The Involvement of HYBID in the Regulation of Intraocular Pressure and Extracellular Matrix Accumulation in the Trabecular Meshwork

Abstract

Increased accumulation of extracellular matrix (ECM) in the trabecular meshwork (TM) causes a rise in intraocular pressure (IOP), which is a primary risk factor for glaucoma. Hyaluronan (HA) is essential for forming the ECM network, but it is unclear whether HA metabolism plays a role in IOP control. In this study, we focused on the hyaluronan-binding protein involved in hyaluronan depolymerization (HYBID, also referred to as cell migration inducing hyaluronidase 1 (CEMIP)/KIAA1199), which is an HA-degrading enzyme. Hybid knockout (KO) mice exhibited IOP elevation [IOP on average +2.14 mmHg at 7 weeks old, +1.54 mmHg at 8 weeks old vs. IOP of wildtype (WT) mice]. In addition, fibronectin and HA accumulated in the TM of Hybid KO mice. In cultured human TM cells (HTMCs), HYBID knockdown with HYBID siRNA increased HA and fibronectin protein but the expression of fibronectin mRNA was not altered. In addition, in HYBID knockdown HTMCs, matrix metalloproteinase (MMP)-1 and tissue inhibitor of metalloproteinase (TIMP) 3 were increased and MMP-9 was decreased. These results indicated that HYBID knockdown did not contribute to fibronectin production but inhibited ECM degradation through decreased MMP-9 expression and increased TIMP3 expression, leading to reduced MMP-2 and MMP-9 activity. These findings may offer new perspectives on the underlying mechanisms of glaucoma associated with fibrosis and potentially contribute to the development of novel glaucoma therapeutics.

INTRODUCTION

Glaucoma, a progressive disease of the eye, is characterized by irreversible death of retinal ganglion cells and is a leading cause of vision loss.¹⁾ The elevation of IOP is an important risk factor for developing primary open angle glaucoma (POAG). IOP is determined by the amount of aqueous humor (AH) in the eyes. Therefore, conventional treatment is aimed at lowering IOP, which targets the production or drainage of the AH. The lowering IOP controls the progression of glaucoma.²⁾

The TM controls IOP by generating AH outflow resistance at the entrance of the Schlemm’s canal.³⁾ The ECM, TM cells, and Schlemm’s canal endothelium work together physically and functionally to generate outflow resistance.³⁾ Previous reports have indicated that the accumulation of ECM in the TM increases the outflow resistance and elevates IOP.^4–6) In the TM of POAG patients, transforming growth factor-β (TGF-β) and other fibrosis-related factors are elevated, which leads to the accumulation of the ECM.⁷⁾ However, there are few agents targeting ECM degradation, making it difficult to remove accumulated ECM.

The ECM is a dynamic extracellular substrate composed of glycoproteins such as collagens, fibronectin, glycosaminoglycans, and so on.⁸⁾ The constituents of the ECM interact with each other and cell surface receptors such as integrin, CD44, and discoidin domain receptors, to construct the ECM network.⁸⁾ Glycosaminoglycans bridge the connection of proteoglycans with other ECM constituents, which is essential for construction of the ECM network.

HA is a ubiquitously expressed glycosaminoglycan, containing repeating disaccharide units of D-glucuronic acid and N-acetyl-d-glucosamine.⁹⁾ HA affects many biological functions via connecting hyaladherins, such as CD44 and Toll-like receptor (TLR) 4.^10,11) HA chains also link ECM molecules with hyaladherins. Thus, HA is essential for forming and stabilizing the ECM. Different sizes of HA may have opposite effects; for instance, high molecular weight HA demonstrates anti-inflammatory effects, whereas low molecular weight HA promotes inflammation.¹¹⁾ Therefore, HA-degrading enzymes are thought to be crucial for HA function. HA is degraded into fragments of different sizes by hyaluronidase (HYAL),¹²⁾ transmembrane protein 2 (TMEM2),¹³⁾ and HYBID, also referred to as KIAA1199 or CEMIP.¹⁴⁾ In the human TM, HYBID expression is higher than other HA-degrading enzymes,¹⁵⁾ and probably plays an important role in HA metabolism.

HYBID was initially identified as a human gene linked to non-syndromic familial deafness.¹⁶⁾ A recent study indicated that HYBID has HA degradation activity in skin, synovium, and brain,^14,17,18) and has an HA degradation mechanism distinct from HYALs.¹⁴⁾ Another previous report indicated that HYBID is down-regulated in optic nerve head astrocytes of ocular hypertensions.¹⁹⁾ HA is accumulated in fibrotic tissue and stabilizes the ECM, which affects the expression of other fibrotic proteins.²⁰⁾

TM fibrosis leads the elevation of IOP²¹⁾ and glaucoma patients have fibrotic TM tissue.⁷⁾ However, the role of HYBID on the ECM of the TM remains unclear. HA, the target of HYBID, is needed for construction of the ECM network and probably plays a role in IOP regulation via ECM expression in the TM. In this study, we investigated the role of HYBID on IOP regulation and ECM expression in the TM.

MATERIALS AND METHODS

Ethics Statement

All animal procedures followed the guidelines outlined in the Association for Research in Vision and Ophthalmology (ARVO) Statement for the Use of Animals in Ophthalmic and Vision Research. The animal experiments received approval and oversight from the Institutional Animal Care and Use Committees of Gifu Pharmaceutical University and Gifu University.

Animals

Hybid (KIAA1199) KO mice were created through the Cre-loxP system, as previously outlined.^17,22) The Institutional Biosafety Committees at Gifu Pharmaceutical University and Gifu University approved their usage. The animals were maintained in a 24 ± 2°C environment with a 12-h light–dark cycle, and had free access to food and water. All experimental procedures and evaluations were conducted blind.

IOP Measurement

IOP measurement was performed on both eyes of 6-, 7-, and 8-week-old mice. We used the rebound tonometer TONOLAB (iCare, Vantaa, Finland) to measure the IOP, as described in detail previously.²³⁾ The TONOLAB was used to take three sets of automatically averaged readings, which were then further averaged. All measurements were finalized before the masking code was disclosed.

Immunohistochemistry

Eyes were fixed in 4% paraformaldehyde (PFA; FUJIFILM Wako, Osaka, Japan) in 0.1 M phosphate buffer (pH 7.4) for 48 h. Samples were subsequently moved through 5, 10, 15, and 20% sucrose (FUJIFILM Wako) solutions every 3 h and stored in 25% sucrose at 4°C for 24 h. The eyes were then embedded in optimal cutting temperature (OCT) compound (Sakura Finetek Japan Co., Ltd., Tokyo, Japan) and cut into 15 µm sections. These sections were blocked for 1 h at room temperature in PBS containing 10% normal horse serum (Vector Laboratories, Burlingame, CA, U.S.A.). Primary antibodies, including rabbit anti-fibronectin [1:100 dilution (ab2413, Abcam, Cambridge, U.K.)] or rabbit anti-collagen I [1:100 dilution (ab34710, Abcam)], were applied and incubated overnight at 4°C. Following PBS washes, sections were treated with Alexa Fluor 488 goat anti-rabbit secondary antibody (Thermo Fisher Scientific, Waltham, MA, U.S.A.) for 1 h at room temperature. Negative controls were incubated without primary antibodies. Images were acquired using a confocal microscope (FV3000, Olympus, Tokyo, Japan), and ImageJ software was used to measure the fluorescence intensity of fibronectin and collagen I.

