2025 Volume 48 Issue 8 Pages 1199-1206
Caco-2 cells, derived from colorectal cancer cells, are generally used to evaluate drug absorption in the gastrointestinal tract. However, differences between Caco-2 and normal intestinal cells have been observed. Cells cultured directly from crypts are maintained in their biological state. Therefore, we developed a rapid and easy method of monolayer culture of epithelial cells isolated from the jejunum of mice. We analyzed the usefulness of the jejunal epithelial cell monolayer culture system as a research tool and evaluated changes in the transport activity and mRNA expression of transporters. We focused on P-glycoprotein (P-gp) and peptide transporter 1 (Pept1) as representative transporters expressed in the small intestine. A P-gp inhibitor significantly enhanced the accumulation of Rhodamine 123 (Rho123), a substrate of P-gp, indicating that the transport activity of P-gp could be evaluated. Uptake of glycylsarcosine, a Pept1 substrate, significantly decreased in the presence of the Pept1 inhibitor, indicating that the transport activity of Pept1 could be evaluated. Rho123 accumulation significantly decreased in the group treated with calcitriol, an inducer of P-gp and Cyp3a11, suggesting that changes in P-gp expression could be evaluated. Furthermore, we examined whether mRNA expression levels of transporters and drug-metabolizing enzyme were altered. In the calcitriol-supplemented group, P-gp and Cyp3a11 mRNA levels significantly increased. However, no significant differences were observed in Pept1 mRNA levels. Overall, the jejunal epithelial cell monolayer culture system developed from intestinal tissues is a useful research tool for assessing the transport activities and expression variabilities of transporters.
The intestine is a major organ, and the digestion and absorption of nutrients occur mainly in the small intestine. Caco-2 cells are generally used to evaluate drug absorption in the gastrointestinal tract. However, problems with these cells include the fact that a) Caco-2 cells are derived from colorectal cancer cells, and thus, these cells are fundamentally different from normal intestinal cells, and b) few methods have been developed to examine the cells and tissues when cells other than absorptive epithelial cells are mixed and maintained under physiological conditions.1) Seithel et al. and Nakamura et al. reported that the expression levels of certain metabolic enzymes and transporter subtypes, such as CYP3A and peptide transporter 1 (PEPT1), were much lower in Caco-2 cells than those in the human small intestine.2,3)
Recently, organoids isolated and cultured from normal tissues have attracted attention as possible solutions to these problems.4) Since organoids functionally resemble in vivo organs and do not resemble conventional cultured cells, they have been applied not only in basic research but also in drug discovery research to elucidate the pathogenesis of diseases and drug efficacy, toxicity, and pharmacokinetics.5–8) Enteroids developed from crypts isolated from the small intestine have been used to analyze the secretory mechanisms and physiological functions of substances in the digestive tract.9) An enteroid is a closed system with the intestinal lumen on the inside and intestinal blood on the outside. An experimental system was established to evaluate mass transport in the efflux direction using enteroids maintained under conditions resembling those of the living body.10) However, problems associated with the direction of uptake were observed, such as the need to inject the drug solution into the lumen and the difficulty of performing a detailed quantitative analysis of drug permeation through the epithelial cell layer; therefore, advanced techniques are required to solve these problems. One method to solve this problem is the use of organoid monolayer culture systems. By fragmenting the organoids and growing them as an epithelial monolayer, quantitative evaluation can be performed in a manner similar to that of a cultured cell system. Organoid monolayer cultures achieve homeostasis through balanced growth, differentiation, and apoptosis.11) However, the disadvantage is that at least 2 weeks are required to use the system as an experimental system because of the use of passaged organoids. Therefore, the purpose of this study was to culture jejunal epithelial cells isolated from intestinal tissues, demonstrate the usefulness of the jejunal epithelial cell monolayer culture system as a research tool, and evaluate changes in the transport activity and mRNA expression of transporters.
