Icariin Regulates EMT and Stem Cell-Like Character in Breast Cancer through Modulating lncRNA NEAT1/TGFβ/SMAD2 Signaling Pathway

Abstract

Metastases and drug resistance are the major risk factors associated with breast cancer (BC), which is the most common type of tumor affecting females. Icariin (ICA) is a traditional Chinese medicine compound that possesses significant anticancer properties. Long non-coding RNAs (lncRNAs) are involved in a wide variety of biological and pathological processes and have been shown to modulate the effectiveness of certain drugs in cancer. The purpose of this study was to examine the potential effect of ICA on epithelial mesenchymal transition (EMT) and stemness articulation in BC cells, as well as the possible relationship between its inhibitory action on EMT and stemness with the NEAT1/transforming growth factor β (TGFβ)/SMAD2 pathway. The effect of ICA on the proliferation (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) and colony assays), EMT (Western blotting, immunofluorescence, and wound healing), and stemness (mammosphere formation assays, Western blotting) of BC cells were examined. According to the findings, ICA suppressed the proliferation, EMT, and stem cell-like in MDA-MB-231 cells, and exerted its inhibitory impact by downregulating the TGFβ/SMAD2 signaling pathway. ICA could significantly downregulate the expression of lncRNA NEAT1, and silencing NEAT1 enhanced the effect of ICA in suppressing EMT and expression of different stem cell markers. In addition, silencing NEAT1 was found to attenuate the TGFβ/SMAD2 signaling pathway, thereby improving the inhibitory impact of ICA on stemness and EMT in BC cells. In conclusion, ICA can potentially inhibit the metastasis of BC via affecting the NEAT1/TGFβ/SMAD2 pathway, which provides a theoretical foundation for understanding the mechanisms involved in potential application of ICA for BC therapy.

INTRODUCTION

Among the various gynecological cancers, breast cancer (BC) has the highest rates of mortality and morbidity due to its widespread prevalence.¹⁾ Advanced distant metastasis is considered to be the primary cause of death in BC, and although clinical diagnosis and local systemic therapy have significantly improved survival, the prognosis with metastasis remains poor in BC patients.²⁾

The beneficial effects of epimedium were first published in the Shennong Materia Medica Classic. It has the ability to dissipate wind and moisture, strengthen bones as well as muscles, and tonify renal Yang. It is a normally used Chinese herb for BC treatment. Our preceding studies confirmed that Epimedium can effectively inhibit Epithelial mesenchymal transition (EMT) and stemness expression of MDA-MB-231 cells. Icariin (ICA), an active compound extracted from Epimedium, has been found to exert bone protection, immune regulation³⁾ and anti-tumor effects,⁴⁾ as it can promote apoptosis of a variety of cancer cells.⁵⁾ In BC, ICA was found to display radiosensitizing effect, could inhibit the proliferation and autophagy of 4T1 cells⁶⁾ and MCF-7 cells, and induce their apoptosis.⁷⁾ ICA can also reduce the tumor immunosuppressive environment and enhance its anti-BC effect by inhibiting nuclear factor-kappaB (NF-κB) signaling pathway.⁸⁾ At present, studies describing the impact of ICA on BC cells mainly focus on their phenotypic characteristics and biological functions, but the detailed mechanism of action of ICA is not completely understood.

EMT is an important process through which non-polarized epithelial cells change into polarized, motile mesenchymal cells by rearranging their cytoskeleton.⁹⁾ When epithelial cells are transformed into the mesenchymal cells, loss of Zonula occludens-1 (ZO-1) and Epithelia Cadherin (E-cadherin) can lead to reduced adhesion potential.¹⁰⁾ In addition, expression of fibronectin, Neural-cadherin (N-cadherin), and Vimentin markers¹¹⁾ can cause enhanced tumor migration, invasion, and impart anti-apoptosis ability.^12,13) Cancer stem cells (CSCs) play a key role in tumor prevalence and relapse.¹⁴⁾ Breast cancer stem cells (BCSCs) are responsible for the process of drug resistance¹⁴⁾ and constitute a major challenge in treatment of BC. Targeted therapy of BCSCs, induction of apoptosis and differentiation of CSCs, inhibition of self-renewal and division of CSCs, can serve as an important strategy for BC therapy. Interestingly, EMT can not only promote tumor cell metastasis and invasion, but can also promote CSCs phenotype. It was found that transforming growth factor β1 (TGFβ1) can induce EMT.¹⁵⁾ In BC, TGFβ1-induced EMT-producing mesenchymal cells acquired a CD44⁺/CD24^−/low BCSCs phenotype.⁹⁾ Thus, the mutual promotion of EMT and CSCs may be responsible for the progression mechanism and resistant to the various treatment strategies used against BC.

Long non-coding RNAs (lncRNAs) can affect the treatment as well as prognosis of diseases,¹⁶⁾ and play an important role in promoting or suppressing cancer. For instance, overexpression of the lncRNA tPA can activate the TGF-β signaling pathway, promote EMT in BC, and cause BC invasion and migration.¹²⁾ The process of EMT and generation of CSCs in BC also involve SNHG6, LCC-Spry1, H19, and LBCS,^17–20) among other lncRNAs. Excessive levels of lncRNA NEAT1 have been linked to a dismal outcome in BC patients and can promote the incidence of EMT, whereas the knockout of this gene can limit the markers associated with BCSCs and increase susceptibility to chemotherapy sellers.^21–23) Although NEAT1 is positively correlated with EMT and CSCs characteristics, however the role of NEAT1 in mediating the anti-tumor effects of ICA in BC cells remains unclear. In this study, we have examined the mechanism through which ICA can affect EMT and BCSCs in MDA-MB-231 cells, and discovered that NEAT1 was significantly up-regulated in BC. Interestingly, NEAT1 silencing enhanced ICA inhibition on the EMT and BCSCs characteristics of BC cells, both of which are important factors in regulating BC metastasis. We found that NEAT1 can effectively promote MDA-MB-231 cells’ metastasis via modulating the TGFβ/SMAD2 signaling pathway while maintaining its EMT phenotype and BSCSs characteristics, whereas ICA effectively inhibited the NEAT1/TGFβ/SMAD2 pathway.

MATERIALS AND METHODS

Cell Culture

Human MDA-MB-231 BC cells were obtained from the Chinese Academy of Medical Sciences’ Institute of Basic Medicine and cultured in Dulbecco’s modified Eagle’s medium (DMEM)/F12 (Gibco, U.S.A., C11330500BT). To study the potential role of ICA (Solarbio, China, II0030) in BC, it was dissolved in dimethyl sulfoxide (DMSO) and prepared as 10 mM stock solution, which was diluted to the required concentration of drug before the experiments. EMT was induced by treating the cells with TGFβ1 (PeproTech, U.S.A., #100-21, 5 ng/mL) and SD208 (Beyotime Biotechnology, China, # SF7908, 1 µM), an inhibitor of the TGFβ/SMAD2 pathway, was used to pre-treat MDA-MB-231 cells in some experiments.

3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium Bromide (MTT) Assay

The cells were plated at a density of 5 × 10⁴ cells/well/100 µL, and various ICA concentrations were added to experimental wells for either 24 or 48 h. Each well was then incubated with a solution of MTT (Solarbio, China, M8180, 5 mg/mL) for 4 h before DMSO was added. After the crystallization product was completely dissolved, the optical density (OD) of each well was measured at 570 nm.

