for 24 h. Intracellular mercury (Hg) was measured using a Mercury Analyzer MA-2. Data are expressed as the mean ± S.D. from three independent experiments. Significant differences were determined by one-way ANOVA with multiple comparisons corrected by Dunnett’s test. *** p < 0.001, ** p < 0.01, and * p < 0.05. N.S. indicates not statistically significant.

Expression Profiles of LATs and MRPs at Varying MeHg Exposure Times

LATs and MRPs are thought to be involved in cellular MeHg influx and efflux, respectively. To gain insights into the mechanisms underlying the reduction of intracellular Hg content by p38 MAPK inhibition, we examined the effects of MeHg on the expression of LATs and MRPs mRNA in SH-SY5Y cells. The exposure of cells to MeHg significantly increased relative mRNA expression levels of LAT1, LAT2, MRP2, and MRP3 compared to those of the control group (Fig. 3). However, no significant increase in MRP1 or MRP4 levels was observed. No significant differences were observed in MRP5, MRP6, or MRP7 mRNA expressions in MeHg-treated cells compared to those in the control (Supplementary Fig. 1). Specifically, the expression of LAT1, LAT2, and MRP2 mRNAs increased at early time points (6 and 9 h), while there was a slight change in MRP3 mRNA expression later. Therefore, the changes in LAT1, LAT2, or MRP2 expressions early during exposure may significantly reduce MeHg-induced cell death within 24 h by decreasing cellular Hg accumulation.

Fig. 3. Effects of MeHg on the Expression of L-Type Amino Acid Transporters (LAT1 and LAT2) and Multidrug Resistance-Associated Proteins (MRP1–4) in SH-SY5Y Cells

All values were normalized to glyceraldehyde 3-phosphate dehydrogenase (GAPDH) expression and the expression of each gene in untreated controls was set at 1. Data are expressed as the mean ± S.D. from three independent experiments. Significant differences were determined by one-way ANOVA with multiple comparisons corrected by Dunnett’s test. p-Values compared to untreated controls. *** p < 0.001, ** p < 0.01, and * p < 0.05. N.S. indicates not statistically significant.

Inhibition of p38 MAPKs Significantly Decreases the Level of MeHg-Induced Cell Death

We further examined the expression of LATs and MRPs mRNAs following MeHg or MeHg + MAPK inhibitor treatment to obtain insights into the transporter(s) involved in the reduction of intracellular Hg. The data showed that the MEK inhibitor increased the LAT1 and LAT2 mRNA expression, whereas it decreased that of MRP3 in MeHg-treated cells (Fig. 4). Notably, p38 inhibitor treatment increased the mRNA expression of MRP2 compared to that of cells treated with MeHg alone. Unlike MEK and p38 inhibitors, the JNK inhibitor did not alter the mRNA levels of LATs and MRPs. The increased expression of MRP2 upon p38 MAPK inhibitor treatment suggests that MRP2 may be a candidate MeHg efflux transporter associated with p38 inhibition in SH-SY5Y cells.

Fig. 4. Effects of MAPK Inhibitors on MeHg-Induced Expression of L-Type Amino Acid Transporters (LAT1 and LAT2) and MRP1–4 mRNA in SH-SY5Y Cells

Cells were pretreated with or without inhibitors against ERK (U; 10 µM U0126), JNK (SP; 10 µM SP600125), and p38 (SB; 10 µM SB203580) for 1 h followed by treatment with 1 µM MeHg for 9 h. Relative mRNA levels of LAT1, LAT2, and MRP1-4 were assessed using real-time PCR. All values were normalized to glyceraldehyde 3-phosphate dehydrogenase (GAPDH) expression and the expression of each gene in untreated controls was set at 1. Expression of each gene after treatment with MAPK inhibitors alone for 9 h is represented by the square boxes. Data are expressed as the mean ± S.D. from three independent experiments. Significant differences were determined by one-way ANOVA with multiple comparisons corrected by Dunnett’s test. *** p < 0.001, ** p < 0.01, and * p < 0.05. N.S. indicates not statistically significant.