Rhodamine 123 (Rho123), verapamil hydrochloride, glycylsarcosine (Gly-Sar), and Y-27632 dihydrochloride were purchased from Sigma-Aldrich (MO, U.S.A.). Quinidine sulfate was obtained from AstraZeneca K.K. (Osaka, Japan). Cyclosporin A (CsA) and valacyclovir hydrochloride were purchased from Toronto Research Chemicals, Inc. (ON, Canada). [3H]-Gly-Sar (0.2 Ci/mmol) was obtained from Moravek Biochemicals Inc. (CA, U.S.A.). Captopril was purchased from Daiichi Sankyo Co., Ltd. (Tokyo, Japan). Antipyrine, cephalexin, dimethyl sulfoxide (DMSO), and calcitriol were obtained from FUJIFILM Wako Pure Chemical Corporation (Osaka, Japan). Penicillin G potassium salt and streptomycin sulfate were purchased from Tokyo Chemical Industry Co., Ltd. (Tokyo, Japan) and FUJIFILM Wako Pure Chemical Corporation, respectively.
AnimalsSix-week-old male C57BL/6J mice were obtained from CLEA Japan Inc. (Tokyo, Japan). The rearing environment was adjusted to the appropriate temperature, humidity, and lighting conditions.10) All mice were provided with standard mouse feed and water ad libitum. The experiments were approved by the Hokkaido University Animal Care Committee (Approval No.: 23-0092) and were conducted using 7 to 13-week-old mice.
Establishment of Jejunal Epithelial Cell Monolayer Culture SystemTo maximize seeding efficiency, 96-well plates (Corning Inc., NY, U.S.A.) were coated with 100 μL of 2% (v/v) Matrigel (Cat. No. 356231; Corning Inc.) in phosphate-buffered saline (PBS; 154 mM NaCl, 2.97 mM Na2HPO4, and 1.06 mM KH2PO4) for 1 h at 37°C.12,13) Crypts were isolated using a previously described procedure with some modifications.5,14,15) Briefly, tissue removed by abrasion from the mucosa of the jejunum of mouse (6–12 cm downstream from the gastropyloric pylorus) was shaken in ice-cold Hanks’ balanced salt solution (HBSS; 136.9 mM NaCl, 25 mM d-glucose, 5.37 mM KCl, 441 μM KH2PO4, 338.1 μM Na2HPO4, and 10 mM N-(2-hydroxyethyl)piperazine-N'-2-ethanesulfonic acid (HEPES)) to obtain the crypts. The obtained crypts were treated with 1.8 mL of ice-cold Dulbecco’s modified Eagle medium (DMEM)/F12 containing 15 mM HEPES (STEMCELL Technologies, Inc. Inc., BC, Canada), and the pellet was washed by inverted agitation and then centrifuged (440 × g; 4 min; 4°C). The supernatant was aspirated; 1 mL of trypsin (Thermo Fisher Scientific, MA, U.S.A.), diluted in 0.68 mM ethylenediaminetetraacetic acid-containing PBS, was added to the supernatant to achieve a concentration of 0.05% trypsin; the mixture was gently pipetted 10 times and incubated at 37°C for 5 min. The cells were crushed by gentle pipetting 20 times; next, 1 mL of ice-cold DMEM/F12 containing 15 mM HEPES was added and mixed by inversion. Subsequently, 2 mL of the suspension was passed through a 40-μm cell strainer (Corning Inc.) and rinsed once with 500 μL of DMEM/F12 containing 15 mM HEPES. After centrifugation (440 × g; 4 min; 4°C) and removal of the supernatant, the medium was added and seeded at 6.25 × 105 cells/cm2.12,13,16) Cells were incubated at 37°C in an atmosphere of 5% CO2/95% air. The medium was changed every 2 d, and 3-d-old cultures were used for the experiments. The medium was prepared by mixing equal volumes of IntestiCulTM Organoid Growth Medium human basal medium and the supplied Organoid Supplement (STEMCELL Technologies, Inc.) with 100 units/mL of penicillin/100 μg/mL streptomycin and 10 μM of Y-27632.13,17–19) The monolayer of mouse jejunal epithelial cells was prepared by mixing the crypts from one or two mice. Monolayers were prepared for each experiment without passaging. To examine whether changes in mRNA levels could be evaluated using the mouse jejunal epithelial cell monolayer, the P-gp-inducer calcitriol was added to the cells. Calcitriol was dissolved in DMSO to prepare a stock solution and then diluted in medium to 100 nM (0.1% final DMSO concentration). Calcitriol was added at the time of medium change on day 2 of culture and incubated for 24 h before use in uptake assays and real-time PCR analysis.
