Molecular Mechanisms Underlying Urate-Induced Enhancement of Kv1.5 Channel Expression in HL-1 Atrial Myocytes

Abstract

Background: Hyperuricemia induces endothelial dysfunction, oxidative stress and inflammation, increasing cardiovascular morbidities. It also raises the incidence of atrial fibrillation; however, underlying mechanisms are unknown.

Methods and Results: The effects of urate on expression of Kv1.5 in cultured mouse atrial myocytes (HL-1 cells) using reverse transcriptase-PCR, immunoblots, flow cytometry and patch-clamp experiments were studied. Treatment with urate at 7 mg/dl for 24 h increased the Kv1.5 protein level, enhanced ultra-rapid delayed-rectifier K⁺ channel currents and shortened action potential duration in HL-1 cells. HL-1 cells expressed the influx uric acid transporter (UAT), URATv1, and the efflux UATs, ABCG2 and MRP4. An inhibitor against URATv1, benzbromarone, abolished the urate effects, whereas an inhibitor against ABCG2, KO143, augmented them. Flow cytometry showed that urate induced an increase in reactive oxygen species, which was abolished by the antioxidant, N-acetylcysteine (NAC), and the NADPH-oxidase inhibitor, apocynin. Both NAC and apocynin abolished the enhancing effects of urate on Kv1.5 expression. A urate-induced increase in the Kv1.5 proteins was accompanied by phosphorylation of extracellular signal-regulated kinase (ERK), and was abolished by an ERK inhibitor, PD98059. NAC abolished phosphorylation of ERK by urate.

Conclusions: Intracellular urate taken up by UATs enhanced Kv1.5 protein expression and function in HL-1 atrial myocytes, which could be attributable to ERK phosphorylation and oxidative stress derived from nicotinamide adenine dinucleotide phosphate (NADPH)-oxidase. (Circ J 2015; 79: 2659–2668)

Compared to other mammals whose serum urate levels are 0.5–1 mg/dl or less, humans have a higher serum urate level due to loss of uricase activity.¹ Hyperuricemia, defined as a condition with the serum urate level exceeding 6.8 mg/dl, is a risk factor for gout, kidney stone and renal failure.^2,3 Recently, the guideline in Japan has indicated that hyperuricemia is defined as the serum urate level of more than 7 mg/dl.⁴ It is caused by an imbalance between urate synthesis and its renal excretion; the predominant cause is reduced excretion due to altered expression of uric acid transporters (UATs) in the kidney. UATs in renal proximal tubular cells play a pivotal role in the regulation of serum urate levels.^5,6

Hyperuricemia has been reported to be associated with various kinds of diseases such as hypertension, metabolic syndromes, diabetes mellitus, as well as chronic kidney disease.^5,7–9 It increases oxidative stress, endothelial dysfunction and inflammation, thereby increasing cardiovascular morbidity and mortality.^7,8 Two possible mechanisms have been proposed for hyperuricemia-related cardiovascular dysfunction: (1) xanthine oxidase causes oxidative stress; and (2) urate induces vascular smooth muscle cell proliferation, decreases nitric oxide production and activates the renin-angiotensin system.^10–13 UATs (eg, URAT1) are expressed not only in renal tubular cells, but also in vascular smooth muscle cells, endothelial cells, adipocytes and pancreatic β-cells.^5,14–16 Thus, intracellular accumulation of urate via activation of UATs could cause systemic cell damage through several signaling pathways.^13,15,17

Several clinical studies have reported a strong association between hyperuricemia and the incidence of atrial fibrillation (AF) in patients with hypertension,¹⁸ type 2 diabetes mellitus,¹⁹ and/or cardiovascular diseases²⁰ such as chronic heart failure,²¹ ischemic heart failure,²² and cardiac events.²³ Another cohort study reported that hyperuricemia was associated with the development of AF, indicating that the serum urate level is a predictor for comorbidity with AF.²⁴ High levels of serum urate correlated with not only recurrence of paroxysmal AF after catheter ablation,²⁵ but also permanent AF,²⁶ and increased risk of left atrial thrombus as well as thromboembolic risk on transesophageal echocardiography in patients with non-valvular AF.^27,28 Suzuki et al recently reported that serum urate could be a marker or an independent risk factor for AF in patients with cardiovascular diseases.²⁰ These reports indicate that the measurement of the serum urate level could be useful in predictions of the onset and prognosis in AF patients,²³ and the control of the serum urate level might be a therapeutic approach for AF. Despite these correlations, however, the mechanisms underlying the occurrence of AF in hyperuricemia patients remains unknown.