Quantitative PCR (qPCR)

According to the instructions of the M5 universal RNA Mini Kit Rapid tissue cell RNA Extraction Kit (Mei5bio, China, MF036-01), the total RNA was extracted. The total RNA was reverse-transcribed into cDNA and a PCR reaction was carried out using qPCR RT kit (Mei5bio, China, MF166-T). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as a reference gene (Sangon Biotech, China, B661104). The reaction was performed with 2 × M5 Hiper SYBR Premix EsTaq (Mei5bio, China, MF787-01) as the premix system and repeated three times. 2^−△△Ct method was used for the data analysis. The primer sequence for the lncRNA NEAT1 (Sangon Biotech, China): R: 5′GCTGAGGCAGAAGAATCACTT 3′, and F: 5′CGCTTGTAATCCCAGCACTTT 3′.

Colony Formation Assay

After adjusting the cell density to 1000 cells per well of 6-well plates, ICA was added to the cells for 24 h, and then continued in culture for approximately 14 d. When the incubation process was complete, the cells were preserved in 4% paraformaldehyde (Bosterbio, China, AR1068) and stained with 0.1% crystal violet (Solarbio, China, G1063). The cell colonies were photographed and enumerated with a digital camera.

Mammospheres Formation Assay

The cells were digested and cultured in 10 ng/mL basic fibroblast growth factor (bFGF) (Sangon Biotech, China, C610029), 20 ng/mL epidermal growth factor (EGF) (Sinobiological, China, 10605-HNAE), 1 × B27 (Gibco, U.S.A., 17504044) and 1% Penicillin/Streptomycin DMEM/F12 medium were evenly spread into ultra-low adhesion 6-well plates (10⁴/well) for 7-10 d, and the pellet formation was observed.

Western Blot Analysis

After collecting the cells, we added phenylmethylsulfonyl fluoride (PMSF) (Bosterbio, China, AR1178), protease and Phosphatase Inhibitor Cocktail (Proteintech, China, PR20015) to radio immunoprecipitation assay (RIPA) lysis buffer (Bosterbio, China, AR0102). Bicinchoninic acid (BCA) assay (Bosterbio, China, AR0146) was used to quantify the protein content. The protein was resolved by electrophoresis on a denatured sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) gel (Bosterbio, China, AR0138). The protein was electrotransferred to polyvinylidene difluoride (PVDF) membrane (Millipore, U.S.A.) and sealed with TBST containing 5% skim milk powder. The membranes were then incubated with different primary antibodies. EpCAM (1 : 1000, Proteintech, China, 21050-1-AP), SOX4 (1 : 1000, Bioss, China, bs-11208R), ZO-1 (1 : 5000, Proteintech, China, 21773-1-AP), E-cadherin (1 : 10000, Proteintech, China, 20874-1-AP), Vimentin (1 : 5000, Proteintech, China, 10366-1-AP), Smad2 (1 : 3000, Proteintech, China, 12570-1-AP), P-Smad2 (1 : 1000, CST, U.S.A., 18338), Smad2/3 (1 : 1000, CST, U.S.A., 3102), TGFβ1 (1 : 2500, Proteintech, China, 21898-1-AP), β-actin (1 : 5000, Bioworld Technology, U.S.A., AP0060) and GAPDH (1 : 5000, Abways, China, AB0037) for overnight at 4 °C. A working solution of Goat Anti-Rabbit immunoglobulin G (IgG) (1 : 5000, Proteintech, China, SA00001-2) was added after washing the membrane next day and the mixture was incubated for 2 h. The membranes were then developed with Meilunbio^® FGSuper Sensitive ECL Luminescence Reagent (ECL, Meilunbio, China, MA0186). Image J software was used for the densitometric analysis.

Immunofluorescence Assay

After the drug treatment, the cells were fixed with 4% paraformaldehyde for 20 min, followed by treatment with 0.3% Triton X-100 (Solarbio, China, T8200), and 10% goat serum (Bosterbio, China, AR0009). The cells were incubated with various primary antibodies such as E-cadherin (1 : 200, Proteintech, China, 20774-1-AP), ZO-1 (1 : 2000, Proteintech, China, 21773-1-AP) and Vimentin (1 : 200, Proteintech, China, 10366-1-AP) for overnight at 4 °C. After overnight incubation on second day, a working solution of fluorescent Goat Anti-Rabbit IgG (green label/red label; 1 : 1000; Abbkine, U.S.A., A23620/A23220) it was added and incubated for 1 h. 4′-6-Diamidino-2-phenylindole (DAPI)-Staining-solution (DAPI, Bosterbio, China, AR1177) was added to restrain the core (blue mark). Thereafter, appropriate fluorescence channels and fluorescence parameters were selected on the Laser confocal microscopy (Zeiss, Germany, LSM 900) to capture the photos. Image J software was used to merge the images obtained in the two channels.

Cell Transfection

si-NC and si-NEAT1 (Genepharma, China) were transfected according to the instructions provided in Lipofectamine2000 kit (ThermoFisher, U.S.A., 11668027) when the cell density reached around 70–80% confluency. After transfection, the cells were routinely cultured in an incubator at 37 °C and 5% CO₂. After 4–6 h, the fresh medium was added and the cells were further cultured for 48 h. Thereafter, follow-up experiments were conducted.

Wound Healing

The cells were first scraped with the tip of a 200 µL pipette gun perpendicular. Phosphate buffered saline (PBS) was then used to gently wash the scraped cells and the medium containing 2% fetal bovine serum (FBS) was replaced. The scratch widths of 0 and 24 h were then photographed using an inverted microscope (Nikon, Japan, TS100). The scratch breadth and cellular mobility were measured with the aid of Image J software. The rate of wound healing was measured by distance between two sides of the induced injury.

Statistical Analysis

The data were analyzed using SPSS 22.0. All experiments were performed in triplicate. The measurement data with a normal distribution were displayed as X̅ ± S. The statistical significance of the differences between two groups was analyzed using Student t-test. One-way ANOVA and Tukey were used to analyze differences between more than two groups. For this study, p < 0.05 was considered to be statistically significant.