Cell Culture

Cell culture dishes and plates were treated with 55 µg/mL poly-l-Lysine (ScienCell, San Diego, CA, U.S.A.) by incubating for 1 h in 5% CO₂ at 37°C. Human trabecular meshwork cells (HTMCs; ScienCell, Carlsbad, CA, U.S.A.) were maintained in Dulbecco’s modified Eagle’s medium (DMEM; Sigma-Aldrich, St. Louis, MO, U.S.A.) with 10% fetal bovine serum (FBS; Valeant, Costa Mesa, CA, U.S.A.), 2 mM l-glutamine (FUJIFILM Wako), and 100 units/mL penicillin (Meiji Seika Pharma Ltd., Tokyo, Japan), as well as 100 µg/mL streptomycin (Meiji Seika Pharma Ltd.). Incubation of HTMCs occurred at 37°C with 5% CO₂. HTMCs at 80–90% confluence were split at a ratio of 1 : 3 for proper density maintenance during passaging, with cells from passages 6 to 10 being used to avoid cellular senescence.

Cell Characterization

To assess myocilin expression in HTMCs upon dexamethasone (Dex) treatment, we followed the protocol outlined in a previous report.²⁴⁾ In a previous experiment, HTMCs at 90% confluence were treated with Dex concentrations of 100, 300, and 500 nM, and after 7 d, the changes in myocilin expression were examined using immunoblotting.²⁵⁾

RNA Interference

Stealth RNAi™ siRNA duplexes targeting HYBID were obtained from Thermo Fisher Scientific (Invitrogen, Carlsbad, CA, U.S.A.). The sequences of HYBID siRNA were 5′-ACCACUGUCUUGGCCUCCUUGUCAA-3′ and 5′-UUGACAAGGAGGCCAAGACAGUGGU-3′. HYBID siRNA (Santa Cruz, Texas, U.S.A., sc-140583) was employed to achieve HYBID knockdown in HTMCs. This siRNA comprises a pool of five target-specific siRNAs, each 19–25 nucleotides in length, though the individual sequences are not publicly disclosed. HTMCs were plated at 25000 cells per well in 24-well plates using antibiotic-free DMEM supplemented with 10% FBS and 2 mM l-glutamine. After medium refreshment, the cells were transfected with 20 nM Stealth RNAi™ siRNA Negative Control (Invitrogen, 12935112) or 5, 10, and 20 nM HYBID siRNA, utilizing Lipofectamine RNAiMAX (Invitrogen, 1778150) and Opti-MEM (Thermo Fisher Scientific, 31985070), following the manufacturer’s guidelines. A mix of 1 µL Lipofectamine RNAiMAX and 0.06 µL HYBID siRNA (20 µM) was prepared in 100 µL Opti-MEM and left at room temperature for 15 min. Later, 100 µL of this mixture was added to each well. Knockdown efficiency was confirmed via quantitative real-time reverse transcription PCR (qRT-PCR) at 48 h post-transfection and immunoblotting at 96 h post-transfection.

qRT-PCR Analysis

RNA was isolated from HTMCs using NucleoSpin RNA II (TaKaRa, Shiga, Japan). The RNA concentrations were determined using NanoVue Plus (GE Healthcare, Tokyo, Japan). Single-stranded cDNAs were synthesized from the isolated RNA via reverse transcription with a PrimeScript RT Reagent Kit (Perfect Real Time; TaKaRa). qRT-PCR was performed using TB Green Premix Ex Taq II (Tli RNase H Plus; TaKaRa) and a TP800 Thermal Cycler Dice Real-Time System (TaKaRa). All procedures were carried out according to the manufacturer’s instructions. The PCR primer sequences are listed in Table 1. The cycling conditions were conducted according to the manufacturer’s protocol. Specifically, 40 cycles were performed, with one cycle consisting of 5 s at 95°C and 30 s at 60°C. The results are expressed as relative gene expression levels normalized to that of GAPDH. RNA extraction from HTMCs was performed using NucleoSpin RNA II (TaKaRa, Shiga, Japan), and RNA concentrations were measured with the NanoVue Plus (GE Healthcare, Tokyo, Japan). cDNA was synthesized from the isolated RNA by reverse transcription using the PrimeScript RT Reagent Kit (Perfect Real Time; TaKaRa). qRT-PCR was then performed with TB Green Premix Ex Taq II (Tli RNase H Plus; TaKaRa) on a TP800 Thermal Cycler Dice Real-Time System (TaKaRa), following the manufacturer’s guidelines. Primer sequences are listed in Table 1, and the cycling conditions followed the recommended protocol, consisting of 40 cycles of 5 s at 95°C and 30 s at 60°C. The results were normalized to GAPDH expression and are reported as relative gene expression levels.

Table 1. PCR Primer Sequences

Gene	Forward 5′→3′	Reverse 5′→3′
HYBID (human)	GGCTTCTGAGCCGGAACATC	GCTGCCTTAAATCCCAGAGCAA
FIBRONECTIN (human)	AAACCAATTCTTGGAGCAGG	CCATAAAGGGCAACCAAGAG
COLLAGEN1 (human)	GGAGGGAATCACTGGTGCTA	AGGGGGAAAAACTGCTTTGT
GAPDH (human)	CCTGCACCACCAACTGCTTA	GGCCATCCACAGTCTTCTGAG
HYAL1 (human)	TGTGGCTATAGTTTCCAGAGACC	TGAATTCAGTGTGTGCAGTTGGGT
HYAL2 (human)	GGACCTCATCTCTACCATTGGC	CTTTGAGGTACTGGCAGGTCTC
HYAL3 (human)	GCAGTCCATTGGTGTGAGTGCA	CCAAGGTGTCCACCAGGTAGTC
TMEM2 (human)	GGAATAGGACTGACCTTTGCCAG	TTCTGACCACCCTGAAAGCCGT
MMP1 (human)	CAGAGATGAAGTCCGGTTTTTC	GGGGTATCCGTGTAGCACAT
MMP2 (human)	ATAACCTGGATGCCGTCGT	AGGCACCCTTGAAGAAGTAGC
MMP9 (human)	GCCACTACTGTGCCTTTGAGTC	CCCTCAGAGAATCGCCAGTACT
TIMP1 (human)	GGAGAGTGTCTGCGGATACTTC	GCAGGTAGTGATGTGCAAGAGTC
TIMP2 (human)	ACCCTCTGTGACTTCATCGTGC	GGAGATGTAGCACGGGATCATG
TIMP3 (human)	TACCGAGGCTTCACCAAGATGC	CATCTTGCCATCATAGACGCGAC
HAS1 (human)	TGTGGCTATAGTTTCCAGAGACC	TGAATTCAGTGTGTCCAGTTGGGT
HAS2 (human)	GTCATGTACACAGCCTTCAGAGC	ACAGATGAGGCTGGGTCAAGCA
HAS3 (human)	AGCACCTTCTCGTGCATCATGC	TCCTCCAGGACTCGAAGCATCT
SDC1 (human)	TCCTGGACAGGAAAGAGGTGCT	TGTTTCGGCTCCTCCAAGGAGT
SDC2 (human)	GCTCCAAAAGTGGAAACCACGAC	ATCCTCTTCGGCTGGGTCCATT
SDC3 (human)	CTCCTGGACAATGCCATCGACT	TGAGCAGTGTGACCAAGAAGGC
SDC4 (human)	GAGTGAGGATGTGTCCAACAAGG	GGTACATGAGCAGTAGGATCAGG