MRP2 Inhibitor MK-571 Increases Cell Death and Intracellular Hg Level in MeHg-Treated Cells

To investigate whether the inhibition of MRP2 promotes increased intracellular Hg levels, the morphology of SH-SY5Y cells was assessed after co-exposure to an MRP2 inhibitor, MK-571, and MeHg for 24 h. Treatment with MK-571 and MeHg increased the number of rounded cells compared to that of cells treatment with MeHg or MK-571 alone (Fig. 5A) and reduced cell viability (Fig. 5B). Exposure to both MeHg and MK-571 significantly increased intracellular Hg levels compared to exposure to MeHg alone (Fig. 5C). In addition, we investigated the effect of MRP2 knockdown on intracellular MeHg content in HeLa cells. MRP2 siRNA treatment significantly reduced the level of MRP2 mRNA in the HeLa cells (Supplementary Fig. 2A) and increased the intracellular Hg level compared to that in the cells transfected with negative control siRNA (Supplementary Fig. 2B). Taken together, our results suggest that MRP2 contributes, at least in part, to the efflux of MeHg and reduces cytotoxicity.

Fig. 5. MRP2 Inhibitor MK-571 Increases Cell Death and Intracellular Hg Level in MeHg-Treated Cells

(A) SH-SY5Y cell morphology (the red scale bars represent 100 µm). (B) Cell viability after treatment with 1 µM MeHg in the absence or presence of 50 µM MK-571 for 24 h. Significant differences were determined by one-way ANOVA, followed by Tukey’s HSD test. Different alphabets above the bar graphs represent statistical significance at the 5% level. Error bars represent the standard deviations; n = 8. (C) Hg concentrations after treatment with 1 µM MeHg in the absence or presence of 50 µM MK-571 for 24 h. Values were normalized to the protein concentration of each sample. Data are expressed as the mean ± S.D. from three independent experiments. Significant differences were determined by one-way ANOVA with multiple comparisons corrected by Dunnett’s test. *** p < 0.001.

DISCUSSION

Among the MAPKs, the activation of JNK and p38 is involved in cell differentiation and apoptosis induced by various environmental stimuli.²⁷⁾ The inhibition of these MAPKs results in the prevention of cell death and can aid in the treatment of various diseases, such as cancer, arthritis, and neuropathy.^28–30) Before now, p38 MAPKs are reportedly involved in the mitigation of MeHg toxicity.²²⁾ Additionally, it is believed that reducing intracellular Hg concentrations may mitigate the toxicity of MeHg.³¹⁾ However, the relationship between MAPK inhibition and intracellular Hg concentrations is unknown. Therefore, the aim of this study was to clarify the inhibitory effect of MAPKs on MeHg-induced cell death and its relationship with intracellular Hg concentrations. To advance the understanding of the effects of MAPK inhibitors on MeHg toxicity, the expression of MRPs as potential molecules involved in intracellular Hg regulation was examined.

The first step of the study was to evaluate cell viability after treatment with five concentrations of MeHg (0.5, 0.75, 1, 1.5, and 2 µM). The average MeHg concentration in previous studies using SH-SY5Y cells was 1 µM MeHg, a concentration at which cell viability after 24 h of treatment was approximately 50%.^32,33) As in previous studies, cell viability in this study was confirmed to be approximately 50% after 24 h of treatment with 1 µM MeHg (Fig. 1). Guida et al. examined the effect of 1 µM MeHg on the activation of MAPKs in SH-SY5Y cells and demonstrated that MeHg exposure activated p38 MAPKs but not ERK and JNK MAPKs.²²⁾ Additionally, their results showed that siRNA against p38 MAPKs significantly blocked MeHg-induced cell death. Lu et al. reported that the p38 MAPK inhibitor SB203580 attenuated MeHg-induced cytotoxicity in Neuro-2a cells.¹⁴⁾ Similar to these studies, we showed that the p38 MAPK inhibitor SB203580 blocked MeHg-induced cell death in SH-SY5Y cells (Fig. 2A). To the best of our knowledge, this is the first study to show that pretreatment with SB203580 before MeHg exposure directly reduces intracellular Hg concentrations (Fig. 2B). These findings suggest that p38 MAPK inhibition protects cells against MeHg toxicity by reducing intracellular Hg.