RESULTS

ICA Inhibited EMT Process and Stemness of MDA-MB-231 Cells

Treatment of MDA-MB-231 cells with ICA for 24 and 48 h, respectively, was used to determine the effect of ICA on BC cell viability in vitro using the MTT assay (Fig. 1B). The viability of MDA-MB-231 cells was drastically reduced by ICA (24 h: p < 0.0001, < 0.0001, 0.3053, 0.0002, < 0.0001, < 0.0001 and < 0.0001, respectively, vs. 0 group; 48 h: p = 0.0072, 0.5252, 0.0014, < 0.0001, < 0.0001, < 0.0001 and < 0.0001, respectively, vs. 0 group). The results of colony forming assay (Fig. 1A) demonstrated a significant decrease in the number of the cell colonies in the ICA treatment group, thus suggesting that ICA was able to significantly suppress the proliferative potential of MDA-MB-231 cells (p < 0.0001). Interestingly, both untreated and 5 µM ICA-treated MDA-MB-231 cells displayed mesenchymal features under a 20 × inverted microscope (Fig. 1C), whereas the 10 and 20 µM ICA treated groups showed more obvious epithelial morphology (spherical or cobblestone appearance). Based on these findings, treatment groups with 10 and 20 µM ICA suppressed the mesenchymal properties of MDA-MB-231 cells. Moreover, the results from the wound healing assay (Figs. 1C, F) indicated that MDA-MB-231 cells migrated less distance after being treated with ICA (p = 0.0777, 0.0275 and 0.0011, respectively, vs. 0 group). Western blotting results (Fig. 1E) indicated that ICA at 20 µM significantly increased the expression of E-cadherin and ZO-1 but decreased the expression of Vimentin (ZO-1: p < 0.0001; E-cadherin: p = 0.0017, 0.0001 and < 0.0001; Vimentin: p = 0.4002, 0.0756 and < 0.0001. Respectively, vs. 0 group). Immunofluorescence analysis confirmed (Fig. 1D) that after 20 µM ICA treatment, levels of ZO-1 and E-cadherin expression increased in the membrane, whereas both the cytoplasmic and nuclear expression of Vimentin was diminished. Overall, the findings suggested that ICA could significantly inhibit EMT process in BC cells.

Fig. 1. Proliferation, EMT, and Stem Cell-Like Character of MDA-MB-231 Cells Were All Suppressed by ICA

(A) Effects of ICA concentration on colony forming ability and mammospheres formation of BC. (B) Statistical analysis of results of MTT assay following treatment with different ICA concentrations. (C, F) Cell morphology and wound width. (D) Analysis of expression of EMT interacting proteins (ZO-1, E-cadherin, Vimentin, Vimentin) by Immunofluorescence. (E) Western blot analysis to determine the protein expression of ZO-1, E-cadherin, and Vimentin. (G) Transcriptional regulation of the stem cell-associated proteins (SOX4 and EpCAM) by Western blotting. (One-way ANOVA with the Tukey test. * p < 0.05, ** p < 0.01 vs. 0 group).

CSCs play a crucial role in the metastatic process.²⁴⁾ The aim of this study was also to evaluate if ICA was associated with stem cell features in MDA-MB-231 cells. Hence, we used sphere formation experiments in suspension and Western blot assay. We found that both 10 and 20 µM ICA treatment groups were able to reduce the ability of mammospheres formation (Fig. 1A), and significantly reduced the protein expression of SOX4 and EpCAM which are indicators of tumor progenitor cells (Fig. 1G) (SOX4: p = 0.1331, < 0.0001 and < 0.0001; EpCAM: p < 0.0001. Respectively, vs. 0 group). Based on these findings, it was concluded that ICA may play a key role in suppressing the stem cell properties of MDA-MB-231 cells.

ICA Suppressed the EMT and Stem Cell Properties of BC via Inhibition of the TGFβ/SMAD2 Signaling Pathway

Treatment of MDA-MB-231 cells with TGFβ1 (5 ng/mL) or SD208 (1 µM) for 24 h was performed to determine the role of ICA in modulating EMT and the maintenance of MDA-MB-231 stem cell characteristics. We found that TGFβ1 treatment significantly augmented MDA-MB-231 cell growth (Fig. 2A) (p = 0.0024, vs. control), and increased their mobility (Fig. 2C) (p = 0.0029, vs. control) as well as the rate of pellet formation (Fig. 2A). It also enhanced the expression of EpCAM, SOX4 and Vimentin proteins (EpCAM: p < 0.0001; SOX4: p = 0.0102; Vimentin: p = 0.0001. vs. control). However, expression levels of E-cadherin and ZO-1 were reduced (Figs. 2B, D, F) (E-cadherin: p < 0.0001; ZO-1: p < 0.0001. vs. control). This finding suggested that TGFβ1 induced an increase in EMT and stemness in BC. However, compared to the TGFβ1 treatment group, ICA treatment dramatically reduced cell proliferation (Fig. 2A) (p = 0.0004, < 0.0001 and < 0.0001, respectively, vs. TGFβ1), migration (Fig. 2C) (p = 0.0262, < 0.0001 and < 0.0001, respectively, vs. TGFβ1), and pellet formation rate in MDA-MB-231 cells, concomitant with decreased EpCAM, SOX4, and Vimentin expression (EpCAM: p < 0.0001; SOX4: p < 0.0001; Vimentin: p < 0.0001. Respectively, vs. TGFβ1). In addition, increase in the expression of E-cadherin and ZO-1 proteins were observed (Figs. 2B, D, F) (E-cadherin: p < 0.0001; ZO-1: p < 0.0001. Respectively, vs. TGFβ1). Moreover, clear mesenchymal characteristics were observed in TGFβ1-induced MDA-MB-231 cells, but spheroids were formed in MDA-MB-231 cells treated with the TGF-β signaling pathway inhibitor SD208 and ICA. (Fig. 2C). ICA was thus shown to inhibit EMT and stem cell properties of BC cells through modulation of TGFβ1.

Fig. 2. ICA Inhibited the EMT and Cell-Like Characteristics of BC Cells via Downregulation of the TGFβ/SMAD2 Signaling Pathway

(A) The colonies formation and mammospheres formation of control group, TGFβ1 group, TGFβ1 + ICA group, TGFβ1 + SD208 group and TGFβ1 + SD208 + ICA group after TGFβ1 cytokine induced EMT. (Student t-test. ** p < 0.01 vs. control; One-way ANOVA with the Tukey test. ^##p < 0.01 vs. TGFβ1) (B) The expression of EMT related proteins (ZO-1, E-cadherin, Vimentin). Immunofluorescence after induction with TGFβ1 was performed. (C) The effect on the cell morphology and migratory capacity upon TGFβ1 induction. (Student t-test. ** p < 0.01, vs. control; One-way ANOVA with the Tukey test. ^##p < 0.01 vs. TGFβ1) (D) The expression of EMT related proteins (ZO-1, E-cadherin, Vimentin) by Western blot assay following TGFβ1 induction (Student t-test. ** p < 0.01 vs. control; One-way ANOVA with the Tukey test. ^##p < 0.01 vs. TGFβ1) (E) The expression of TGFβ/SMAD2 signaling pathway proteins (Smad, P-Smad2, Smad2/3, TGFβ1) after treatment with the different concentrations of ICA by Western blot assay. (One-way ANOVA with the Tukey test. * p < 0.05, ** p < 0.01 vs. 0 group) (F) The expression of stem proteins (SOX4, EpCAM) by Western blot assay after TGFβ1 induction. (Student t-test. ** p < 0.01 vs. control; One-way ANOVA with the Tukey test. ^##p < 0.01 vs. TGFβ1) (G) The expression of TGFβ/SMAD2 signaling pathway proteins (Smad, P-Smad2, Smad2/3, TGFβ1) by Western blot assay after TGFβ1 induction. (Student t-test. ** p < 0.01 vs. control; One-way ANOVA with the Tukey test. ^##p < 0.01 vs. TGFβ1).