Immunoblotting

HTMCs were plated at a density of 25000 cells per well in a 24-well plate and incubated for 24 h in a humidified environment with 5% CO₂ at 37°C. After 24 h, the medium was replaced with DMEM (Sigma-Aldrich) supplemented with 10% FBS (Valeant, Costa Mesa, CA, U.S.A.) and 2 mM l-glutamine (FUJIFILM Wako). The cells were then transfected with either negative control siRNA or HYBID siRNA at final concentrations ranging from 5 to 20 µM and incubated for 48 h. Subsequently, the medium was changed to DMEM containing 10% FBS, 2 mM l-glutamine, 100 units/mL penicillin (Meiji Seika Pharma Ltd.), and 100 µg/mL streptomycin (Meiji Seika Pharma Ltd.), and the cells were cultured for another 48 h. After harvesting, the cells were lysed in RIPA buffer (R0278; Sigma-Aldrich) supplemented with protease inhibitor cocktail, phosphatase inhibitor cocktails 2 and 3 (Sigma-Aldrich), and sample buffer (FUJIFILM Wako). Protein concentrations were assessed using a BCA Protein Assay kit (Thermo Fisher Scientific). Proteins were separated by SDS-PAGE using 5–20% gradient gels (FUJIFILM Wako), transferred to a PVDF membrane (Immobilon-P; Merck Millipore Corporation, Bedford, MA, U.S.A.), and blocked with Blocking One-P (Nacalai Tesque, Kyoto, Japan) or 5% skim milk for 1 h. Membranes were then incubated overnight at 4°C with primary antibodies: rabbit anti-KIAA1199 [1 : 1000 dilution (21129-1-AP, Proteintech, Illinois, U.S.A.)], rabbit anti-fibronectin [1 : 1000 dilution (ab2413, Abcam)], rabbit anti-collagen I [1 : 1000 dilution (ab34710, Abcam)], and mouse anti-β-actin [1 : 1000 dilution (A2228, Sigma-Aldrich)]. After washing with PBS, membranes were incubated with HRP-conjugated secondary antibodies: goat anti-rabbit immunoglobulin G (IgG) or goat anti-mouse IgG [1 : 1000 dilution for both (Thermo Fisher Scientific)]. Protein bands were visualized with a chemiluminescent substrate (ImmunoStar^® LD; FUJIFILM Wako) and analyzed using a LAS-4000 UV mini Luminescent Image Analyzer (FUJIFILM, Tokyo, Japan) with Multi Gauge Version 3.0 software (FUJIFILM) and an Amersham Imager 680 (FUJIFILM). Protein loading was verified using β-actin.

HA Staining with HA Binding Protein (HABP)

HA was stained in frozen eye sections and in HTMCs. HA was detected using biotinylated HABP. HABP has a versican G1 domain that specifically binds to the repeating unit of HA, so the level of HABP represents the amount of HA. The frozen eye sections were incubated overnight at 4°C with 5 mg/mL of HABP (Hokudo, Hokkaido, Japan) containing 3% normal horse serum in PBS. Next, the samples were incubated for 1 h at room temperature with streptavidin conjugated to Alexa Fluoro™ 488 (37350A, Molecular Probes, Oregon, U.S.A.). After fixing HTMCs in 4% PFA for 15 min, they were blocked using 1.5% horse serum and 1% BSA in PBS for 60 min. The cells were then incubated with HABP (1:50 dilution) overnight at 4°C and further incubated with Alexa Fluor^TM 488-conjugated streptavidin at room temperature for 1 h. Images were acquired with a confocal microscope (FV3000, Olympus, Tokyo, Japan), and the fluorescent intensity of HABP was quantified using ImageJ software.

Gelatin Zymography

HTMCs were cultured in DMEM supplemented with 2 mM l-glutamine (without FBS) for 48 h after treatment with 20 nM negative control siRNA or 20 nM HYBID siRNA for 48 h. Next, the supernatant was collected and centrifuged at 2400 × g for 5 min to remove the cells. The resulting supernatant was concentrated tenfold using an Amicon Ultra-15 centrifugal filter (UFC900324, Merck Millipore, Massachusetts, America). The protein concentrations were assessed using a BCA Protein Assay kit (Thermo Fisher Scientific). The samples were subjected to gelatin zymography using a Gelatin Zymography kit (Cosmo Bio, Tokyo, Japan) according to the vendor’s protocol. We quantified the results using Amersham Imager 680 (FUJIFILM).

Statistical Analysis

The results are expressed as mean ± standard error of the mean (S.E.M.). Statistical analyses were performed using Student’s t-test or Dunnett’s test with SPSS Statistics software (IBM, Armonk, NY, U.S.A.). A p-value of less than 0.05 was considered statistically significant.

RESULTS

Analysis of IOP in Hybid KO Mice

We hypothesized that Hybid KO mice have elevated IOP due to both low HA resolution and ECM accumulation in the TM. Therefore, the IOP in Hybid KO mice was measured and compared with that in WT mice. The IOP was measured in 6-, 7-, and 8-week-old mice using the rebound tonometer TONOLAB. Hybid KO mice had significantly higher IOP at 7 weeks old (20.48 ± 0.41 mmHg in KO vs. 18.3 ± 0.43 mmHg in WT, p = 0.0010) and at 8 weeks old (18.9 ± 0.43 mmHg in KO vs. 17.4 ± 0.40 mmHg in WT, p = 0.013). In addition, the IOP tended to be higher at 6 weeks old (18.2 ± 0.39 mmHg in KO vs. 17.3 ± 0.36 mmHg in WT, p = 0.097) (Fig. 1).