ImmunostainingCell suspensions were seeded at 6.25 × 105 cells/cm2 in 12-well plates (Corning Inc.) lined with 18-mm round cover glass (AS ONE Corporation, Osaka, Japan), coated with 2% Matrigel, and incubated until confluence. After washing with PBS, the cells were fixed by adding 1 mL/well of 4% paraformaldehyde (FUJIFILM Wako Pure Chemical Corporation) and allowed to stand for 10 min at room temperature. Triton X-100 solution (FUJIFILM Wako Pure Chemical Corporation) was added at a concentration of 1 mL/well, and the cells were incubated at room temperature for 20 min for permeabilization. The cells were washed with PBS, 1 mL/well of 1% bovine serum albumin in PBS solution (Sigma-Aldrich) was added, and the cells were incubated at room temperature for 30 min for blocking. Subsequently, 1 mL/well of anti-villin, anti-chromogranin A (CHGA), anti-lysozyme C (LYZ), or anti-mucin 2 (MUC2; Santa Cruz Biotechnology, Inc., TX, U.S.A.) was added as the primary antibody solution and the suspension was allowed to stand overnight at 4°C, shielded from light. The following day, after incubation at room temperature for 10 min, the primary antibody solution was aspirated, and the cells were washed with PBS. One milliliter of secondary antibody solution (Alexa FluorTM 488 goat anti-mouse immunoglobulin G (IgG); Thermo Fisher Scientific) and 4′,6-diamidino-2-phenylindole (DAPI; NACALAI TESQUE, Inc., Kyoto, Japan) were added to each well, and the mixture was allowed to stand at room temperature for 60 min. After washing with PBS, the cover glass was removed from the well and placed on a glass slide with the cell surface down; the glass slide was sealed with 30 μL of VECTASHIELD HardSet Mounting Medium (Vector Laboratories, Inc., CA, U.S.A.). Stained images were obtained using a fluorescence microscope (BZ-X800; KEYENCE Corporation, Osaka, Japan).
Western Blotting AssayCytoplasmic and membrane fractions were extracted from a monolayer of mouse jejunal epithelial cells cultured for 3 d using a Subcellular Protein Fractionation Kit for Cultured Cells (Thermo Fisher Scientific). Equal amounts of protein were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transferred onto polyvinylidene di-fluoride membranes (Cytiva, Tokyo, Japan). The membranes were blocked with 5% skim milk in Tris-buffered saline containing Tween 20 (TBS-T; 20 mM Tris, 100 mM NaCl, 0.1% Tween 20) for 1 h at room temperature. The membranes were then exposed to an anti-P-gp antibody (sc-55510) or anti-Pept1 antibody (sc-20653) (Santa Cruz Biotechnology, Inc.) at 4°C overnight. The membranes were washed with TBS-T, incubated for 1 h at room temperature with peroxidase-labeled goat anti-mouse IgG antibody (5450–0011, SeraCare Life Sciences, Inc., MA, U.S.A.) or goat anti-rabbit IgG antibody (sc-2004, Santa Cruz Biotechnology, Inc.). After washing, the membranes were incubated with ImmunoStar Zeta (FUJIFILM Wako Pure Chemical Corporation) and the luminescence of the bands was detected using a ChemiDoc XRS+ (Bio-Rad Laboratories, Inc., CA, U.S.A.).