By using Western blotting, we analyzed the expression of Smad2, P-Smad2, Smad2/3 and TGFβ1 in MDA-MB-231 cells treated with ICA at the varying doses. Figure 2E shows that as ICA concentration was increased, protein expression of Smad2, P-Smad2, Smad2/3 and TGFβ1 was decreased significantly in comparison to the control group (Smad2: p < 0.0001; P-Smad2: p = 0.0005, < 0.0001 and < 0.0001; Smad2/3: p = 0.0173, < 0.0001 and < 0.0001; TGFβ1: p = 0.1921, < 0.0001 and < 0.0001. Respectively, vs. 0 group). Interestingly, following TGFβ1 induction, expression of Smad2, P-Smad2, Smad2/3 and TGFβ1 proteins were all upregulated (Smad2: p < 0.0001; P-Smad2: p < 0.0001; Smad2/3: p = 0.0005; TGFβ1: p = 0.0002. Respectively, vs. control), but after ICA and (or) SD208 treatment, levels of all of these proteins were considerably downregulated. The suppressive effect was amplified substantially (Fig. 2G) (Smad2: p < 0.0001; P-Smad2: p < 0.0001; Smad2/3: p = 0.0004, 0.0137 and < 0.0001; TGFβ1: p < 0.0001. Respectively, vs. TGFβ1). Therefore, ICA might inhibit EMT process in BC cells by down-regulating TGFβ/SMAD2 signaling pathway.

Silencing NEAT1 Increased the Inhibition of ICA on the Stemness and EMT Expression of BC

The lncRNA NEAT1 is highly expressed in BC.²¹⁾ Following NEAT1 knockdown in MDA-MB-231 cells, we analyzed mRNA levels by using qPCR. Three different siRNAs targeting NEAT1 (si-NEAT1-1, si-NEAT1-2, and si-NEAT1-3) were transfected into MDA-MB-231 cells, and it was found (Fig. 3A) that all three siRNAs dramatically decreased NEAT1 expression compared to the si-NC group (si-NEAT1-1: p < 0.0001; si-NEAT1-2: p < 0.0001; si-NEAT1-3: p < 0.0001. Respectively, vs. control). As a result, si-NEAT1-1 was used to inhibit NEAT1 activity in the subsequent experiments. Figure 3B shows that NEAT1 was considerably down-regulated in response to ICA therapy (5: p = 0.0283; 10: p = 0.0045; 20: p = 0.0004. Respectively, vs. 0 group).

Fig. 3. MDA-MB-231 Cells Displayed Elevated Levels of NEAT1 Expression, and Silencing NEAT1 Enhanced ICA Reduced the Expression of Stem Cell-Like Characteristics

(A) The effects of silencing NEAT1 in MDA-MB-231 on mRNA expression were measured using qPCR. (One-way ANOVA with the Tukey test. ** p < 0.01 vs. control) (B) The qPCR analysis of NEAT1 expression in MDA-MB-231 cells exposed to the varying doses of ICA. (One-way ANOVA with the Tukey test. * p < 0.05, ** p < 0.01 vs. 0 group) (C) The expression of NEAT1 in ICA group by qPCR after transfection of si-NEAT1 in MDA-MB-231 cells. (Student t-test. ** p < 0.01 vs. control; Student t-test. ^##p < 0.01 vs. si-NC + ICA) (D) The effects of colonies formation and mammospheres formation in ICA group after transfection with si-NEAT1 into MDA-MB-231. (One-way ANOVA with the Tukey test. ** p < 0.01 vs. control; Student t-test. ^##p < 0.01 vs. si-NC + ICA) (E) The protein expression of stem interacted protein (SOX4, EpCAM) by Western blot assay after transfection of si-NEAT1 in MDA-MB-231 cells. (One-way ANOVA with the Tukey test. ** p < 0.01 vs. control; Student t-test. ^##p < 0.01 vs. si-NC + ICA).

To understand more about the role of NEAT1 in mediating ICA to suppress EMT and stemness expression in MDA-MB-231 cells, we performed additional experiments. The data indicated that knocking down NEAT1 expression increased ICA’s ability to suppress cell colony (ICA: p = 0.0005, vs. control; si-NEAT1 + ICA: p < 0.0001, vs. control; si-NEAT1 + ICA: p = 0.0004, vs. si-NC + ICA) and globular formation in MDA-MB-231 cells (Fig. 3D). Compared to the si-NC treatment group, NEAT1 silencing dramatically decreased EpCAM and SOX4 protein levels (Fig. 3E) (EpCAM: p < 0.0001, respectively, vs. control. p < 0.0001, vs. si-NC + ICA; SOX4: p = 0.0029, < 0.0001, respectively, vs. control. p = 0.0079, vs. si-NC + ICA). Finally, qPCR data demonstrated that NEAT1 silencing resulted in a more significant decrease in NEAT1 gene expression in ICA treatment group (Fig. 3C) (p = 0.0069, vs. control; p = 0.0028, vs. si-NC + ICA). When NEAT1 gene was knocked down, ICA-repressed MDA-MB-231 cells migration much more slowly (Fig. 4E) (p = 0.0030, vs. control; p = 0.0284, vs. si-NC + ICA), expressed higher levels of ZO-1 and E-cadherin proteins, and expressed significantly less Vimentin level (Figs. 4B–D) (ZO-1: p < 0.0001, respectively, vs. control. p = 0.0002, vs. si-NC + ICA; E-cadherin: p < 0.0001, respectively, vs. control. p = 0.0003, vs. si-NC + ICA; Vimentin: p < 0.0001, respectively, vs. control. p = 0.0161, vs. si-NC + ICA). Morphological examination of the cells revealed a diminished mesenchymal character (Fig. 4A). It was hypothesized that knocking down NEAT1 expression in MDA-MB-231 cells can significantly improve ICA’s ability to suppress both EMT and stem cell characteristics.

Fig. 4. Silencing NEAT1 Enhanced ICA Induced Inhibition of EMT Process in BC

(A) Morphological changes of cells in ICA group after transfection with si-NEAT1 under inverted microscope. (B, D) The protein expression of EMT related protein (ZO-1, E-cadherin, Vimentin) by Western blot assay after transfection of si-NEAT1 into MDA-MB-231 cells. (One-way ANOVA with the Tukey test. ** p < 0.01 vs. control; Student t-test. ^#p < 0.05, ^##p < 0.01 vs. si-NC + ICA) (C) The protein expression of EMT related protein (ZO-1, E-cadherin, and Vimentin) by immunofluorescence after transfection of si-NEAT1 into MDA-MB-231 cells. (E) The effect of cell migration ability after transfection of si-NEAT1 into MDA-MB-231 cells. (Student t-test. ** p < 0.01 vs. control; Student t-test. ^#p < 0.05, vs. si-NC + ICA).