Fig. 1. Hybid KO Mice Have Higher IOP than WT Mice

Measurement of the IOP of WT and Hybid KO mice. The IOP of 6-, 7-, and 8-week-old WT or Hybid KO mice. The data are shown as the mean ± S.E.M. (WT: n = 19, KO: n = 18, n means the number of animals), ^**p = 0.0010, ^*p = 0.013 vs. WT group (Student’s t-test). Hybid: hyaluronan-binding protein involved in hyaluronan depolymerization; IOP: intraocular pressure; KO: knockout; WT: wildtype.

Accumulation of the ECM in the TM from Hybid KO Mice

We found increased IOP in Hybid KO mice (Fig. 1), which suggests that the ECM may accumulate in the TM. Next, we evaluated the expression of the ECM by immunohistochemistry in Hybid KO mice and WT mice. HA was detected using HABP. HA, fibronectin, and collagen I were localized on the TM and sclera in both WT and Hybid KO mice (Fig. 2A). The Hybid KO mice exhibited increased fluorescent intensity of fibronectin and HABP, indicating that fibronectin and HA expression, respectively, were more abundant in the Hybid KO mice TM (Figs. 2A–2C). By contrast, the Hybid KO had no effect on collagen I expression in mice (Figs. 2A, 2D).

Fig. 2. The Expression of ECM Components in the TM from WT and Hybid KO Mice

HA and fibronectin expression were significantly increased in the TM from Hybid KO mice compared with WT mice. (A) Representative image of immunofluorescence staining of HA binding protein (HABP) (green), Fibronectin (Red), and Collagen I (Red) in the section. HABP indicates the expression of HA. Arrow heads indicate the TM. Scale bar: 100 µm. (B–D) The fluorescent intensity of HABP (B), Fibronectin (C), and Collagen I (D). The data are shown as the mean ± S.E.M. (n = 5, n means the number of animals), ^*p = 0.039 (B), p = 0.0156 (C) vs. WT group (B–D: Student’s t-test). ECM: extracellular matrix; Hybid: hyaluronan-binding protein involved in hyaluronan depolymerization; KO: knockout; TM: trabecular meshwork; WT: wildtype.

Knockdown of HYBID in HTMCs Had No Effect on ECM mRNA Levels

Increased expression of the ECM was observed in the TM of Hybid KO mice (Figs. 2A–2C). Therefore, we hypothesized that HYBID affects the mRNA levels of ECM components. We treated HTMCs with HYBID siRNAs for 48 h. qRT-PCR showed that HYBID was sufficiently knocked down (5 nM; 97%, 10 nM; 98%, 20 nM; 98%) (Fig. 3A). On the contrary, the mRNA levels of FN1 and COL1 did not significantly change in the HYBID knockdown HTMCs (Figs. 3B, 3C). In the present study, the expression of fibronectin was increased in Hybid KO mice. However, in HTMCs treated with HYBID siRNAs, the FN1 mRNA levels did not change. Based on these results, we hypothesized that HYBID does not affect the production of fibronectin but instead inhibits the degradation of fibronectin. Then we measured the mRNA levels of MMPs, TIMPs, and other HA-degrading enzymes, such as HYALs and TMEM2. We found that treatment with HYBID siRNA (20 nM) significantly decreased the mRNA levels of HYAL1 and MMP9, and the mRNA levels of MMP1 and TIMP3 were increased. The expression of other factors, such as MMP2, HYAL2-3, TMEM2, and TIMP1-2, were not altered by treatment with HYBID siRNA (20 nM).

Fig. 3. The mRNA Levels of ECM Components and Related Genes in HYBID Knockdown HTMCs

There were no significant changes in the mRNA levels of ECM components, but certain genes related to ECM degradation were altered in expression in the HYBID knockdown HTMCs. We treated HTMCs with HYBID siRNA or NT siRNA for 48 h, then measured the mRNA levels of specific genes by qRT-PCR analysis. The gene expression levels were normalized to GAPDH levels. (A–M) The mRNA levels of HYBID (A), FN1 (B), COL1 (C), HYAL1 (D), HYAL2 (E), HYAL3 (F), TMEM2 (G), MMP-1 (H), MMP-2 (I), MMP-9 (J), TIMP1 (K), TIMP2 (L), and TIMP3 (M) in HTMCs transfected with HYBID or NT siRNA. The data are shown as the mean ± S.E.M. (n = 4~6, n means the sample number), ^*p = 0.029 (D), p = 0.020 (J),^**p = 0.0029 (H), p = 0.0010 (M), ^***p < 0.001 (A) vs. NT siRNA (A, B; Dunnett’s T3 test, C; Dunnett’s test, D–F, H–M; Student’s t-test, G; Welch’s t-test). ECM: extracellular matrix; HTMCs: human trabecular meshwork cells; HYBID: hyaluronan-binding protein involved in hyaluronan depolymerization; NT: negative control; qRT-PCR: quantitative real-time reverse transcription polymerase chain reaction.

The Knockdown of HYBID in HTMCs Increased Fibronectin Protein Levels

Next, we investigated the effects of the HYBID knockdown on the expression of ECM proteins by immunoblotting. We treated HTMCs with HYBID siRNA for 48 h, then further cultured the cells without siRNA for 48 h and obtained cell lysates. We found that the HYBID knockdown increased fibronectin protein levels but had no effect on collagen I protein levels (Figs. 4A, 4B). Since fibronectin is degraded mainly by MMP-2 and MMP-9, the mRNA levels of MMP2 and MMP9 were measured in HYBID knockdown HTMCs. The MMP9 mRNA levels were decreased, but the MMP2 mRNA levels did not change (Figs. 3I, 3J). These results suggest that when HYBID is knocked down in HTMCs, fibronectin degradation is inhibited, resulting in increased fibronectin protein levels.

Fig. 4. The Expression Levels of ECM Components in HYBID Knockdown HTMCs

Fibronectin expression was significantly increased in HYBID knockdown HTMCs. We treated HTMCs with HYBID siRNA or NT siRNA for 48 h, then further cultured the cells without siRNA for 48 h and obtained cell lysates for immunoblotting. (A) Representative images of the immunoblots, and the expression levels of Fibronectin in HTMCs transfected with HYBID siRNA or NT siRNA. β-Actin was used as a loading control. (B) Representative images of the immunoblots, and the expression levels of Collagen I normalized to β-actin in HTMCs transfected with HYBID siRNA or NT siRNA. The data are shown as the mean ± S.E.M. (n = 4, n means the sample number), ^*p = 0.049 vs. NT siRNA (A; Dunnett’s T3 test, B; Dunnett’s test). ECM: extracellular matrix; HTMCs: human trabecular meshwork cells; HYBID: hyaluronan-binding protein involved in hyaluronan depolymerization; NT: negative control.

The Knockdown of HYBID in HTMCs Increased HA Expression

Next, we examined the influence of HYBID on the amount of HA in HTMCs. We treated HTMCs with HYBID siRNA (20 nM) for 48 h, and detected HA by immunostaining using HABP. We found that HYBID knockdown increased the fluorescent intensity of HABP, which is an indicator of the HA levels (Figs. 5A, 5B).