Miura and Clarkson indicated the importance of reducing the influx and/or increasing the efflux of MeHg to inhibit its intracellular accumulation.³⁴⁾ In this study, we found that treatment with MeHg significantly induced mRNA expression of LAT1, LAT2, MRP2, and MRP3 in SH-SY5Y cells (Fig. 3). Usuki et al. reported that MeHg upregulates the mRNA expression of LAT1, SNAT2, and ABCC4/MRP4 in a dose-dependent manner in mouse myogenic C2C12-DMPK160 cells.³¹⁾ The results of the siRNA study of LAT1 and ABCC4/MRP4 indicated that LAT1 and MRP4 are major contributors to the influx and efflux of MeHg, respectively. However, LATs, known transporters for MeHg influx, appear to be less involved in the reduction of intracellular Hg content by the p38 MAPK inhibitor, as their expression was increased by MeHg exposure. In addition, LATs and MRP3 mRNA expression, which was induced by MeHg, was slightly affected by pretreatment with SB203580. In contrast, MRP2 mRNA expression was enhanced by pretreatment with SB203580 (Fig. 4). Therefore, we speculate that MRP2 is most likely involved in the reduction of intracellular Hg content and protection against cell death by SB203580 pretreatment.

MRP2 is a major transporter responsible for the secretion of glutathione-drug conjugates, thereby playing an essential role in cell detoxification and defense against oxidative stress and environmental electrophiles.^35,36) MeHg reacts with GSH, leading to the formation of a MeHg-GSH adduct that is excreted by MRP2 into the extracellular space.^11,35) MK-571 is a selective MRP family inhibitor,^37,38) and pretreatment with MK-571 increased intracellular Hg levels following MeHg treatment in SH-SY5Y cells.³⁹⁾ Consistent with these results, pretreatment with MK-571 prior to MeHg exposure increased Hg levels and cytotoxicity in SH-SY5Y cells (Figs. 5A–C). The knockdown of MRP2 by siRNA enhanced Hg levels in HeLa cells supporting the notion that MRP2 potentially controls intracellular MeHg levels (Supplementary Figs. 2A, B). However, we did not observe any significant difference in cell viability between si-NC and si-MRP2 cells after MeHg treatment (Supplementary Fig. 2C). One possibility is that the elevation of intracellular Hg content was mild in si-MRP2 cells compared to that in MK-571 treated cells (Supplementary Fig. 2D). Since MK-571 has been shown to inhibit MRP1 and MRP4 in addition to MRP2,⁴⁰⁾ multiple MRPs may contribute to the efflux action of MeHg.

Because p38 MAPKs play an important role in physiological events, such as cell differentiation, cell growth, cell cycle, and inflammation,⁴¹⁾ p38 MAPK itself may not be an ideal candidate. However, p38 MAPK inhibitors represent a potential therapeutic alternative to reduce MeHg toxicity. The identification and functional elucidation of molecules that reduce intracellular MeHg through p38 MAPK inhibitors may provide better results, enabling the reduction of intracellular MeHg, while maintaining the physiological functions of p38 MAPKs.