Silencing NEAT1 Enhanced ICA Inhibition of TGFβ/SMAD2 Signaling Pathway Induced Stemness and EMT in BC

To understand the detailed mechanism of action of ICA, we next investigated whether NEAT1 was involved in the control of the TGFβ/SMAD2 signaling pathway following ICA treatment, and mediated the suppression of the stemness and EMT expression of MDA-MB-231 cells. We observed that silencing NEAT1 reduced protein levels of Smad2, P-Smad2, Smad2/3 as well as TGFβ1 (Fig. 5A) (Smad2: p = 0.0262 and 0.0029, respectively, vs. control. p = 0.0059, vs. si-NC + ICA; P-Smad2: p < 0.0001, respectively, vs. control. p = 0.0123, vs. si-NC + ICA; Smad2/3: p = 0.0005 and < 0.0001, respectively, vs. control. p = 0.0004, vs. si-NC + ICA; TGFβ1: p = 0.0010 and < 0.0001, respectively, vs. control. p = 0.0034, vs. si-NC + ICA), and that TGFβ1-induced cells transfected with si-NEAT1 reduced protein expression of the TGFβ/SMAD2 signaling pathway (Smad2, P-Smad2, Smad2/3 and TGFβ1) (Fig. 5B) (Smad2: p < 0.0001 vs. control. p < 0.0001, vs. TGFβ1. p < 0.0001, respectively, vs. TGFβ1 + si-NC; P-Smad2: p < 0.0001 vs. control. p = 0.0017, vs. TGFβ1. p < 0.0001, respectively, vs. TGFβ1 + si-NC; Smad2/3: p = 0.0004 vs. control. p = 0.0004, vs. TGFβ1. p < 0.0001, respectively, vs. TGFβ1 + si-NC; TGFβ1: p = 0.0003 vs. control. p < 0.0001, vs. TGFβ1. p = 0.0070, < 0.0001, respectively, vs. TGFβ1 + si-NC). These findings suggested that NEAT1 could effectively regulate the TGFβ/SMAD2 signaling pathway. In addition, based on the observation that silencing NEAT1 can inhibit the activation of TGFβ/SMAD2 signaling pathway, we continued to investigate whether silencing NEAT1 can enhance ICA-induced inhibition of TGFβ/SMAD2 signaling pathway, thereby inhibiting MDA-MB-231 cells. In colony and pellet formation assays, it was found (Fig. 6A) that TGFβ1 treated cells upon ICA exposure had a decreased capacity for both colony and pellet formation when NEAT1 was silenced (p = 0.0002 vs. control. p = 0.0008, vs. TGFβ1. p < 0.0001, respectively, vs. TGFβ1 + si-NC). Evidence from Western blotting and immunofluorescence also demonstrated elevated levels of ZO-1 and E-cadherin proteins (Figs. 5C, 6C) (ZO-1: p < 0.0001 vs. control. p = 0.0003, vs. TGFβ1. p < 0.0001, respectively, vs. TGFβ1 + si-NC; E-cadherin: p < 0.0001 vs. control. p = 0.0018, vs. TGFβ1. p < 0.0001, respectively, vs. TGFβ1 + si-NC). The cell shape was drastically altered, and fusiform interstitial features were no longer present, leading to a dramatic reduction in the protein levels of Vimentin, SOX4, and EpCAM (Fig. 5D) (Vimentin: p = 0.0008 vs. control. p = 0.0018, vs. TGFβ1. p = 0.0011 and < 0.0001, respectively, vs. TGFβ1 + si-NC; SOX4: p = 0.0001 vs. control. p = 0.0017, vs. TGFβ1. p < 0.0001, respectively, vs. TGFβ1 + si-NC; EpCAM: p = 0.0005 vs. control. p = 0.0408, vs. TGFβ1. p = 0.0411 and 0.0002, respectively, vs. TGFβ1 + si-NC). Figures 6B and 6E reveal that in the wound healing assay, silencing of NEAT1 significantly reduced migration ability of MDA-MB-231 cells in response to treatment with TGFβ1 and ICA (p = 0.0018 vs. control. p = 0.0024, vs. TGFβ1. p = 0.0012 and < 0.0001, respectively, vs. TGFβ1 + si-NC). Thus, it is possible that silencing of NEAT1 increases the inhibitory effect of ICA on stemness expression and EMT in MDA-MB-231 cells by blocking the TGFβ/SMAD2 signaling pathway.

Fig. 5. Silencing NEAT1 Enhanced ICA Down-Regulating TGFβ/SMAD2 Signaling Pathway and Inhibited the Expression of Stemness and EMT-Related Proteins in MDA-MB-231 Cells

(A) The expression of TGFβ/SMAD2 signaling pathway proteins (Smad2, P-Smad2, Smad2/3, TGFβ1) by Western blot assay after transfection with si-NEAT1.(One-way ANOVA with the Tukey test. ** p < 0.01 vs. control; Student t-test. ^#p < 0.05, ^##p < 0.01 vs. si-NC + ICA) (B) The expression of TGFβ/SMAD2 signaling pathway interacted proteins (Smad2, P-Smad2, Smad2/3, TGFβ1) by Western blot assay after TGFβ1-induced cell transfection with si-NEAT1.(Student t-test. ** p < 0.01 vs. control; Student t-test. ^##p < 0.01 vs. TGFβ1; One-way ANOVA with the Tukey test. ^&&p < 0.01, vs. TGFβ1 + si-NC) (C) The protein expression of EMT related proteins (ZO-1, E-cadherin, Vimentin) by Western blot assay after TGFβ1-induction and cell transfection with si-NEAT1 (Student t-test. ** p < 0.01 vs. control; Student t-test. ^##p < 0.01 vs. TGFβ1; One-way ANOVA with the Tukey test. ^&&p < 0.01 vs. TGFβ1 + si-NC). (D) The expression of stem cell related proteins (SOX4, EpCAM) by Western blot assay after TGFβ1-induced cell transfection with si-NEAT1 (Student t-test. ** p < 0.01 vs. control; Student t-test. ^#p < 0.05, ^##p < 0.01 vs. TGFβ1; One-way ANOVA with the Tukey test. ^&p < 0.05, ^&&p < 0.01 vs. TGFβ1 + si-NC).

Fig. 6. Silencing NEAT1 Enhanced ICA Down-Regulation of TGFβ/SMAD2 Signaling Pathway and Inhibited Stem Cell-Like Character and EMT of BC

(A) The effects of colony and mammospheres formation after TGF-β1-induced cell transfection with si-NEAT1(Student t-test. ** p < 0.01 vs. control; Student t-test. ^##p < 0.01 vs. TGFβ1; One-way ANOVA with the Tukey test. ^&&p < 0.01 vs. TGFβ1 + si-NC). (B, E) The effect on the cell migration ability after TGF-β1-induction and cell transfection with si-NEAT1(Student t-test. ** p < 0.01 vs. control; Student t-test. ^##p < 0.01 vs. TGFβ1; One-way ANOVA with the Tukey test. ^&&p < 0.01 vs. TGFβ1 + si-NC). (C) The expression of EMT related proteins (ZO-1, E-cadherin, Vimentin) by Immunofluorescence after TGFβ1-induction and cell transfection with si-NEAT1. (D) The morphological changes of ICA group after TGFβ1-induction and cell transfection with si-NEAT1.

DISCUSSION

BC is the most frequent kind of cancer diagnosed in women, even though contemporary drugs have increased survival rates of BC patients,¹⁾ relapse and drug resistance remain high, and advanced metastasis is not curable.²⁾ In recent years, traditional Chinese medicine and active ingredients have become the hot spot of anti-BC drugs due to their relatively low side effects and better safety profile. ICA is a natural flavonoid compound,²⁵⁾ which can reduce the proportion of EpCAM positive cells in hepatocellular cancer cells and inhibit their self-renewal.²⁶⁾ Elevated expression of E-cadherin is an important strategy for preventing EMT.⁸⁾ The present investigation found that concentrations of ICA between 5 and 20 µM significantly suppressed BC proliferation and also inhibited the BC cell clonogenicity. During EMT, epithelial cells undergo cytoskeletal remodeling and thus gain the increased ability to invade and metastases.⁹⁾ BCSCs can enhance the ability of the self-renewal and induce the differentiation potential of tumor cells by activating the normal stem cells or progenitors,²⁷⁾ and exist in epidermoid (ALDH⁺) as well as in mesenchymal (CD24^−/low or CD44⁺) states.