Fig. 5. The Expression Levels of HA in HYBID Knockdown HTMCs

HA expression, as monitored by HA binding protein (HABP) immunofluorescence, was significantly increased in HYBID knockdown HTMCs. (A) Representative image of immunofluorescence staining of HABP (green) in HTMCs transfected with 20 nM HYBID siRNA or NT siRNA. Hoechst staining was conducted to stain the nucleus, and the merged images are shown. Scale bar: 100 µm. (B) The expression levels of HABP in HTMCs transfected with HYBID siRNA or NT siRNA. The data are shown as the mean ± S.E.M. (n = 6, n means the sample number), ^***p = 0.00012 vs. NT siRNA (Student’s t-test). HA: hyaluronan; HTMCs: human trabecular meshwork cells; HYBID: hyaluronan-binding protein involved in hyaluronan depolymerization; NT: negative control.

The Knockdown of HYBID Affected the mRNA Levels of HAS2 and Specific SDCs

In the present study, the knockdown of HYBID was found to increase fibronectin protein levels, but the fibronectin mRNA levels were not affected. It remains unclear why the protein levels of fibronectin increased in the HYBID knockdowns. Fibronectin is a major ECM structural protein that binds to syndecan (SDC), a cell surface receptor that mediates cell-ECM adhesion, via glycosaminoglycans. We measured the mRNA levels of SDCs following the same protocol described in Fig. 3. We found that the knockdown of HYBID increased the mRNA levels of SDC3 and decreased the SDC4 mRNA levels. By contrast, the SDC1 and SDC2 mRNA levels were not changed in the HYBID knockdowns (Figs. 6D–6G).

Fig. 6. The mRNA Levels of HASes and SDCs in HYBID Knockdown HTMCs

Among the subtypes of HASes and SDCs, certain genes exhibited significant changes in the HYBID knockdown HTMCs. We treated HTMCs with HYBID siRNA or NT siRNA for 48 h, then measured the mRNA levels of specific genes by qRT-PCR analysis. The gene expression levels were normalized to GAPDH mRNA levels. (A–G) The mRNA levels of HAS1 (A), HAS2 (B), HAS3 (C), SDC1 (D), SDC2 (E), SDC3 (F), and SDC4 (G) in HTMCs transfected with HYBID or NT siRNA. The data are shown as the mean ± S.E.M. (n = 5~6, n means the sample number). ^**p = 0.0011 (B), ^**p = 0.0012 (F), ^**p = 0.0044 (G) vs. NT siRNA (Student’s t-test). HTMCs: human trabecular meshwork cells; HYBID: hyaluronan-binding protein involved in hyaluronan depolymerization; NT: negative control; SDCs: syndecans; qRT-PCR: quantitative real-time reverse transcription polymerase chain reaction.

As shown in Fig. 5, the knockdown of HYBID increased the HA levels, although its influence on the production of HA remains unclear. Next, we measured the mRNA levels of HASes. The knockdown of HYBID significantly increased the mRNA levels of HAS2, but the mRNA levels of HAS1 and HAS3 exhibited no significant changes (Figs. 6A–6C).

The Knockdown of HYBID in HTMCs Decreased MMP-9 Activity

HYBID knockdown resulted in decreased mRNA expression of MMP9 and increased mRNA expression of TIMP3. Since TIMP3 downregulates the activity of MMP-2 and MMP-9 by connecting the active forms of MMP-2 and MMP-9, these results suggest that knockdown of HYBID leads to a decrease in MMP-9 and MMP-2 activity. Therefore, we performed gelatin zymography to assess the activities of MMP-9 and MMP-2. Treatment of HTMCs with HYBID siRNA was performed for 48 h, then the cells were further cultured without FBS for 48 h and the supernatants obtained. HYBID siRNA treatment significantly decreased MMP-9 activity (Figs. 7A–7C). At this time, MMP-2 proteins were not initially detected; however, when the assay was performed using a more concentrated sample, MMP-2 became detectable. Nonetheless, no significant difference in MMP-2 activity was observed in the HYBID knockdown compared with the control (no data shown).

Fig. 7. The Activity of MMP-9 and MMP-2 in HYBID Knockdown HTMCs

The activity of MMP-9 significantly increased in the HYBID knockdown HTMCs. We treated HTMCs with 20 nM HYBID siRNA or NT siRNA for 48 h, then collected the supernatant for measurement of MMP-9 and MMP-2 activity by gelatin zymography. The samples were normalized based on protein concentration. (A) Representative images of the blots of MMP-9, pro MMP-9, MMP-2, and pro MMP-2 by gelatin zymography. (B, C) The intensity of MMP-9 (B) and pro MMP-9 (C) that reflect the activity of each gelatinase. The data are shown as the mean ± S.E.M. (n = 4). ^**p = 0.0013 (B), ^**p = 0.0025 (C) vs. NT siRNA (Student’s t-test). HTMCs: human trabecular meshwork cells; HYBID: hyaluronan-binding protein involved in hyaluronan depolymerization; NT: negative control.