Uptake Assay for Analysis of Transporter ActivityRho123 was used as a substrate for P-glycoprotein (P-gp). CsA, quinidine, and verapamil were used as inhibitors. Antipyrine was used as the negative control. Gly-Sar was used as a substrate for Pept1, and high concentrations of Gly-Sar, captopril, cephalexin, and valacyclovir were added as its inhibitors. To analyze the transport activity of P-gp, a transporter acting in the efflux direction, the cells were washed in DMEM/F12 containing 15 mM HEPES. The cells were subsequently incubated in 20 μM Rho123 alone or 20 μM Rho123 containing 20 μM CsA, quinidine, verapamil, and antipyrine with DMEM/F12 and 15 mM HEPES at 37°C for 60 min. To stop the uptake reaction, cells were washed twice with ice-cold DMEM/F12 containing 15 mM HEPES. Cells were lysed in 0.1 n NaOH, and the intracellular accumulation of Rho123 was examined. The fluorescence intensity was measured using an Infinite 200 PRO M Plex (Tecan Japan Co., Ltd., Kanagawa, Japan) at excitation and emission wavelengths of 488 and 530 nm, respectively. Pept1 is a transporter responsible for transport in the uptake direction. To analyze the transport activity of Pept1, cells were washed in transport buffer (25 mM 2-[N-morpholino]ethanesulfonic acid [MES], 140 mM NaCl, 5.4 mM KCl, 1.8 mM CaCl2, 0.8 mM MgSO4, and 5 mM glucose; pH 6). Next, 5 μM [3H]-Gly-Sar alone or 5 μM [3H]-Gly-Sar containing 20 mM Gly-Sar, 20 mM captopril, 20 mM cephalexin, and 10 mM valacyclovir in transport buffer was added, and the mixture was incubated at 37°C for 60 min. To stop the uptake reaction, cells were washed twice with ice-cold transport buffer. Cells were lysed in 0.2 n NaOH containing 1% sodium dodecyl sulfate. The radioactivity in the cell lysate was measured using a liquid scintillation counter (AccuFLEX LSC-8000, Raytek, Tokyo, Japan).
Real-Time PCR AnalysisTotal RNA was isolated from the monolayer of mouse jejunal epithelial cells seeded on 24-well plates (Corning Inc.) using RNAiso Plus (TaKaRa Bio Inc., Shiga, Japan). cDNA was synthesized using the ReverTra Ace qPCR RT Master Mix with gDNA remover (TOYOBO Co., Ltd., Osaka, Japan) according to the manufacturer’s instructions. The mRNA expression levels of multidrug resistance protein 1 (Mdr1), multidrug resistance-associated protein 2 (Mrp2), breast cancer resistance protein (Bcrp), organic cation/carnitine transporter 2 (Octn2), Pept1, and Cyp3a11 were determined by qPCR using TB Green Premix Ex Taq II (Tli RNase H Plus; TaKaRa Bio Inc.). The mRNA levels were normalized to those of glyceraldehyde-3-phosphate dehydrogenase (Gapdh). Sequences of the primers used for amplification of the genes of interest are listed in Table 1.
| Target gene | GenBank accession number | Forward primer sequence (5′→3′) | Reverse primer sequence (5′→3′) |
|---|---|---|---|
| Mdr1a | NM_011076.3 | GGGCACAAACCAGACAACAT | TCCGCTCTTCACCTTCAGAT |
| Mrp2 | AY905402.1 | AGGGTCTGGGCTTGATTCTT | CCTGTGTCTTCTGAGCACCA |
| Bcrp | NM_011920.3 | TGAGGCCTGACAGTTCTCCT | CATCCAGGAAGAGGATGGAA |
| Octn2 | AB015800 | CCACTCACCACCTCCTTGTT | CTGTTCCCAGGACAAATGCT |
| Pept1 | NM_053079.2 | GCCGGACCAGATGCAGACGG | GCGGGTACACCACAGCGTCC |
| Cyp3a11 | NM_007818 | AGCATTGAGGAGGATCACACAC | TACGAGTCCCATATCGGTAGAG |
| Gapdh | NM_001289726.2 | AGGTCGGTGTGAACGGATTTG | TGTAGACCATGTAGTTGAGGTCA |
Mdr1a: multidrug resistance protein 1a; Mrp2: multidrug resistance-associated protein 2; Bcrp: breast cancer resistance protein; Octn2: organic cation/carnitine transporter 2; Pept1: peptide transporter 1; Gapdh: glyceraldehyde-3-phosphate dehydrogenase.