EMT and CSCs are considered to be important biological processes that can promote tumor cells invasion and metastasis. During EMT, the tumor cells can acquire stem cell properties with the ability to self-renew. Among the multiple subpopulations of CSCs identified so far, EMT-like CSCCs are typically invasive.²⁴⁾ Interestingly, Wright et al. found that CD44⁺/CD24⁻ population can be mainly induced by TGFβ or other transcription factor. This subpopulation exhibits a gene expression profile identical to BCSCs and is capable of inducing tumors in mice.²⁸⁾ Therefore, targeting EMT and BCSCs may act as the key targets for overcoming BC metastasis, recurrence, and drug resistance in the clinical practice. EpCAM is a surface marker of BCSCs which is strongly expressed in pathological conditions,^29,30) and is high expression can promote the occurrence of EMT in BC.³¹⁾ It has been reported that knocking down the SOX4 gene causes an upregulation of E-cadherin expression, downregulation of Vimentin levels, a reduction in the development of BCSCs-like mammary spheres, and a suppression of the TGFβ/SMAD signaling pathway.³²⁾ As a marker of EMT, ZO-1 down-regulation can promote the invasive transformation of BC in situ.³³⁾ We found that MDA-MB-231 cells movement was considerably reduced upon ICA treatment, whereas expression of ZO-1 and E-cadherin proteins was up-regulated, but that of Vimentin was repressed. The ability of MDA-MB-231 cells to undergo EMT was effectively blocked. At 20 µM, ICA suppressed mammary gland development and expression of EpCAM as well as SOX4, thus indicating that ICA might also suppress stemness expression in MDA-MB-231 cells.

LncRNAs have been reported to be involved in regulating the process of tumorigenesis.^34–37) NEAT1 has been confirmed to be up-regulated in BC, and knockout of NEAT1 can effectively reduce CD44⁺/CD24⁻, ALDH⁺, and SOX2⁺ stem cell populations,³⁸⁾ inhibit EMT,³⁹⁾ and increase the sensitivity of BC cells to chemotherapy. Recently, lncRNAs have received a lot of attention as potential therapeutic targets, particularly in the context of phytochemicals. For example, gambogenic acid could improve EMT by up-regulating the expression of the lncRNA MEG3 gene, thereby inhibiting melanoma metastasis in vitro and in vivo.⁴⁰⁾ Resveratrol can reduce NEAT1 expression and block growth, invasion, and migration of myeloma cells.⁴¹⁾ We hypothesized that since ICA can suppress EMT and BCSCs properties in MDA-MB-231 cells, NEAT1 could be the molecular target. In this work affected by it, as NEAT1 expression was found to be elevated in MDA-MB-231 cells. Our results showed that ICA not only suppressed NEAT1 expression in MDA-MB-231 cells but also inhibited EMT and BSCSs. Silencing NEAT1 was found to significantly decrease colony forming capacity of MDA-MB-231 cells and attenuate the rate of mammary balloon formation. It also led to decrease of Vimentin, SOX4 and EpCAM protein expression, but favorably regulated the protein expression of E-cadherin and ZO-1. The expression of EMT and BCSCs related markers was also suppressed in MDA-MB-231 cells by ICA which mediated via NEAT1.

The TGFβ/SMAD signaling pathway is closely associated with the emergence and progression of BC.⁴²⁾ In the early phases of carcinogenesis, TGFβ1 causes cell cycle arrest and death in normal and precancerous cells. Later, however, it was found that TGFβ1 boosted the expression of CSCs-specific proteins¹⁴⁾ and the self-renewal ability of BCSCs,⁴³⁾ thus suggesting that can play a key role in inducing and maintaining the EMT process of BC. Heterogeneous complexes consisting of SMAD2 and SMAD3 are formed by TGFβRI recruitment and phosphorylation of these two proteins.⁴⁴⁾ Thus, blocking TGFβ1 receptor signal transduction with the specific kinase inhibitor SD208 can markedly improve anti-tumor efficacy.⁴⁵⁾ We found that ICA inhibited TGFβ1-induced protein levels of Vimentin, SOX4, and EpCAM while simultaneously increasing E-cadherin and ZO-1 expression and dephosphorylating SMAD2, thereby inactivating the TGFβ/SMAD2 signaling system. It was thus hypothesized that ICA’s capacity to target EMT and BCSCs characteristics is exerted by its ability to suppress the activation of TGFβ/SMAD2 signaling pathway in MDA-MB-231 cells.

Involvement of NEAT1 in the TGFβ/SMAD signaling pathway has been linked to increased tumor cell proliferation, metastasis, and treatment resistance.⁴⁶⁾ In triple negative breast cancer (TNBC), Smad2/Smad3 is transduced by the TGFβ1/Smad2/Smad3 signaling pathway and can directly bind to the promoter of lncRNA.⁴⁷⁾ lncRNA tPA has been shown to significantly reduce E-cadherin expression and up-regulate Vimentin, fibronectin, and TGFβ1 expression through stimulating activation of the TGF-β signaling pathway.¹²⁾ When SMASR is overexpressed, it can potentially interact with Smad2/3 to suppress EMT in lung cancer cells by preventing the activation of the TGFβ/SMAD signaling pathway and reducing TGFβR1 production.⁴⁸⁾ We found that silencing NEAT1 inhibited the colony forming ability of MDA-MB-231 cells induced by TGFβ1 and the formation of mammary spheres, reduced its mobility, down-regulated Vimentin, SOX4 as well as EpCAM levels and promoted the protein expression of E-cadherin and ZO-1. The TGFβ/SMAD signaling pathway could be inactivated by downregulating Smad2, Smad2/3 and TGFβ1 and dephosphorylating Smad2. Thus, our findings indicate that NEAT1 may negatively regulate the expression of EMT and BCSCs in ICA-treated MDA-MB-231 cells through targeting TGFβ/SMAD2 signaling pathway.

This study has limitations due to the enormous number of cell lines and signaling pathways implicated in BC, the extensive regulatory networks involved in ICA and NEAT1, and the lack of in vivo studies. This research group will further investigate the mechanism of ICA in various BC cell lines and undertake in vivo investigations to confirm the findings, resulting in novel clinical concepts for developing BC treatment targets.

CONCLUSION

Overall, we have found ICA could have great potential for the targeted therapy of EMT and BCSCs. From a mechanistic standpoint, ICA inhibited BC metastasis via modulating the NEAT1/TGFβ/SMAD2 pathway, which in turn suppressed MDA-MB-231 cells proliferation, decreased expression of BCSCs markers, and attenuated the process of EMT. The findings of this study provide a novel theoretical framework for detailed investigations into the mechanism through which ICA can be used to treat BC.

Acknowledgments

We will like to thank Laboratory of Experimental Formulae and the Cell Laboratory of the Experimental Management Center of Shanxi University of Chinese Medicine for their support in all the experiments.