DISCUSSION

Previous reports have indicated that among glaucoma patients, high ECM expression in the TM induces an increase in IOP.²⁶⁾ HA is one of the major components of the ECM, but the relationship between IOP and HA-degrading enzymes including HYBID is not well understood. This study provided the first insight into the relationship between HYBID and IOP. To clarify the role of HYBID on the TM, we first compared the IOP between WT mice and Hybid KO mice. We found that Hybid KO mice had higher IOP (on average +2.14 mmHg at 7 weeks old, +1.54 mmHg at 8 weeks old vs. IOP of WT mice) (Fig. 1). The spontaneous high IOP model mice, DBA/2J, which is a widely used model of chronic secondary angle-closure glaucoma, has elevated IOP at 9 months old (+9 mmHg vs. strain-matched control: DBA/2J^{Gpnmb + /SjJ}).^27,28) By contrast, Vav2/Vav3 KO mice exhibit ocular phenotype-like angle-closure glaucoma at 6 weeks old (+4 mmHg vs. WT).²⁹⁾ Moreover, collagen I mutated mice exhibit high IOP by age-dependent accumulation of collagen type I at 4 months old (+4 mmHg vs. WT).³⁰⁾ Compared with these model mice, Hybid KO mice had high IOP at a relatively earlier phase, but the difference in IOP compared with WT mice is smaller. A previous report indicated that intracameral injection of different molecular weight HA molecules (20 kDa to 2000 kDa) into rabbits increased the IOP in a molecular weight-dependent manner (−1 mmHg to + 16 mmHg).³¹⁾ Therefore, the Hybid KO may trigger IOP elevation by accumulation of high-molecular weight HA. In this study, immunohistochemistry indicated that Hybid KO mice had increased expression of HA and fibronectin in the TM (Figs. 2A–2D). Thus, these data revealed the possibility that HYBID affects not only HA, but also other ECM molecules. In previous studies, ECM-degrading enzymes increased outflow facility, which leads to lower IOP; HYAL treatment, the major HA degradation enzyme, increased outflow facility in dog and rabbit eyes. Moreover, in human perfused anterior segment organ culture, heparinase, which degrades heparan sulfate (a major glycosaminoglycan), was shown to increase outflow. In addition, inhibition of glycosaminoglycan biosynthesis or glycosaminoglycan sulfation was also shown to increase outflow.³²⁾ Furthermore, inhibition of ECM-degrading enzymes elevated the IOP; Mmp9-deficient mice exhibited increased IOP (+5 mmHg at 2- to 8-months-old, +7 mmHg at 9- to 12-months-old vs. WT).³³⁾ These reports implied that the expression levels of ECM-degrading enzymes play an important role in IOP homeostasis. Furthermore, inhibition of HA synthesis in porcine TM cells by multiple mechanisms including 4-methylumbelliferone treatment, silencing of HA synthases, and HYAL treatment reduced the expression of fibronectin and versican.³⁴⁾ These results implied that decreasing the HA levels results in a reduction in fibronectin. Conversely, increasing the HA levels may trigger an increase in fibronectin. In our study, the elevated HA levels in Hybid KO mice led to an increase in fibronectin, potentially resulting in increased IOP. In addition, in the present study, HYBID knockdown decreased the expression of MMP9 in HTMCs. Since MMP-9 is one of the major factors that degrades fibronectin, downregulation of MMP-9 leads to an increase in fibronectin protein levels. In the Hybid KO mouse, it is possible that fibronectin was also increased due to decreased expression of MMP-9.

In HTMCs, we found that HYBID knockdown increased the expression levels of HA and fibronectin (Fig. 4A and Figs. 5A–5B). Conversely, there was no significant change observed in the mRNA expression levels of FN1 (Fig. 5B). From these observations, we hypothesized that the absence of HYBID led to the stabilization of HA and fibronectin or led to the suppression of degradation of these factors and was not due to an increase in the production of these factors. MMP-2 and MMP-9 are expressed in the human TM³⁵⁾ and have a fibronectin domain that catalyzes the degradation of ECM.³⁶⁾ We found that the HYBID knockdown did not affect MMP2 levels but downregulated MMP9 expression (Figs. 3I–3J). In addition, the HYBID knockdown increased the expression of TIMP3 (Fig. 3M). TIMP3 downregulates the activity of MMP-2 and MMP-9 by connecting the active forms of MMP-2 and MMP-9.³⁷⁾ Indeed, we found that the HYBID knockdown decreased MMP-9 activity (Figs. 7A–7C). Thus, the HYBID knockdown might suppress the degradation of the ECM via a decrease in MMP-9 activity, which leads to an increase in fibronectin protein levels. Furthermore, HYBID may not be directly involved in ECM production. Fibronectin is a major ECM structural protein that binds to SDC, a cell surface receptor that mediates cell-ECM adhesion, via glycosaminoglycans.³⁸⁾ SDC is essential for establishing a physical connection to the cytoskeleton, enabling force transmission, and regulating the spatial organization of signaling complex formation. Previous studies have reported that variations in the expression of other ECM constituents affect the expression and metabolism of fibronectin.^8,38) Thus, we hypothesized that the observed increase in fibronectin protein levels in the HYBID knockdown may be associated with alterations in SDC expression. Therefore, we evaluated the mRNA expression of SDCs (SDC1, SDC2, SDC3, and SDC4) in the HYBID knockdown HTMCs. We found that HYBID knockdown increased the SDC3 mRNA levels and decreased the SDC4 mRNA levels. By contrast, the SDC1 and SDC2 mRNA levels were not changed in the HYBID knockdown HTMCs (Figs. 6D–6G). It has been reported that SDC3 is produced intracellularly and then translocates to the plasma membrane, where it binds to ECM components such as fibronectin and collagen, and that this binding is important for matrix construction and growth factor transduction.³⁹⁾ It has also been reported that SDC3 in the plasma membrane reassociates with the ECM after MMP-dependent cleavage,⁴⁰⁾ suggesting that SDC3 plays an important role in ECM formation. Therefore, an increase in SDC3 upon HYBID knockdown in HTMCs may be involved in both the stability of the ECM and the increased expression of the ECM. SDC4 is known to bind to the heparin-binding domain (HBD) of fibronectin and is involved in cell adhesion, migration, and tissue repair. In a previous study, it has been reported that knockdown of SDC4 disrupts extracellular fibril formation; however, no changes were observed in fibronectin mRNA levels or total protein content.⁴¹⁾ Regarding its involvement with other extracellular molecules, the knockdown of SDC4 disrupts ECM homeostasis by decreasing the expression of MMP-9⁴²⁾ and increasing collagen I expression.⁴³⁾ It is possible that the downregulation of SDC4 upon HYBID knockdown is involved in the decrease in MMP9 mRNA expression as shown in Fig. 3J. These processes may result in the inhibition of fibronectin degradation, potentially increasing fibronectin expression levels.

We evaluated the mRNA expression of other HA degrading enzymes and HA synthases such as HYALs, TMEM2, and HASes. We found that the knockdown of HYBID increased the mRNA levels of HAS2 (Fig. 6B), which indicated the involvement of HYBID in HA synthesis. In the present study, the knockdown of HYBID did not affect the expression of HYAL2, HYAL3, or TMEM2 (Figs. 3D–3G). The function of TMEM2 exhibits differences among species: while mouse TMEM2 possesses hyaluronidase activity, human TMEM2 does not exhibit this activity.^44,45) Human TMEM2 has been reported to regulate the expression of HYBID and HAS2, and it has been shown that knockdown of TMEM2 in human fibroblasts paradoxically promotes HA degradation.⁴⁶⁾ Our data suggest that reduced expression of HYBID does not directly influence the regulation of TMEM2.

While the expression of HA and fibronectin increased in the HYBID knockdown, there was no significant difference observed in the expression levels of collagen I, a major constituent of the ECM (Figs. 2D, 4B). Therefore, we hypothesized that the knockdown of HYBID might be involved in suppressing ECM degradation and thus stabilizing the ECM. According to this hypothesis, it is expected that the expression of collagen I, the major ECM component, will increase due to the deficiency of HYBID. However, we found that collagen I did not significantly change in the HYBID knockdowns. MMP-1 is one of the major collagenases expressed in the human TM. In our study, it was shown that HYBID knockdown increased the mRNA levels of MMP1 (Fig. 3H). The relative stability in the expression level of collagen I may be attributed to a balance between increased accumulation due to ECM stabilization and enhanced degradation driven by upregulated MMP-1 expression.