The results are expressed as means with standard deviations (S.D.s). Student’s t-test was used to determine the significance of the difference in means between results for two groups. One-way ANOVA, followed by Dunnett’s test, was used for comparisons between the means of results for three or more groups. Statistical significance was set at p < 0.05.
The culture conditions in the monolayer culture system of jejunal epithelial cells were examined. The seeding density varied from 4.8 × 104 to 9.6 × 105 cells/cm2, and the cells were incubated for 2–4 d. The plates were coated with type I collagen, which is commonly used in the culture of epithelial cells, and trypsin-treated crypts were seeded at 1 × 105 cells/cm2 as reported by Altay et al.20) Cell growth was not observed under these culture conditions, and parts of the cells were detached, which resulted in no confluence even on the sixth day of culture (data not shown). The same experiment was conducted at 2 × 105 cells/cm2; however, no improvement was observed (Fig. 1A). Therefore, following the method described in a previous report,15) the plates were coated with Matrigel and seeded at 2 × 105 cells/cm2. Cell detachment reduced when the plates were coated with type I collagen. However, the cells were not confluent even on day 6 of culture, and no cell proliferation was observed (data not shown). However, when the plates were coated with Matrigel and seeded at 6.25 × 105 cells/cm2, nearly confluent monolayers were observed after 3 days of culture (Fig. 1B). In subsequent experiments, monolayers were coated with Matrigel and cultured at 6.25 × 105 cells/cm2. A fluorescence microscope was used to capture images of the jejunal epithelial cell monolayers. The cells showed a paved stone-like structure of uniform size (Fig. 1B).
Image of mouse jejunal epithelial cell monolayer developed from crypts. A: Plates were coated with collagen, seeded at 2 × 105 cells/cm2, and incubated for two days. B: Plates were coated with Matrigel, seeded at 6.25 × 105 cells/cm2 and incubated for 3 d. Scale bar: 100 μm.
Immunostaining was performed to confirm the presence of differentiated cells in the mouse jejunal epithelial cell monolayer. The cells comprised absorptive epithelial cells (villin), endocrine cells (CHGA), Paneth cells (LYZ), and goblet cells (MUC2) (Figs. 2A–2D). The expression level of villin was the highest. This result suggested that the monolayer of mouse jejunal epithelial cells was a suitable culture system containing epithelial and differentiated cells from the mouse jejunum.
Representative fluorescence microscopic images of a monolayer of mouse jejunal epithelial cells stained with epithelial and differentiated cell markers: anti-villin (A), anti-chromogranin A (CHGA) (B), anti-lysozyme C (LYZ) (C), and anti-mucin 2 (MUC2) (D). Images were merged with those obtained after nuclear blue staining. Images were acquired 3 d after preparation of samples. Scale bar: 50 μm.
Western blotting was performed to confirm the membrane localization of P-gp and Pept1 in the mouse jejunal epithelial cell monolayers for 3 d. Bands at around 170 kDa for P-gp and 75 kDa for Pept1 were mainly detected in the membrane fractions, suggesting that P-gp and Pept1 levels are very low in the cytoplasm and that these proteins localized at the membrane (Fig. 3). Based on these results, P-gp and Pept1 are localized at the membrane of mouse jejunal epithelial cell monolayers.
We prepared cytoplasmic fractions (1) and membrane fractions (2) from a monolayer of mouse jejunal epithelial cells cultured for 3 d. Western blotting was performed using anti-P-gp (170 kDa) and anti-Pept1 (75 kDa) antibodies.