Funding

This work was supported by Health Commission of Shanxi Province (#2020XM26), Shanxi Science and Technology Department (#20210302123226), Shanxi University of Chinese Medicine (#2022TD2005), and Shanxi Provincial Key Laboratory Open Project Research Fund (#CPSY202204).

Author Contributions

Bo Song performed the research, analyzed the data and wrote the manuscript. Fuxia Wei, Jiehao Peng, Xiuhong Wei and Mingran Liu performed experiment and data analysis and verification. Yanmiao Ma designed the study and revised the manuscript. Tao Peng and Zhongbiao Nie provided the support for the experimental design.

Conflict of Interest

The authors declare no conflict of interest.

Data Availability

The original contributions are presented in the study and further inquiries about the original data can be directed to the corresponding author.

REFERENCES

• 1) Siegel RL, Miller KD, Fuchs HE, Jemal A. Cancer statistics, 2022. CA Cancer J. Clin., 72, 7–33 (2022).
• 2) Harbeck N, Penault-Llorca F, Cortes J, Gnant M, Houssami N, Poortmans P, Ruddy K, Tsang J, Cardoso F. Breast cancer. Nat. Rev. Dis. Primers., 5, 66 (2019).
• 3) Li C, Li Q, Mei Q, Lu T. Pharmacological effects and pharmacokinetic properties of icariin, the major bioactive component in Herba Epimedii. Life Sci., 126, 57–68 (2015).
• 4) Zheng X, Li D, Li J, Wang B, Zhang L, Yuan X, Li C, Cui L, Zhang Q, Yang L, Wang X. Optimization of the process for purifying icariin from Herba Epimedii by macroporous resin and the regulatory role of icariin in the tumor immune microenvironment. Biomed. Pharmacother., 118, 109275 (2019).
• 5) Li C, Yang S, Ma H, Ruan M, Fang L, Cheng J. Influence of icariin on inflammation, apoptosis, invasion, and tumor immunity in cervical cancer by reducing the TLR4/MyD88/NF-κB and Wnt/β-catenin pathways. Cancer Cell Int., 21, 206 (2021).
• 6) Hong J, Zhang Z, Lv W, Zhang M, Chen C, Yang S, Li S, Zhang L, Han D, Zhang W. Icaritin synergistically enhances the radiosensitivity of 4T1 breast cancer cells. PLOS ONE, 8, e71347 (2013).
• 7) Cheng X, Tan S, Duan F, Yuan Q, Li Q, Deng G. Icariin induces apoptosis by suppressing autophagy in tamoxifen-resistant breast cancer cell line MCF-7/TAM. Breast Cancer, 26, 766–775 (2019).
• 8) Song L, Chen X, Mi L, Liu C, Zhu S, Yang T, Luo X, Zhang Q, Lu H, Liang X. Icariin-induced inhibition of SIRT6/NF-κB triggers redox mediated apoptosis and enhances anti-tumor immunity in triple-negative breast cancer. Cancer Sci., 111, 4242–4256 (2020).
• 9) Mani SA, Guo W, Liao MJ, Eaton EN, Ayyanan A, Zhou AY, Brooks M, Reinhard F, Zhang CC, Shipitsin M, Campbell LL, Polyak K, Brisken C, Yang J, Weinberg RA. The epithelial–mesenchymal transition generates cells with properties of stem cells. Cell, 133, 704–715 (2008).
• 10) Zhou P, Li B, Liu F, Zhang M, Wang Q, Liu Y, Yao Y, Li D. The epithelial to mesenchymal transition (EMT) and cancer stem cells: implication for treatment resistance in pancreatic cancer. Mol. Cancer, 16, 52 (2017).
• 11) Dongre A, Weinberg RA. New insights into the mechanisms of epithelial-mesenchymal transition and implications for cancer. Nat. Rev. Mol. Cell Biol., 20, 69–84 (2019).
• 12) Li Q, Mo W, Ding Y, Ding X. Study of lncRNA TPA in promoting invasion and metastasis of breast cancer mediated by TGF-β signaling pathway. Front. Cell Dev. Biol., 9, 688751 (2021).
• 13) Lamouille S, Xu J, Derynck R. Molecular mechanisms of epithelial-mesenchymal transition. Nat. Rev. Mol. Cell Biol., 15, 178–196 (2014).
• 14) Zeng X, Liu C, Yao J, Wan H, Wan G, Li Y, Chen N. Breast cancer stem cells, heterogeneity, targeting therapies and therapeutic implications. Pharmacol. Res., 163, 105320 (2021).
• 15) Tirino V, Camerlingo R, Bifulco K, Irollo E, Montella R, Paino F, Sessa G, Carriero MV, Normanno N, Rocco G, Pirozzi G. Pirozzi G TGF-β1 exposure induces epithelial to mesenchymal transition both in CSCs and non-CSCs of the A549 cell line, leading to an increase of migration ability in the CD133+ A549 cell fraction. Cell Death Dis., 4, e620 (2013).
• 16) Chen Y, Li Z, Chen X, Zhang S. Long non-coding RNAs: From disease code to drug role. Acta Pharm. Sin. B., 11, 340–354 (2021).
• 17) Wang X, Lai Q, He J, Li Q, Ding J, Lan Z, Gu C, Yan Q, Fang Y, Zhao X, Liu S. LncRNA SNHG6 promotes proliferation, invasion and migration in colorectal cancer cells by activating TGF-β/Smad signaling pathway via targeting UPF1 and inducing EMT via regulation of ZEB1. Int. J. Med. Sci., 16, 51–59 (2019).
• 18) Rodríguez-Mateo C, Torres B, Gutiérrez G, Pintor-Toro JA. Downregulation of Lnc-Spry1 mediates TGF-β-induced epithelial-mesenchymal transition by transcriptional and posttranscriptional regulatory mechanisms. Cell Death Differ., 24, 785–797 (2017).
• 19) Shima H, Kida K, Adachi S, Yamada A, Sugae S, Narui K, Miyagi Y, Nishi M, Ryo A, Murata S, Taniguchi H, Ichikawa Y, Ishikawa T, Endo I. Lnc RNA H19 is associated with poor prognosis in breast cancer patients and promotes cancer stemness. Breast Cancer Res. Treat., 170, 507–516 (2018).
• 20) Chen X, Xie R, Gu P, Huang M, Han J, Dong W, Xie W, Wang B, He W, Zhong G, Chen Z, Huang J, Lin T. Long noncoding RNA LBCS inhibits self-renewal and chemoresistance of bladder cancer stem cells through epigenetic silencing of SOX2. Clin. Cancer Res., 25, 1389–1403 (2019).
• 21) Park MK, Zhang L, Min KW, et al. NEAT1 is essential for metabolic changes that promote breast cancer growth and metastasis. Cell Metab., 33, 2380–2397.e9 (2021).
• 22) Li W, Zhang Z, Liu X, Cheng X, Zhang Y, Han X, Zhang Y, Liu S, Yang J, Xu B, He L, Sun L, Liang J, Shang Y. The FOXN3-NEAT1-SIN3A repressor complex promotes progression of hormonally responsive breast cancer. J. Clin. Invest., 127, 3421–3440 (2017).