In summary, we revealed that pretreatment with SB203580 prior to MeHg treatment enhanced SH-SY5Y cell viability, decreased intracellular Hg levels, and increased MRP2 mRNA expression. Thus, our findings indicate that SB203580 attenuates the toxic effects of MeHg, potentially through MRP2 induction, at least in part, to promote the survival of neural cells. We suggest that the identification of target molecules of p38 MAPK that mediate MRP2 expression may be a novel approach for the mitigation of MeHg toxicity.

Acknowledgments

We thank Mr. M. Tanabe, Ms. A. Miyamoto, and A. Sumi for technical assistance. This work was supported in part by the Grants-in-Aid for Scientific Research C (Grant Number: 22K12392) and the Study of the Health Effects of Heavy Metals organized by the Ministry of Environment, Japan.

Conflict of Interest

The authors declare no conflict of interest.

Supplementary Materials

This article contains supplementary materials.

REFERENCES

• 1) Gilbert SG, Grant-Webster KS. Neurobehavioral effects of developmental methylmercury exposure. Environ. Health Perspect., 103 (Suppl. 6), 135–142 (1995).
• 2) Puty B, Leão LKR, Crespo-Lopez ME, Almeida APCPSC, Fagundes NCF, Maia LC, Lima RR. Association between methylmercury environmental exposure and neurological disorders: a systematic review. J. Trace Elem. Med. Biol., 52, 100–110 (2019).
• 3) Yokoo EM, Valente JG, Grattan L, Schmidt SL, Platt I, Silbergeld EK. Low level methylmercury exposure affects neuropsychological function in adults. Environ. Health, 2, 8 (2003).
• 4) Auger N, Kofman O, Kosatsky T, Armstrong B. Low-level methylmercury exposure as a risk factor for neurologic abnormalities in adults. Neurotoxicology, 26, 149–157 (2005).
• 5) Karagas MR, Choi AL, Oken E, Horvat M, Schoeny R, Kamai E, Cowell W, Grandjean P, Korrick S. Evidence on the human health effects of low-level methylmercury exposure. Environ. Health Perspect., 120, 799–806 (2012).
• 6) Bridges CC, Zalups RK. Molecular mimicry as a mechanism for the uptake of cysteine S-conjugates of methylmercury and inorganic mercury. Chem. Res. Toxicol., 19, 1117–1118, author reply, 1118 (2006).
• 7) Simmons-Willis TA, Koh AS, Clarkson TW, Ballatori N. Transport of a neurotoxicant by molecular mimicry: the methylmercury–L-cysteine complex is a substrate for human L-type large neutral amino acid transporter (LAT) 1 and LAT2. Biochem. J., 367, 239–246 (2002).
• 8) Kanda H, Toyama T, Shinohara-Kanda A, Iwamatsu A, Shinkai Y, Kaji T, Kikushima M, Kumagai Y. S-Mercuration of rat sorbitol dehydrogenase by methylmercury causes its aggregation and the release of the zinc ion from the active site. Arch. Toxicol., 86, 1693–1702 (2012).
• 9) Farina M, Aschner M. Glutathione antioxidant system and methylmercury-induced neurotoxicity: an intriguing interplay. Biochim. Biophys. Acta, Gen. Subj., 1863, 129285 (2019).
• 10) Rush T, Liu X, Nowakowski AB, Petering DH, Lobner D. Glutathione-mediated neuroprotection against methylmercury neurotoxicity in cortical culture is dependent on MRP1. Neurotoxicology, 33, 476–481 (2012).
• 11) Ballatori N. Transport of toxic metals by molecular mimicry. Environ. Health Perspect., 110 (Supplement 5), 689–694 (2002).