AF is triggered by ectopic activity in the atrium or pulmonary vein and is sustained by reentry that is characterized by shortening of the effective refractory period (ERP), unidirectional conduction block and slow conduction.²⁹ Electrical properties of atrial myocytes in AF depend on electrical remodeling, namely, altered expressions of atrial ion channels.³⁰ Shortening of the atrial action potential duration (APD) shortens ERP, which plays an important role in the initiation and sustainment of AF.³⁰ Both rate and rhythm control are essential in AF management, however, their application must be considered wisely due to serious adverse effects and limited long-term efficacy.³¹

Kv1.5 channels (voltage-gated potassium channel, shaker-related subfamily, member 5), encoded by the KCNA5 gene, confer the ultra-rapid delayed-rectifier potassium channel currents (I_Kur) that strongly influence APD. It is more abundantly expressed in the human atrium than in the ventricle.³² The increases in mRNA and protein levels of Kv1.5 channels contribute to the shortening of atrial APD, causing electrical remodeling with atrial APD shortening in AF; therefore, inhibition of Kv1.5 channel expression may be one of the therapeutic approaches for AF.^33–35

HL-1 cells are cardiac muscle cells derived from the AT-1 mouse atrial cardiomyocyte tumor lineage. They are able to contract spontaneously, propagate with an apparently unlimited lifespan, and express the ion channels required for generating action potentials.^36,37 They have been used for studying Kv1.5 channels, as reported in several publications.^37,38

Taken together, we hypothesized that urate could enhance the expression of Kv1.5 in atrial myocytes. To verify this hypothesis, we studied the effects of urate on the expression and function of Kv1.5 channels using HL-1 cells, and explored subcellular mechanisms underlying the hyperuricemia-induced increase in AF incidence and alteration of Kv1.5 channels to facilitate AF occurrence.

Methods

Cell Culture

HL-1 cells were cultured in Claycomb medium supplemented with 10% Fetal bovine serum, 1% norepinephrine, 1% penicillin-streptomycin, and 1% L-glutamin, on dishes coated with 0.02% gelatin-fibronectin in an incubator at 37℃ with 5% CO₂, before being subjected to the assays.

Reagents

Urate (uric acid sodium salt) (Sigma Aldrich, St. Louis, MO, USA) was dissolved in 10 mmol/L NaOH. It was administered to cells at 60–70% confluence at the final concentration of 7 mg/dl. We also used the influx UAT (URATv1) inhibitor, benzbromarone, and efflux UAT (ABCG2) inhibitor, KO143 (Sigma Aldrich), antioxidant N-acetylcysteine (NAC) (Sigma Aldrich), NADPH-oxidase inhibitor, apocynin (Abcam Biochemicals), and an extracellular signal-regulated kinase (ERK) inhibitor, PD98059 (Sigma Aldrich).

mRNA Extraction and Reverse Transcriptase-PCR

Total RNA was extracted from HL-1 cells and mouse kidney using a RNeasy kit (Qiagen). cDNA was synthesized using PrimeScript with gDNA eraser (Takara Bio Inc, Kusatsu, Japan) according to the manufacturer’s protocol. PCR primers are listed in Table 1.