We investigated transport activity using mouse jejunal epithelial cell monolayers prepared in this study. We focused on the expression of P-gp and Pept1 in the small intestine. Under the conditions described above, Rho123 and Gly-Sar uptake was linear for up to 1 h (data not shown). We analyzed the transport activity of P-gp using Rho123, a P-gp substrate. Rho123 was taken up by the cells via passive diffusion, and accumulation of Rho123 after it was expelled by P-gp was examined. Compared with that observed in the presence of the control, the accumulation of Rho123 significantly increased in the presence of P-gp inhibitors (20 μM Rho123 containing 20 μM CsA, quinidine, and verapamil), indicating that these inhibited efflux by P-gp (Fig. 4). By contrast, no increase in Rho123 accumulation was observed when antipyrine was used as the negative control. The results suggested that the transport activity of P-gp could be evaluated using mouse jejunal epithelial cell monolayers.
The reagents were added to the monolayer of mouse jejunal epithelial cells, and the monolayer cells were incubated for 60 min at 37°C. Control: 20 μM Rho123; P-gp inhibitors: 20 μM Rho123 containing 20 μM cyclosporin A (CsA), 20 μM quinidine, and 20 μM verapamil; negative control: 20 μM antipyrine. n = 4; mean ± standard deviation (S.D.); *p < 0.05 by Dunnett’s test.
Next, we analyzed the transport activity of Pept1 using Gly-Sar, a Pept1 substrate, using mouse jejunal epithelial cell monolayers. Gly-Sar uptake significantly reduced in the presence of 5 μM [3H]-Gly-Sar containing 20 mM Gly-Sar, 20 mM captopril, and 20 mM cephalexin and 10 mM valacyclovir as Pept1 inhibitors compared with that in the control (Fig. 5). The results showed that the transport activity of Pept1 could be evaluated using the monolayer of mouse jejunal epithelial cells.
The reagents were added to the monolayer of mouse jejunal epithelial cells, and the monolayer cells were incubated for 60 min at 37°C. Control: 5 μM [3H]-Gly-Sar; Pept1 inhibitors: 5 μM [3H]-Gly-Sar containing 20 mM Gly-Sar, 20 mM captopril, 20 mM cephalexin, and 10 mM valacyclovir. n = 4; mean ± S.D.; *p < 0.05 by Dunnett’s test.
Since the transport activity of P-gp could be analyzed using the prepared monolayers, the effect of P-gp transport activity was examined using calcitriol, an inducer of P-gp. In the control group, calcitriol significantly reduced the accumulation of Rho123 compared with that in the vehicle group (Fig. 6). Therefore, calcitriol clearly induced P-gp in the control group. In the group treated with 20 μM Rho123 containing 20 μM CsA, calcitriol significantly reduced the accumulation of Rho123 compared with that in the vehicle group. In addition, P-gp activity was partially inhibited in the presence of 20 μM CsA. The results showed that calcitriol reduced the uptake of Rho123 in the monolayer of mouse jejunal epithelial cells.
The reagents were added to the monolayer of mouse jejunal epithelial cells, and the monolayer cells were incubated for 24 h at 37°C and 5% CO2. Vehicle: 0.1% dimethyl sulfoxide (DMSO); P-gp inducer: 100 nM calcitriol. Subsequently, the cells were incubated for 60 min in the presence of 20 μM Rho123 alone or 20 μM Rho123 containing 20 μM CsA. n = 4; mean ± S.D.; **p < 0.01 by Student’s t-test versus respective control.
Gene expression levels in the mouse jejunal epithelial cell monolayer and jejunal tissue were compared using real-time PCR. No significant changes in expression levels of any of the transporters or metabolic enzyme analyzed in this study were observed between the mouse jejunal epithelial cell monolayer and jejunal tissue (Fig. 7). In addition, the expression levels of all analyzed genes except for Mrp2 tended to be lower in the monolayer than in the tissue; Mrp2 levels were similar in the monolayer and tissue.