This study suggests that HYBID, which is responsible for HA metabolism, is involved in the elevation of IOP via suppressing ECM degradation in the TM. However, the HYBID-mediated mechanism which regulates the IOP and ECM remains unclear. HYBID is the most recently identified molecule among HA-degrading enzymes, and its associations with various diseases are gradually becoming clear. However, its relationship with glaucoma remains unclear.

In conclusion, this study has elucidated the involvement of HYBID deficiency in the elevation of IOP and ECM accumulation, suggesting an important role for HYBID in the homeostasis of the TM. Furthermore, clarifying the involvement of HYBID in ECM accumulation in the TM may provide new insights into the pathogenesis of glaucoma associated with fibrosis. These novel insights may contribute to the development of novel glaucoma therapeutics.

Acknowledgments

The authors thank Dr. Hiroyuki Yoshida (Department of Biological Science Research, Kao Corporation) for creating Hybid KO mice.

Author Contributions

Conception and design: Y.T., K.A., M.S.; collection and/or assembly of data: Y.T.; data analysis and interpretation: Y.T., K.A., Y.K., S.N., M.S.; manuscript writing: Y.T., M.S.; financial support: Y.K., S.N., M.S.; final approval of manuscript: Y.O., M.S.

Conflict of Interest

The authors declare no conflict of interest.

Data Availability

The data supporting the conclusions of this study can be obtained from the corresponding author upon reasonable request.