Table 1. Sequences of Mouse Uric Acid Tranporters’ cDNA Primers

No.	Transcript	Reference sequence	Product (bp)	Forward primer	Reverse primer
				Sequence 5’–3’	Sequence 5’–3’
1	URAT1	NM_009203.3	431	CAGTCCATCTTCCTGGCTGG	AGCTTGCCCACCGTGATGAG
2	URATv1	NM_001102414.1	576	GAGGAGGACAAAGAAATGGTCC	ATCACTCCGAACAGGTATGGC
3	ABCG2	NM_011920.3	496	CCTACAACAACCCTGCGGAT	ACTACGAACAGCTCCACAGC
4	NPT1	NM_009198.3	665	GATGTCCTTGCTCCTCCCAC	TGGTGAAGAGTTTCCGGACG
5	NPT4	NM_001164743.1	527	TCACACTGATGGCGCAGAAT	ACTAATGATGCCGCCCACAA
6	OAT1	NM_008766.3	331	ACCTTGTGTGCTCTCATCGG	AACTGGCCCAAGCTGTAGAC
7	OAT3	NM_031194.5	308	CTTCCGATTCCTGTGTGGCT	TAGCCACACGTTGGAGTGTC
8	MRP4	NM_001163676.1	426	CGTTAATTGAGGCACTCCGGT	GGTAGGAGCTGCCCAGAATC
9	MCT9	NM_025807.3	330	CCTTCCTAAAAGCCTCGCCA	CCCAAAAGAAGCTTGCCCAC

ABCG2, ATP-binding cassettes subfamily G second member 2 (also known as the human breast cancer resistance protein [BRCP]); bp, base pairs; MCT, monocarboxylate transporter; MRP, multidrug resistance protein; NPT, Na⁺/phosphate cotransporter; OAT, organic anion transporter; URAT, urate transporter.

Western Blot Analysis

Cells were collected in lysis buffer containing 0.01 M phosphate buffered saline (PBS), 1% nonidet P-40 (w/w), 0.5% sodium deoxycholate (w/v), 0.1% sodium dodecyl sulphate (w/v), 10 μg/ml aprotinin, 10 μg/ml leupeptine, 10 μg/ml pepstatin and 1 mmol/L phenylmethylsulfonyl fluoride, and were lysed by repeat pipetting. Insoluble materials were removed by centrifugation, and the protein concentration of the supernatant was determined by using the Bradford Protein Assay method. An aliquot of 10–15 μg protein was subjected to sodium dodecylsulfate poly-acrylamide gel electrophoresis and electrotransferred to a polyvinylidene fluoride membrane. After being blocked with 5% skim milk, membranes were probed with primary antibodies against Kv1.5 (1:400; Alomone Labs, Jerussalem, Israel), α-tubulin (1:5,000; Abcam, Tokyo, Japan), phosphorylated ERK (1:500; Cell-signaling Technology) or total ERK (1:1,000; Cell-signaling Technology). The secondary antibodies were either anti-rabbit IgG or anti-mouse IgG (1:3,000); both are horseradish-peroxidase-linked (GE-Healthcare Limited, Buckinghamshire, UK). The blots were developed using the enhanced chemiluminescence (ECL) system (Amersham Bioscience, Piscataway, NJ, USA). The band intensities were quantified using Image J version 1.42q software (NIH, Bethesda, MD, USA).

Assay of Reactive Oxygen Species (ROS) Level

HL-1 cells were treated with urate (7 mg/dl) alone, urate (7 mg/dl) with either NAC (10 mmol/L) or apocynin (1 mmol/L), or the solvent NaOH (10 mmol/L) as a control, washed with PBS, and incubated in the presence of 20µmol/L 2’,7’-Dichlorofluorescin diacetate (DCFH-DA) (Sigma Aldrich) for 30 min. Cells were then washed with PBS, trypsinized, resuspended in fluorescence-activated cell sorting (FACS) buffer, and analyzed by BD FACSAria^TM flowcytometry (BD Bioscience, San Jose, CA, USA).