Gene expression levels of the efflux-directed transporters multidrug resistance protein 1 (Mdr1), multidrug resistance-associated protein 2 (Mrp2), and breast cancer resistance protein (Bcrp), absorption-directed transporters organic cation/carnitine transporter 2 (Octn2) and Pept1, and drug-metabolizing enzyme Cyp3a11 in mouse jejunal epithelial cell monolayers and jejunal tissues were compared using real-time PCR analysis. The expression levels of the analyzed genes were standardized based on glyceraldehyde-3-phosphate dehydrogenase (Gapdh) levels and expressed relative to the mRNA expression level in the jejunal tissue as 1. Total RNA was extracted, and qPCR analysis was performed. n = 3; mean ± S.D.
We examined whether the mRNA expression levels of transporters and metabolic enzyme were altered by calcitriol-induced expression of Mdr1 and Cyp3a11, equivalent to that observed for human CYP3A4, in the mouse jejunal epithelial cell monolayer. Mdr1 levels significantly increased in the presence of calcitriol compared with that in the control (Fig. 8A). By contrast, no significant differences were observed in Pept1 expression levels between the calcitriol-treated and control groups. Furthermore, Cyp3a11 levels significantly increased in cells treated with calcitriol compared with that in the control (Fig. 8B).
The reagents were added to the monolayer of mouse jejunal epithelial cells, and the monolayer cells were incubated for 24 h at 37°C and 5% CO2. Control: 0.1% DMSO; P-gp and Cyp3a11 inducers: 100 nM calcitriol (A: transporters; B: drug-metabolizing enzyme). Total RNA was extracted, and qPCR analysis was performed. n = 3; mean ± S.D.; *p < 0.05 and **p < 0.01 by Student’s t-test versus respective controls.
To demonstrate the usefulness of the jejunal epithelial cell monolayer culture system as a research tool, jejunal epithelial cells were cultured in a monolayer using cells isolated from mouse intestinal crypts.
The cells were seeded onto Matrigel-coated plates at a density of 6.25 × 105 cells/cm2, and the cells reached confluence on days 2 and 3 of culture, indicating that Matrigel is more appropriate as a coating for monolayer culture systems than collagen; moreover, the initial seeding density is important to achieve cell confluency, because a higher seeding density than that of normal cultured cells, such as Caco-2 cells, is required. In human duodenal organoid-derived monolayer cells, the expression of some pharmacokinetics-related genes is upregulated on day 3 of culture, and the upregulation is maintained for several days thereafter.12) Therefore, subsequent experiments were performed after 3 d of culture. Based on the above-mentioned observations, we investigated the optimal coating, seeding density, and number of days of culture, and succeeded in developing a jejunal epithelial cell monolayer culture system from mouse jejunal crypts (Fig. 1B). However, in our model, the cells tended to detach on day 5 of the culture; this cell detachment was faster than that observed using an enteroid-derived monolayer. In previous studies,12) cell adhesion efficiency was observed to change depending on the intestinal site of origin and culture conditions. Therefore, although the jejunum was used in this study, cells obtained from other sites will be used for further investigation. In the present study, changes in mRNA levels were examined in the presence of calcitriol, which has been reported to induce the expression of P-gp and Cyp3a11, the human equivalent of CYP3A4.21,22) For short-term stimulation, our model of monolayer culture from crypts with a short culture period was useful. However, use of an organoid-derived monolayer may be preferable for a longer stimulation period.
The transport activity of organoid-derived monolayers or monolayer cultures directly derived from crypts has been quantitatively evaluated in few studies. In our model, the efflux transporter P-gp and uptake transporter Pept1 localized at the membrane (Fig. 3), and their transport activity was quantitatively evaluated. We observed that Rho123, a substrate of P-gp, accumulated intracellularly, and its accumulation increased in the presence of P-gp inhibitors (Fig. 4). Among the inhibitors used in this study, CsA showed the highest magnitude of inhibition, which is consistent with that mentioned in previous reports.23) Cellular uptake of Gly-Sar, a substrate of Pept1, was also observed; Gly-Sar uptake was inhibited by Pept1 inhibitors (Fig. 5). The inhibitory effects of the analyzed inhibitors were in the order of cephalexin > valacyclovir > captopril > Gly-Sar, which is in general agreement with the findings of a previous study.24) These results indicated that the transport activities of P-gp and Pept1 could be quantitatively evaluated using the monolayer model.