REFERENCES

• 1)  Quigley HA. Number of people with glaucoma worldwide. Br. J. Ophthalmol., 80, 389–393 (1996).
• 2)  Anderson DR. Glaucoma: the damage caused by pressure XLVI Edward Jackson memorial lecture. Am. J. Ophthalmol., 108, 485–495 (1989).
• 3)  Stamer WD, Acott TS. Current understanding of conventional outflow dysfunction in glaucoma. Curr. Opin. Ophthalmol., 23, 135–143 (2012).
• 4)  Johnson M. 'What controls aqueous humour outflow resistance?' Exp. Eye Res., 82, 545–557 (2006).
• 5)  Braunger BM, Fuchshofer R, Tamm ER. The aqueous humor outflow pathways in glaucoma: A unifying concept of disease mechanisms and causative treatment. Eur. J. Pharm. Biopharm., 95 (Pt. B), 173–181 (2015).
• 6)  Keller KE, Peters DM. Pathogenesis of glaucoma: extracellular matrix dysfunction in the trabecular meshwork-A review. Clin. Exp. Ophthalmol., 50, 163–182 (2022).
• 7)  Zhavoronkov A, Izumchenko E, Kanherkar RR, Teka M, Cantor C, Manaye K, Sidransky D, West MD, Makarev E, Csoka AB. Pro-fibrotic pathway activation in trabecular meshwork and lamina cribrosa is the main driving force of glaucoma. Cell Cycle, 15, 1643–1652 (2016).
• 8)  Theocharis AD, Skandalis SS, Gialeli C, Karamanos NK. Extracellular matrix structure. Adv. Drug Deliv. Rev., 97, 4–27 (2016).
• 9)  Fraser JRE, Laurent TC, Laurent UBG. Hyaluronan: its nature, distribution, functions and turnover. J. Intern. Med., 242, 27–33 (1997).
• 10)  McKeown-Longo PJ, Higgins PJ. Hyaluronan, transforming growth factor β, and extra domain A-fibronectin: a fibrotic triad. Adv. Wound Care (New Rochelle), 10, 137–152 (2021).
• 11)  Garantziotis S, Savani RC. Hyaluronan biology: a complex balancing act of structure, function, location and context. Matrix Biol., 78-79, 1–10 (2019).
• 12)  Csoka AB, Frost GI, Stern R. The six hyaluronidase-like genes in the human and mouse genomes. Matrix Biol., 20, 499–508 (2001).
• 13)  Yamamoto H, Tobisawa Y, Inubushi T, Irie F, Ohyama C, Yamaguchi Y. A mammalian homolog of the zebrafish transmembrane protein 2 (TMEM2) is the long-sought-after cell-surface hyaluronidase. J. Biol. Chem., 292, 7304–7313 (2017).
• 14)  Yoshida H, Nagaoka A, Kusaka-Kikushima A, Tobiishi M, Kawabata K, Sayo T, Sakai S, Sugiyama Y, Enomoto H, Okada Y, Inoue S. KIAA1199, a deafness gene of unknown function, is a new hyaluronan binding protein involved in hyaluronan depolymerization. Proc. Natl. Acad. Sci. U.S.A., 110, 5612–5617 (2013).
• 15)  van Zyl T, Yan W, McAdams AM, Monavarfeshani A, Hageman GS, Sanes JR. Cell atlas of the human ocular anterior segment: Tissue-specific and shared cell types. Proc. Natl. Acad. Sci. U.S.A., 119, e2200914119 (2022).
• 16)  Abe S, Usami SI, Nakamura Y. Mutations in the gene encoding KIAA1199 protein, an inner-ear protein expressed in Deiters’ cells and the fibrocytes, as the cause of nonsyndromic hearing loss. J. Hum. Genet., 48, 564–570 (2003).
• 17)  Shimoda M, Yoshida H, Mizuno S, Hirozane T, Horiuchi K, Yoshino Y, Hara H, Kanai Y, Inoue S, Ishijima M, Okada Y. Hyaluronan-binding protein involved in hyaluronan depolymerization controls endochondral ossification through hyaluronan metabolism. Am. J. Pathol., 187, 1162–1176 (2017).
• 18)  Yoshino Y, Ishisaka M, Tsuruma K, Shimazawa M, Yoshida H, Inoue S, Shimoda M, Okada Y, Hara H. Distribution and function of hyaluronan binding protein involved in hyaluronan depolymerization (HYBID, KIAA1199) in the mouse central nervous system. Neuroscience, 347, 1–10 (2017).
• 19)  Yang Y-J, Xiang Y, Tian Y, Xia F, Zhou Y-S, Peng J, Peng Q-H. Hub genes of astrocyte involved in glaucoma with ocular hypertension by integrated bioinformatics analysis. Digit. Chin. Med., 1, 280–288 (2018).
• 20)  Evanko SP, Potter-Perigo S, Petty LJ, Workman GA, Wight TN. Hyaluronan controls the deposition of fibronectin and collagen and modulates TGF-β1 induction of lung myofibroblasts. Matrix Biol., 42, 74–92 (2015).
• 21)  Tian B, Geiger B, Epstein DL, Kaufman PL. Cytoskeletal involvement in the regulation of aqueous humor outflow. Invest. Ophthalmol. Vis. Sci., 41, 619–623 (2000).
• 22)  Yoshino Y, Shimazawa M, Nakamura S, Inoue S, Yoshida H, Shimoda M, Okada Y, Hara H. Targeted deletion of HYBID (hyaluronan binding protein involved in hyaluronan depolymerization/ KIAA1199/CEMIP) decreases dendritic spine density in the dentate gyrus through hyaluronan accumulation. Biochem. Biophys. Res. Commun., 503, 1934–1940 (2018).
• 23)  Aoshima K, Inagaki S, Takagi Y, Nakamura S, Hara H, Shimazawa M. ALK5 inhibitor acts on trabecular meshwork cell and reduces intraocular pressure. Exp. Eye Res., 227, 109382 (2023).
• 24)  Keller KE, Bhattacharya SK, Borrás T, et al. Consensus recommendations for trabecular meshwork cell isolation, characterization and culture. Exp. Eye Res., 171, 164–173 (2018).
• 25)  Morozumi W, Aoshima K, Inagaki S, Iwata Y, Takagi Y, Nakamura S, Hara H, Shimazawa M. Piezo1 activation induces fibronectin reduction and PGF2a secretion via arachidonic acid cascade. Exp. Eye Res., 215, 108917 (2022).
• 26)  Rohen JW, Linnér E, Witmer R. Electron microscopic studies on the trabecular meshwork in two cases of corticosteriod-glaucoma. Exp. Eye Res., 17, 19–31 (1973).
• 27)  Libby RT, Anderson MG, Pang IH, Robinson ZH, Savinova OV, Cosma IM, Snow A, Wilson LA, Smith RS, Clark AF, John WMS. Inherited glaucoma in DBA/2J mice: pertinent disease features for studying the neurodegeneration. Vis. Neurosci., 22, 637–648 (2005).
• 28)  Van Hook MJ, Monaco C, Bierlein ER, Smith JC. Neuronal and synaptic plasticity in the visual thalamus in mouse models of glaucoma. Front. Cell. Neurosci., 14, 1–17 (2021).
• 29)  Fujikawa K, Iwata T, Inoue K, Akahori M, Kadotani H, Fukaya M, Watanabe M, Chang Q, Barnett EM, Swat W. VAV2 and VAV3 as candidate disease genes for spontaneous glaucoma in mice and humans. PLoS One, 5, e9050 (2010).
• 30)  Mabuchi F, Lindsey JD, Aihara M, Mackey MR, Weinreb RN. Optic nerve damage in mice with a targeted type I collage mutation. Invest. Ophthalmol. Vis. Sci., 45, 1841–1845 (2004).
• 31)  Equi RA, Jumper M, Cha C, Stern R, Schwartz DM. Hyaluronan polymer size modulates intraocular pressure. J. Ocul. Pharmacol. Ther., 13, 289–295 (1997).
• 32)  Acott TS, Kelley MJ. Extracellular matrix in the trabecular meshwork. Exp. Eye Res., 86, 543–561 (2008).
• 33)  De Groef L, Andries L, Siwakoti A, Geeraerts E, Bollaerts I, Noterdaeme L, Etienne I, Papageorgiou AP, Stalmans I, Billen J, West-Mays JA, Moons L. Aberrant collagen composition of the trabecular meshwork results in reduced aqueous humor drainage and elevated IOP in MMP-9 null mice. Invest. Ophthalmol. Vis. Sci., 57, 5984–5995 (2016).
• 34)  Keller KE, Sun YY, Vranka JA, Hayashi L, Acott TS. Inhibition of hyaluronan synthesis reduces versican and fibronectin levels in trabecular meshwork cells. PLOS ONE, 7, e48523 (2012).
• 35)  De Groef L, Van Hove I, Dekeyster E, Stalmans I, Moons L. MMPs in the trabecular meshwork: promising targets for future glaucoma therapies? Invest. Ophthalmol. Vis. Sci., 54, 7756–7763 (2013).
• 36)  Mondal S, Adhikari N, Banerjee S, Amin SA, Jha T. Matrix metalloproteinase-9 (MMP-9) and its inhibitors in cancer: a minireview. Eur. J. Med. Chem., 194, 112260 (2020).
• 37)  Cabral-Pacheco GA, Garza-Veloz I, Castruita-De la Rosa C, Ramirez-Acuña JM, Perez-Romero BA, Guerrero-Rodriguez JF, Martinez-Avila N, Martinez-Fierro ML. The roles of matrix metalloproteinases and their inhibitors in human diseases. Int. J. Mol. Sci., 21, 9739 (2020).
• 38)  Morgan MR, Humphries MJ, Bass MD. Synergistic control of cell adhesion by integrins and syndecans. Nat. Rev. Mol. Cell Biol., 8, 957–969 (2007).
• 39)  Couchman JR. Syndecans: proteoglycan regulators of cell-surface microdomains? Nat. Rev. Mol. Cell Biol., 4, 926–937 (2003).
• 40)  Asundi VK, Erdman R, Stahl RC, Carey DJ. Matrix metalloproteinase-dependent shedding of syndecan-3, a transmembrane heparan sulfate proteoglycan, in Schwann cells. J. Neurosci. Res., 73, 593–602 (2003).
• 41)  Zhang Z, Rankin SA, Zorn AM. Syndecan4 coordinates Wnt/JNK and BMP signaling to regulate foregut progenitor development. Dev. Biol., 416, 187–199 (2016).
• 42)  Lai ZY, Yang CC, Chen PH, Chen WC, Lai TY, Lu GY, Yang CY, Wang KY, Liu WC, Chen YC, Liu LYM, Chuang YJ. Syndecan-4 is required for early-stage repair responses during zebrafish heart regeneration. Mol. Biol. Rep., 51, 604 (2024).
• 43)  Rønning SB, Carlson CR, Aronsen JM, Pisconti A, Høst V, Lunde M, Liland KH, Sjaastad I, Kolset SO, Christensen G, Pedersen ME. Syndecan-4^−/− mice have smaller muscle fibers, increased Akt/mTOR/S6K1 and Notch/HES-1 pathways, and alterations in extracellular matrix components. Front. Cell Dev. Biol., 8, 730 (2020).
• 44)  Yoshino Y, Goto M, Hara H, Inoue S. The role and regulation of TMEM2 (transmembrane protein 2) in HYBID (hyaluronan (HA)-binding protein involved in HA depolymerization/KIAA1199/CEMIP)-mediated HA depolymerization in human skin fibroblasts. Biochem. Biophys. Res. Commun., 505, 74–80 (2018).
• 45)  Yoshida H, Inoue S, Okada Y. New molecules indispensable for hyaluronan degradation, HYBID (CEMIP/KIAA1199) and TMEM2 (CEMIP2): differential roles in physiological and pathological non-neoplastic conditions. Proc. Jpn. Acad., Ser. B, Phys. Biol. Sci., 101, 317–338 (2025).
• 46)  Sato S, Miyazaki M, Fukuda S, Mizutani Y, Mizukami Y, Higashiyama S, Inoue S. Human TMEM2 is not a catalytic hyaluronidase, but a regulator of hyaluronan metabolism via HYBID (KIAA1199/CEMIP) and HAS2 expression. J. Biol. Chem., 299, 104826 (2023).