Electrophysiological Recordings

After treatment with urate, Kv1.5 channel currents corresponding to I_Kur were measured. Outward membrane currents were elicited every 6 s by 300-ms test pulses ranging from –60 to +80 mV (in 10 mV increments) with a holding potential (HP) of –60 mV. A specific inhibitor of Kv1.5 channel currents, 4-aminopyridine (4-AP), at a dose of 100 µmol/L was used to isolate I_Kur. To eliminate the contamination by another outward current, rapidly activating delayed rectifier potassium channel current (I_Kr), the outward currents were recorded in the presence of 5 µmol/L E4031, which blocked I_Kr almost completely. Thus, the currents measured here were 4-AP-sensitive, E4031-insensitive currents. The extracellular solution contained (in mmol/L) 140 NaCl, 4 KCl, 1.8 CaCl₂, 0.53 MgCl₂, 0.33 NaH₂PO₄, 5.5 glucose, and 5 HEPES, with the pH adjusted to 7.4 by NaOH. The internal pipette solution contained (in mmol/L) 100 K-aspartate, 20 KCl, 1 CaCl₂, 5 Mg-ATP, 5 EGTA, 5 HEPES, and 5 creatine phosphate dipotassium (pH 7.2 with KOH). Patch pipettes had a resistance of 5–10 MΩ when filled with the pipette solution. Series resistance (R_s) was determined by fitting a single exponential function to the capacitive current decay to estimate its time constant and membrane capacitance. After the R_s compensation of 50–60%, the voltage errors arising from R_s were estimated to be less than 5 mV. The membrane potential was not corrected for the liquid junction potential, which was estimated to be <10 mV. Currents were recorded with an Axopatch-200B amplifier (Axon Instruments, Union City, CA, USA). The capacity-corrected data were digitally filtered at 2 kHz, then analyzed using pCLAMP9 software on the computer. Action potentials were measured in current-clamp mode, elicited at a rate of 0.5 Hz by 5-ms square current pulses of 1nA, and sampled at 20 kHz. All currents and AP measurements were conducted at 37℃.

Statistical Analysis

The data were presented as mean±SD, and the graphs were built using Excel 2013 for Windows. Data were checked for its distribution before further analysis. To analyze the difference between the 2 groups, the Student’s unpaired t-test was used. Analysis of variance (ANOVA) followed by Fisher’s Least Significant Difference (LSD) post-hoc test was used to assess the difference between multiple groups. A P value of <0.05 was considered significant. All of the statistical analyses were performed by using OriginPro 9.1.0 (OriginLab Corporation, Northampton, MA, USA).

Results

Urate Increased Kv1.5 Protein Levels and Enhanced I_Kur

Figure 1 shows the representative Western blot of Kv1.5 proteins expressed by HL-1 cells treated for 24 h with or without urate (7 mg/dl). The summarized data on the density of Kv1.5 proteins normalized to α-tubulin density confirmed that urate significantly increased the protein level of Kv1.5. To examine whether urate increases the activity of Kv1.5 channels on the cell surface, we measured I_Kur through Kv1.5 channels. Figure 2A shows original current traces of 4-AP-sensitive I_Kur in HL-1 cells treated with or without urate (7 mg/dl). Depolarizing test pulses elicited outward currents, which were almost completely blocked by 4-AP at 100µmol/L. As HL-1 cells were known to express another component of outward currents, I_Kr, we eliminated I_Kr contamination using the I_Kr inhibitor, E4031. Treatment with urate for 24 h increased the amplitude of I_Kur elicited by the depolarizing pulses from a HP of –60 mV. Urate did not influence the capacitive currents (35±3.2 pF in control, 36.7±3.0 pF with urate). Summary data of the voltage-dependent activation of I_Kur in HL-1 cells in the absence and presence of urate indicate that urate significantly augmented I_Kur in a potential range from –30 to +60 mV without affecting the threshold potential (Figure 2B). Urate did not affect the L-type calcium channel currents or protein level, as shown in Figures S1 and S2.

Figure 1.

Effects of urate on Kv1.5 protein levels in HL-1 cells. Protein expressions were analyzed by Western blotting using anti-Kv1.5 and anti-α-tubulin as an internal control. Representative Western blots (Left) and averaged densities of Kv1.5 proteins normalized to those of α-tubulin (Right) are shown. HL-1 cells were treated with urate at 7 mg/dl or urate’s solvent (10 mmol/L NaOH) as a control for 24 h. The relative density of Kv1.5 proteins in the urate-treated group is shown as a percentage to the control value (n=14; *P<0.05).

Figure 2.