In mice, P-gp expression has been reported to increase in the order of duodenum < jejunum < ileum,25) Pept1 expression increases in the order of colon < duodenum < ileum < jejunum,24) and Cyp3a11 shows high expression levels in the duodenum and jejunum.26) The mRNA expression levels were confirmed by real-time PCR using tissues removed by abrasion of the mucosa of various parts of the mouse intestine. The order of expression of transporters and metabolic enzyme was consistent with that mentioned in previous reports (data not shown).24–26) No significant changes in the expression levels of P-gp, Pept1, and Cyp3a11 were observed between mouse jejunal epithelial cell monolayers and jejunal tissues (Fig. 7). Thus, the expression levels of transporters and metabolic enzyme in the monolayer culture system were similar to those observed in normal tissues.
Inui et al. established an intestinal organoid-mediated monolayer of human-induced pluripotent stem (iPS) cell-derived small intestinal epithelial cells. In this monolayer, gene expression in absorptive epithelial cells (villin), endocrine cells (CHGA), Paneth cells (LYZ), and goblet cells (MUC2) was observed,27) and similar expression levels were observed using our model (Fig. 2). In addition, the mRNA levels of MDR1, villin, MUC2, and LYZ in the monolayer produced by Inui et al. were similar to those in the small intestine, whereas the mRNA levels of BCRP, PEPT1, and CYP3A4 were lower than those in the small intestine.27) In our monolayer, the mRNA levels of Mdr1, Bcrp, Pept1, and Cyp3a11 were similar to those in the intestinal tissues (Fig. 7). Furthermore, the monolayers prepared by Inui et al. took more than 1 month to develop, and human samples were difficult to obtain.27) By contrast, our monolayers were prepared from mice and required only 3 d of incubation; therefore, our model may be more useful than that of Inui et al. for conducting studies where a simplified model is required for examination.
Calcitriol is known to interact by binding to the vitamin D receptor (VDR).28,29) VDR binds to the retinoid X receptor (RXR) to form a heterodimer (VDR/RXR); its interaction with the vitamin D response element (VDRE) stimulates gene transcription, and the transcribed genes are subsequently translated into specific proteins. In some cells, calcitriol induces the expression of P-gp and Cyp3a11.21,22) However, to the best of our knowledge, induction of Pept1 expression has not been reported. In human brain capillary endothelial hCMEC/D3 cells, P-gp mRNA levels increased by 1.6-fold after calcitriol treatment.30) Calcitriol enhanced P-gp mRNA levels by 2-fold and CYP3A4 mRNA levels by approximately 200-fold, but did not increase PEPT1 levels in Caco-2 cells.21) By contrast, calcitriol increased Cyp3a11 mRNA levels by 15.3-fold in primary cultured hepatocytes derived from pregnane X receptor (PXR)/constitutive androstane receptor (CAR) double-knockout mice.22) In our model, the mRNA levels of P-gp and Cyp3a11 increased by 1.41- and 14.7-fold, respectively, whereas no increase in Pept1 levels was observed (Fig. 8). Thus, our monolayer culture system is a suitable model for evaluating changes in the expression levels of transporters and drug-metabolizing enzyme. In our model, the increase in expression levels of P-gp following calcitriol treatment was confirmed by the amount of uptake of Rho123 (Fig. 6). Furthermore, our results demonstrated that 20 μM CsA only partially inhibited P-gp transport activity when P-gp expression was elevated.
These results are expected to lead to a simplification of uptake assays, because uptake is difficult to evaluate in 3D cultures; our model will also reduce costs by shortening the incubation period. These results may be useful for elucidating the mechanism of drug absorption and analyzing the effects (interactions) of other drugs and food components on drug absorption. In conclusion, the jejunal epithelial cell monolayer culture system developed from mouse intestinal crypts is a useful research tool for evaluating the transport activity and expression variability of transporters.
The authors declare no conflict of interest.