• 12) Madejczyk MS, Aremu DA, Simmons-Willis TA, Clarkson TW, Ballatori N. Accelerated urinary excretion of methylmercury following administration of its antidote N-acetylcysteine requires MRP2/Abcc2, the apical multidrug resistance-associated protein. J. Pharmacol. Exp. Ther., 322, 378–384 (2007).
• 13) Fujimura M, Usuki F, Sawada M, Takashima A. Methylmercury induces neuropathological changes with tau hyperphosphorylation mainly through the activation of the c-Jun-N-terminal kinase pathway in the cerebral cortex, but not in the hippocampus of the mouse brain. Neurotoxicology, 30, 1000–1007 (2009).
• 14) Lu TH, Hsieh SY, Yen CC, Wu HC, Chen KL, Hung DZ, Chen CH, Wu CC, Su YC, Chen YW, Liu SH, Huang CF. Involvement of oxidative stress-mediated ERK1/2 and p38 activation regulated mitochondria-dependent apoptotic signals in methylmercury-induced neuronal cell injury. Toxicol. Lett., 204, 71–80 (2011).
• 15) Toyama T, Sumi D, Shinkai Y, Yasutake A, Taguchi K, Tong KI, Yamamoto M, Kumagai Y. Cytoprotective role of Nrf2/Keap1 system in methylmercury toxicity. Biochem. Biophys. Res. Commun., 363, 645–650 (2007).
• 16) Kumagai Y, Kanda H, Shinkai Y, Toyama T. The role of the Keap1/Nrf2 pathway in the cellular response to methylmercury. Oxid. Med. Cell. Longev., 2013, 848279 (2013).
• 17) Unoki T, Abiko Y, Toyama T, Uehara T, Tsuboi K, Nishida M, Kaji T, Kumagai Y. Methylmercury, an environmental electrophile capable of activation and disruption of the Akt/CREB/Bcl-2 signal transduction pathway in SH-SY5Y cells. Sci. Rep., 6, 28944 (2016).
• 18) Fujimura M, Usuki F. Site-specific neural hyperactivity via the activation of MAPK and PKA/CREB pathways triggers neuronal degeneration in methylmercury-intoxicated mice. Toxicol. Lett., 271, 66–73 (2017).
• 19) Takanezawa Y, Nakamura R, Sone Y, Uraguchi S, Kiyono M. Atg5-dependent autophagy plays a protective role against methylmercury-induced cytotoxicity. Toxicol. Lett., 262, 135–141 (2016).
• 20) Wada T, Penninger JM. Mitogen-activated protein kinases in apoptosis regulation. Oncogene, 23, 2838–2849 (2004).
• 21) Roux PP, Blenis J. ERK and p38 MAPK-activated protein kinases: a family of protein kinases with diverse biological functions. Microbiol. Mol. Biol. Rev., 68, 320–344 (2004).
• 22) Guida N, Laudati G, Mascolo L, Valsecchi V, Sirabella R, Selleri C, Di Renzo G, Canzoniero LM, Formisano L. p38/Sp1/Sp4/HDAC4/BDNF axis is a novel molecular pathway of the neurotoxic effect of the methylmercury. Front. Neurosci., 11, 8 (2017).
• 23) Zarubin T, Han J. Activation and signaling of the p38 MAP kinase pathway. Cell Res., 15, 11–18 (2005).
• 24) Sui X, Kong N, Ye LI, Han W, Zhou J, Zhang Q, He C, Pan H. p38 and JNK MAPK pathways control the balance of apoptosis and autophagy in response to chemotherapeutic agents. Cancer Lett., 344, 174–179 (2014).
• 25) Takanezawa Y, Nakamura R, Sugimoto T, Ohshiro Y, Uraguchi S, Kiyono M. p62/Sequestosome 1 attenuates methylmercury-induced endoplasmic reticulum stress in mouse embryonic fibroblasts. Toxicol. Lett., 353, 93–99 (2021).