Effects of urate on the Kv1.5 channel current, the ultra-rapid delayed rectifier potassium channel currents (I_Kur). (A) Patch clamp records of outward membrane currents elicited before (Left) and during (Middle) administration of 4-aminopyridine (4-AP; 100 µmol/L) in HL-1 cells treated with or without urate at 7 mg/dl. 4-AP-sensitive currents were determined by subtracting the current in the presence of 4-AP from that in the absence of the agent (Right). All current measurements were conducted in the presence of 5 µmol/L E4031, which eliminates rapid delayed-rectifier potassium channel currents (I_Kr). (B) Voltage-dependent activation of 4AP-sensitive currents recorded from the urate-treated (red circles) and control (blue circles) cells. Peak amplitudes of the outward currents were determined and plotted as functions of the test potentials. The currents from the urate-treated cells were significantly larger than those from the urate-untreated cells (*P<0.05).

Figure 3 shows the representative action potentials recorded from HL-1 cells treated with (black and blue) or without urate (red and green), and averaged APDs at 50% repolarization (APD₅₀) and 90% repolarization (APD₉₀). Urate significantly shortened APD₅₀ (32.83±6.51 ms in control, 17.74±5.85 ms with urate) and APD₉₀ (113.18±18.51 ms in control, 53.28±23.29 ms with urate) without changes in resting membrane potentials (–69.38±2.85 mV in control; –69.60±1.77 mV with urate). The details on action potential parameters are presented in Table 2. To ensure that the changes in APDs were specifically caused by the increase of I_Kur, we also compared APDs in the control and urate groups in the absence and presence of 4-AP. The results showed that after addition of 4-AP, the APDs in urate-treated cells were significantly prolonged, but shorter than those in the control group.

Figure 3.

Effects of urate on action potentials of HL-l cells. (A) Action potentials recorded from HL-1 cells treated with (blue and pink) or without (black and red) urate at 7 mg/dl before and during application of 4-aminopyridine (4-AP). (B) Action potential durations at 50% repolarization (APD₅₀) and 90% repolarization (APD₉₀) measured for the control and urate-treated cells. Both APD₅₀ and APD₉₀ values were significantly shorter in the urate-treated cells than in control cells (n=10; *P<0.05).

Table 2. Action Potential Parameters

No.	Treatment group	Resting membrane potential (mV)	AP amplitude (mV)	Overshoot (mV)	APD50 (ms)	APD90 (ms)
1	Control	−69.38±2.85	90.73±6.69	21.35±7.03	32.83±6.51	113.18±18.51
2	Urate	−69.60±1.77	87.45±5.21	17.85±5.20	17.74±5.85	53.28±23.39

APD₅₀, action potential durations at 50% repolarization; APD₉₀, action potential durations at 90% repolarization.

Inhibition of UATs Influenced a Urate-Induced Increase in Kv1.5 Channel Proteins in HL-1 Cells

We evaluated the mRNA expression of 9 UATs in HL-1 cells using RT-PCR (Figure 4A), which detected the expressions of an influx transporter (URATv1) and two efflux transporters (ABCG2 and MRP4). All of these expressed UATs were also expressed in human embryonic stem cell-derived cardiomyocytes (Figure S3).

Figure 4.

Expression of uric acid transporters (UATs) and their roles in urate-induced Kv1.5 upregulation in HL-1 cells. (A) mRNA expressions of UATs in HL-1 cells determined by polymerase chain reaction (PCR) analyses. Data for HL-1 cells’ cDNA (H) and mouse kidney’s cDNA as a control (K) are shown in pairs. HL-1 cells expressed URATv1, ABCG2 and MRP4. Control (–) indicates a control for gDNA contamination during reverse-transcriptase reaction, of which the reverse-transcriptase enzyme was not added to the reaction. Control (+) means a control for the reverse-transcription process, indicating that cDNAs could be well synthesized. During amplification, glyceraldehyde 3-phosphate dehydrogenase (GAPDH) primers were added to both Controls. (B) Effect of benzbromarone on the expression of Kv1.5 proteins. HL-1 cell cultures were assigned to 3 groups, and treated with 10 mmol/L of NaOH as a control, 7 mg/dl urate alone, or 7 mg/dl urate with 20 µmol/L benzbromarone. Protein lysates were taken after 24 h. Representative Western blots (Lower) and the averaged density of Kv1.5 proteins normalized to that of α-tubulin (Upper) are shown. The averaged density data shown as percentages to the control values revealed a significant increase of Kv1.5 expression in the group administered urate alone, and a reduction of the urate effect in the presence of 20 µmol/L benzbromarone (n=3; *P<0.05). (C) Effect of KO143 on the expression of Kv1.5 proteins. HL-1 cell cultures were assigned to 3 groups, treated with 10 mmol/L NaOH as a control, 7 mg/dl urate alone, or 7 mg/dl urate with 100 nmol/L KO143. Protein lysates were taken after 24 h. Representative Western blots (Lower) and the averaged density of Kv1.5 normalized to that of α-tubulin (Upper) are shown. The averaged density data demonstrate an increased Kv1.5 expression in the group treated with urate alone, and a further increase of Kv1.5 expression in the presence of KO143 (n=4; *P<0.05).