• 23) McCabe EM, Rasmussen TP. lncRNA involvement in cancer stem cell function and epithelial–mesenchymal transitions. Semin. Cancer Biol., 75, 38–48 (2021).
• 24) Celià-Terrassa T, Jolly MK. Cancer stem cells and epithelial-to-mesenchymal transition in cancer metastasis. Cold Spring Harb. Perspect. Med., 10, a036905 (2020).
• 25) Chen M, Wu J, Luo Q, Mo S, Lyu Y, Wei Y, Dong J. The anticancer properties of Herba Epimedii and its main bioactive componentsicariin and icariside II. Nutrients, 8, 563 (2016).
• 26) Zhao H, Guo Y, Li S, et al. A novel anti-cancer agent Icaritin suppresses hepatocellular carcinoma initiation and malignant growth through the IL-6/Jak2/Stat3 pathway. Oncotarget., 6, 31927–31943 (2015).
• 27) Bai X, Ni J, Beretov J, Graham P, Li Y. Cancer stem cell in breast cancer therapeutic resistance. Cancer Treat. Rev., 69, 152–163 (2018).
• 28) Wright MH, Robles AI, Herschkowitz JI, Hollingshead MG, Anver MR, Perou CM, Varticovski L. Molecular analysis reveals heterogeneity of mouse mammary tumors conditionally mutant for Brca1. Mol. Cancer, 7, 29 (2008).
• 29) Sankpal NV, Fleming TP, Sharma PK, Wiedner HJ, Gillanders WE. A double-negative feedback loop between EpCAM and ERK contributes to the regulation of epithelial-mesenchymal transition in cancer. Oncogene, 36, 3706–3717 (2017).
• 30) Brugnoli F, Grassilli S, Lanuti P, Marchisio M, Al-Qassab Y, Vezzali F, Capitani S, Bertagnolo V. Up-modulation of PLC-β2 reduces the number and malignancy of triple-negative breast tumor cells with a CD133 +/EpCAM+ phenotype: a promising target for preventing progression of TNBC. BMC Cancer, 17, 617 (2017).
• 31) Shi R, Liu L, Wang F, He Y, Niu Y, Wang C, Zhang X, Zhang X, Zhang H, Chen M, Wang Y. Downregulation of cytokeratin 18 induces cellular partial EMT and stemness through increasing EpCAM expression in breast cancer. Cell. Signal., 76, 109810 (2020).
• 32) Liu Z, Mi M, Zheng X, Zhang C, Zhu F, Liu T, Wu G, Zhang L. miR-30a/SOX4 double negative feedback loop is modulated by disulfiram and regulates EMT and stem cell-like properties in breast cancer. J. Cancer, 12, 5053–5065 (2021).
• 33) Paul A, Danley M, Saha B, Tawfik O, Paul S. PKCζ promotes breast cancer invasion by regulating expression of E-cadherin and zonula occludens-1 (ZO-1) via NFκB-p65. Sci. Rep., 5, 12520 (2015).
• 34) Wang X, Li X, Lin F, Sun H, Lin Y, Wang Z, Wang X. The lnc-CTSLP8 upregulates CTSL1 as a competitive endogenous RNA and promotes ovarian cancer metastasis. J. Exp. Clin. Cancer Res., 40, 151 (2021).
• 35) Ding X, Jia X, Wang C, Xu J, Gao SJ, Lu CA. DHX9-lncRNA-MDM2 interaction regulates cell invasion and angiogenesis of cervical cancer. Cell Death Differ., 26, 1750–1765 (2019).
• 36) Jiang R, Tang J, Chen Y, Deng L, Ji J, Xie Y, Wang K, Jia W, Chu WM, Sun B. The long noncoding RNA lnc-EGFR stimulates T-regulatory cells differentiation thus promoting hepatocellular carcinoma immune evasion. Nat. Commun., 8, 15129 (2017).
• 37) Li Q, Sun H, Luo D, Gan L, Mo S, Dai W, Liang L, Yang Y, Xu M, Li J, Zheng P, Li X, Li Y, Wang Z. Lnc-RP11-536 K7.3/SOX2/HIF-1α signaling axis regulates oxaliplatin resistance in patient-derived colorectal cancer organoids. J. Exp. Clin. Cancer Res., 40, 348 (2021).
• 38) Shin VY, Chen J, Cheuk IW, Siu MT, Ho CW, Wang X, Jin H, Kwong A. Long non-coding RNA NEAT1 confers oncogenic role in triple-negative breast cancer through modulating chemoresistance and cancer stemness. Cell Death Dis., 10, 270 (2019).
• 39) Li X, Wang S, Li Z, Long X, Guo Z, Zhang G, Zu J, Chen Y, Wen L. The lncRNA NEAT1 facilitates cell growth and invasion via the miR-211/HMGA2 axis in breast cancer. Int. J. Biol. Macromol., 105, 346–353 (2017).
• 40) Wang M, Tu Y, Liu C, Cheng H, Zhang M, Li Q. Gambogenic acid inhibits invasion and metastasis of melanoma through regulation of lncRNA MEG3. Biol. Pharm. Bull., 46, 1385–1393 (2023).
• 41) Geng W, Guo X, Zhang L, Ma Y, Wang L, Liu Z, Ji H, Xiong Y. Resveratrol inhibits proliferation, migration and invasion of multiple myeloma cells via NEAT1-mediated Wnt/β-catenin signaling pathway. Biomed. Pharmacother., 107, 484–494 (2018).
• 42) Ma J, Li J, Wang Y, Chen W, Zheng P, Chen Y, Sun Z, Liu J, Zhou Y, Wang J, Liu S, Han X. WSZG inhibits BMSC-induced EMT and bone metastasis in breast cancer by regulating TGF-β1/Smads signaling. Biomed. Pharmacother., 121, 109617 (2020).
• 43) Woosley AN, Dalton AC, Hussey GS, Howley BV, Mohanty BK, Grelet S, Dincman T, Bloos S, Olsen SK, Howe PH. TGFβ promotes breast cancer stem cell self-renewal through an ILEI/LIFR signaling axis. Oncogene, 38, 3794–3811 (2019).
• 44) Hao Y, Baker D, Ten Dijke P. TGF-β-mediated epithelial-mesenchymal transition and cancer metastasis. Int. J. Mol. Sci., 20, 2767 (2019).
• 45) Stüber T, Monjezi R, Wallstabe L, Kühnemundt J, Nietzer SL, Dandekar G, Wöckel A, Einsele H, Wischhusen J, Hudecek M. Inhibition of TGF-β-receptor signaling augments the antitumor function of ROR1-specific CAR T-cells against triple-negative breast cancer. J. Immunother. Cancer., 8, e000676 (2020).
• 46) Wu Y, Zhang Y, Qin X, Geng H, Zuo D, Zhao Q. PI3K/AKT/mTOR pathway-related long non-coding RNAs: roles and mechanisms in hepatocellular carcinoma. Pharmacol. Res., 160, 105195 (2020).
• 47) Vishnubalaji R, Alajez NM. Epigenetic regulation of triple negative breast cancer (TNBC) by TGF-β signaling. Sci. Rep., 11, 15410 (2021).
• 48) Xu L, Liu W, Li T, Hu Y, Wang Y, Huang L, Wang Y, Shao S, Liu X, Zhan Q. Long non-coding RNA SMASR inhibits the EMT by negatively regulating TGF-β/Smad signaling pathway in lung cancer. Oncogene, 40, 3578–3592 (2021).