• 26) Takanezawa Y, Nakamura R, Matsuda H, Yagi T, Egawa Z, Sone Y, Uraguchi S, Adachi T, Kiyono M. Intracellular demethylation of methylmercury to inorganic mercury by organomercurial lyase (MerB) strengthens cytotoxicity. Toxicol. Sci., 170, 438–451 (2019).
• 27) Nagata Y, Todokoro K. Requirement of activation of JNK and p38 for environmental stress-induced erythroid differentiation and apoptosis and of inhibition of ERK for apoptosis. Blood, 94, 853–863 (1999).
• 28) Dapper JD, Crish SD, Pang IH, Calkins DJ. Proximal inhibition of p38 MAPK stress signaling prevents distal axonopathy. Neurobiol. Dis., 59, 26–37 (2013).
• 29) Lan CN, Cai WJ, Shi J, Yi ZJ. MAPK inhibitors protect against earlystage osteoarthritis by activating autophagy. Mol. Med. Rep., 24, 829 (2021).
• 30) Lee S, Rauch J, Kolch W. Targeting MAPK signaling in cancer: mechanisms of drug resistance and sensitivity. Int. J. Mol. Sci., 21, 1102 (2020).
• 31) Usuki F, Fujimura M, Yamashita A. Endoplasmic reticulum stress preconditioning modifies intracellular mercury content by upregulating membrane transporters. Sci. Rep., 7, 12390 (2017).
• 32) Guida N, Laudati G, Anzilotti S, Sirabella R, Cuomo O, Brancaccio P, Santopaolo M, Galgani M, Montuori P, Di Renzo G, Canzoniero LM, Formisano L. Methylmercury upregulates RE-1 silencing transcription factor (REST) in SH-SY5Y cells and mouse cerebellum. Neurotoxicology, 52, 89–97 (2016).
• 33) Dao CV, Shiraishi M, Miyamoto A. The MARCKS protein amount is differently regulated by calpain during toxic effects of methylmercury between SH-SY5Y and EA. hy926 cells. J. Vet. Med. Sci., 79, 1931–1938 (2017).
• 34) Miura K, Clarkson TW. Reduced methylmercury accumulation in a methylmercury-resistant rat pheochromocytoma PC12 cell line. Toxicol. Appl. Pharmacol., 118, 39–45 (1993).
• 35) Suzuki H, Sugiyama Y. Excretion of GSSG and glutathione conjugates mediated by MRP1 and cMOAT/MRP2. Semin. Liver Dis., 18, 359–376 (1998).
• 36) Ballatori N, Hammond CL, Cunningham JB, Krance SM, Marchan R. Molecular mechanisms of reduced glutathione transport: role of the MRP/CFTR/ABCC and OATP/SLC21A families of membrane proteins. Toxicol. Appl. Pharmacol., 204, 238–255 (2005).
• 37) van der Kolk DM, De Vries EG, Koning JA, van den Berg E, Müller M, Vellenga E. Activity and expression of the multidrug resistance proteins MRP1 and MRP2 in acute myeloid leukemia cells, tumor cell lines, and normal hematopoietic CD34+ peripheral blood cells. Clin. Cancer Res., 4, 1727–1736 (1998).
• 38) Chen ZS, Lee K, Kruh GD. Transport of cyclic nucleotides and estradiol 17-β-D-glucuronide by multidrug resistance protein 4. J. Biol. Chem., 276, 33747–33754 (2001).
• 39) Toyama T, Shinkai Y, Yasutake A, Uchida K, Yamamoto M, Kumagai Y. Isothiocyanates reduce mercury accumulation via an Nrf2-dependent mechanism during exposure of mice to methylmercury. Environ. Health Perspect., 119, 1117–1122 (2011).
• 40) Tivnan A, Zakaria Z, O’Leary C, Kögel D, Pokorny JL, Sarkaria JN, Prehn JH. Inhibition of multidrug resistance protein 1 (MRP1) improves chemotherapy drug response in primary and recurrent glioblastoma multiforme. Front. Neurosci., 9, 218 (2015).
• 41) Cuenda A, Rousseau S. p38 MAP-kinases pathway regulation, function and role in human diseases. Biochim. Biophys. Acta, 1773, 1358–1375 (2007).