To test how the expressed UATs could be involved in the urate-induced enhancement of Kv1.5 protein expression, we examined the effects of UATs inhibitors on the Kv1.5 protein expression in HL-1 cells. Figure 4B shows the representative Western blots of expressed Kv1.5 proteins after a 24-h treatment with or without urate. Pretreatment with benzbromarone (20µmol/L), an inhibitor of the influx transporter, URATv1, abolished the urate-induced increases in Kv1.5 protein expression. Figure 4C shows the representative Western blots of Kv1.5 proteins after a 24-h treatment with or without urate in the absence and presence of KO143 (100 nmol/L), an inhibitor of the efflux urate transporter, ABCG2. KO143 (100 nmol/L) enhanced the urate-induced increase in Kv1.5 protein expression. Either benzbromarone or KO143 alone did not affect the Kv1.5 expression (data not shown).

Oxidative Stress Is Involved in Urate-Induced Upregulation of Kv1.5 Channel Proteins

We also examined whether oxidative stress was involved in the urate-induced enhancement of Kv1.5 expression. Treatment with urate increased ROS by approximately 30%, and this effect was cancelled by simultaneous treatment with an antioxidant, NAC (Figure 5A Left). Figure 5B (Left) shows the representative Western blots of Kv1.5 proteins after 24-h treatment with or without urate in the absence and presence of NAC. Treatment with NAC (10 mmol/L) for 1 h prior to urate exposure abolished the enhancing effect of urate on Kv1.5 protein expression, while NAC alone did not affect the Kv1.5 expression (data not shown).

Figure 5.

Involvement of oxidative stress in the urate-induced upregulation of Kv1.5. (A) Representative records of reactive oxygen species (ROS) level analysis using flow cytometry (Upper parts) and averaged ratios of ROS-positive cells (Lower parts). (B) N-acetylcysteine (NAC) and apocynin inhibitions of the urate-induced enhancement of Kv1.5 expression. HL-1 cells were assigned to each 3 groups as for the ROS level analysis. Cells in the urate+drug group were pre-treated with NAC (Left side) or apocynin (Right side) for 1 h prior to the 24-h exposure to urate. Protein lysates were taken and subjected to Western blot analyses (Upper part). The averaged density of Kv1.5 proteins normalized to that of α-tubulin (Lower part) showed a significant reduction of Kv1.5 expression in both NAC-treated and apocynin-treated groups, as compared to the groups treated with urate alone (n=4 each; *P<0.05).

As ROS generation induced by urate has been reported to involve nicotinamide adenine dinucleotide phosphate (NADPH)-oxidase, we tested the effects of a NADPH-oxidase inhibitor, apocynin. Figure 5A (Right) shows the effects of apocynin on ROS productions in the presence of urate. Flow cytometry confirmed the increase of ROS in the urate-treated group, and that apocynin at 1 mmol/L reduced ROS to the control level. Figure 5B (Right) shows the representative Western blots of Kv1.5 proteins after 24-h treatment with or without urate. Treatment with apocynin on urate-treated cells abolished the urate-induced enhancement of Kv1.5 expression. Apocynin alone did not affect Kv1.5 expression (data not shown). Each of the flow cytometry experiments was confirmed by another experiment.

ERK Pathway Is Involved in Urate-Induced Kv1.5 Upregulation

We further examined an involvement of the ERK pathway, the downstream signaling pathway activated by oxidative stress, in the urate-induced enhancement of Kv1.5 expression. Figure 6A shows the representative Western blots of Kv1.5 proteins after 24-h treatment with or without urate in combination with an ERK inhibitor, PD98059. PD98059 (20 µmol/L) abolished the urate effect. Urate increased phosphorylated ERK (pERK) in HL-1 cells (Figure 6B), and PD98059 (20 µmol/L) abolished this enhancement. We finally examined effects of NAC on the level of pERK in urate-treated cells (Figure 6C). NAC abolished the increase of pERK caused by urate, indicating that the urate-induced enhancement of ERK phosphorylation is due to oxidative stress.

Figure 6.

Involvement of the extracellular signal-regulated kinase (ERK) pathway in the urate-induced upregulation of Kv1.5. (A) Effect of the ERK-inhibitor, PD98059, on Kv1.5 expression. HL-1 cells were treated with NaOH at 10 mmol/L (Control), urate (7 mg/dl) alone, or urate (7 mg/dl)+PD98059 (20µmol/L) for 24 h. Protein lysates were taken, and subjected to Western blot analyses (Right). The averaged density of Kv1.5 proteins normalized to that of α-tubulin (Left) showed a significant reduction of Kv1.5 expression in the PD98059-treated group (n=3; *P<0.05). (B) Effect of PD98059 on phosphorylated-ERK. HL-1 cells were treated as per the Kv1.5 expression analysis described above. Western blots using an antibody against phosphorylated ERK (pERK) revealed an increase of pERK level in the urate-treated cells (right). The averaged density of pERK as a percentage to the total ERK, normalized to the density in the control group, showed significant inhibition of the urate-induced pERK increase by PD98059 (Left; n=3; *P<0.05). (C) Effect of N-acetylcysteine (NAC) on phosphorylated-ERK. HL-1 cells were treated with NaOH at 10 mmol/L (Control), urate (7 mg/dl) alone, or urate (7 mg/dl)+NAC (20 mmol/L) for 24 h. Western blots using anti-pERK antibody revealed an increase of pERK level in the urate-treated cells (Right). The averaged density of pERK as a percentage to the total ERK showed significant inhibition of the urate-induced-pERK-increase by NAC (Left; n=3; *P<0.05).

Discussion

In the present study, we investigated whether urate, a soluble form of uric acid, could alter the expression and function of Kv1.5 channels in HL-1 cells. Treatment with urate increased the protein level of Kv1.5, which was accompanied by an increase in I_Kur and shortening of APDs.

Kv1.5 channels, encoded by the KCNA5 gene, confer I_Kur. In humans, the Kv1.5 channel is selectively expressed in atrial myocytes where it is an important contributor for action potential repolarization and controls APD.³⁹ Overexpression of Kv1.5 in rat cardiomyocytes shortens APD,⁴⁰ leading to the shortening of ERP, which plays an important role in the generation of reentry circuits to cause tachyarrhythmia. Yamashita et al reported that the enhancement of Kv1.5 expression by rapid pacing resulted in APD shortening and AF.³³ In the present study, the urate-induced increase in Kv1.5 expression was associated with APD shortening. This is the first study to report that intracellular elevation of urate could shorten atrial APD and ERP via enhancement of Kv1.5 channel currents. Elevation of the serum urate level has been reported to increase the incidence of AF, and a recent study has indicated that hyperuricemia is an independent risk factor of AF.²⁰ Our findings are consistent with these reports.

The intracellular urate level is regulated by UATs.^5,6 The intracellular accumulation of urate via activation of influx UATs could cause cellular damage through several signaling pathways. In a previous report by Kang et al, urate induced vascular smooth cell proliferation through activation of an influx UAT, voltage-driven urate transporter 1 (URATv1, also known as SLC2A9).¹³ There is no report regarding the expression of UATs in human atrium, while there is a report of UATs expressed in human umbilical endothelial cells (HUVECs).¹⁶ This report indicated that URATv1, as well as ATP-binding cassettes subfamily G second member (also known as the human breast cancer resistance protein, BRCP; ABCG2), multidrug resistance protein 4 (MRP4) and monocarboxylate transporter 9 (MCT9) were expressed in HUVECs; thus, the types of UATs in HUVECs were similar to those in HL-1 cells. We confirmed that the expressed UATs were also expressed in human embryonic stem cell-derived cardiomyocytes (Figure S3). Based on these data, there might be significant expressions of URATv1 and other UATs in human atrium as well. However, further experiments would be necessary to clarify whether hyperuricemia really shortens the refractory period in human atrium via the enhancement of Kv1.5 channel expression.

In the present study, HL-1 cells expressed mRNA of the influx transporter, URATv1, as well as the efflux transporters, ABCG2 and MRP4. The authentic URATv1 inhibitor benzbromarone abolished, but the ABCG2 inhibitor, KO143, enhanced the urate-induced increases of Kv1.5 proteins. These findings support our hypothesis that the intracellular accumulation of urate via UATs increases Kv1.5 proteins in HL-1 cells.

Urate-induced oxidative stress is implicated in various pathophysiological states.^10,12,15 Urate stimulates the production of oxidant in both adipocytes and vascular smooth muscle cells.^17,41 We observed an increase of ROS in urate-treated HL-1 cells. This increase was proportional to the increase of Kv1.5 proteins. Reversal of the increase by the antioxidant, NAC, confirms an involvement of oxidative stress. ROS is well-known to be generated by NADPH oxidase and urate-induced ROS production via activation of NADPH oxidase.⁴¹ The NADPH oxidase inhibitor, apocynin, reduced the ROS level and inhibited the urate-induced enhancement of Kv1.5 expression. Chao et al reported that urate stimulated the expression of endothelin-1 and NADPH oxidase in human aortic smooth muscle cells.⁴¹ Taken together, we conclude that urate-induced oxidative stress via activation of NADPH oxidase increased the protein level of Kv1.5.

Several studies reported involvement of the ERK 1/2 pathway as part of the downstream signaling of urate-derived ROS.^15,42 In the present study, treatment with urate increased the level of pERK, which was suppressed by pretreatment with the antioxidant, NAC. This finding is consistent with previous reports for vascular smooth muscle cells, adipocytes and pancreatic β-cells.^15,17,41 The present study demonstrates that urate enhances Kv1.5 expression through xanthine oxidase and NADPH oxidase-dependent oxidative stress, and activation of the ERK1/2 pathway.

Some limitations in this study should be considered. The Kv1.5 channel is known to have a complex regulatory mechanism, starting from its transcription, translation, and post-translational modifications affecting its glycosylation, trafficking, surface expression and degradation.⁴³ Our study measured only the total expressed Kv1.5; further studies are needed to clarify which part of the regulations is actually affected. The mean current increased 3-fold, while the Kv1.5 protein expression increased by only approximately 30%. This discrepancy might be caused by the involvement of other factors that we did not observe. In this study, we used the HL-1 mouse atrial myocytes cell line, of which electrophysiological and biological properties have been well characterized. However, experiments using primary cultured cardiomyocytes or in vivo studies are necessary in the future. Another limitation is that we selected only some of the commonly known UATs to be analyzed for their presence in HL-1 cells. Thus, the presence of other UATs in HL-1 cells is unknown.

In summary, urate enters the cell through UATs, and enhances Kv1.5 protein expression. This effect is exerted by NADPH oxidase-dependent oxidative stress and the ERK pathway. Because the atrium with increased Kv1.5 currents is predisposed to AF, the use of influx UAT inhibitors and antioxidants may be beneficial for the prevention of AF in patients with hyperuricemia. Confirming this finding can lead to a more comprehensive treatment of hyperuricemia, particularly for the prevention of an overexpression of K⁺ channels, which may increase the risk of tachyarrhythmias, including AF.

Acknowledgments

We sincerely thank Professor William C Claycomb for the original HL-1 cells.

Source of Funding

None.

Disclosures

None.

Supplementary Files

Supplementary File 1

Methods

Figure S1. L-type calcium channel currents in HL-1 cells.

Figure S2. Expression of L-type calcium channel proteins in HL-1 cells.

Figure S3. mRNA expressions of uric acid transporters in human embryonic stem cell-derived cardiomyocytes.

Table S1. cDNA primer sequences of human urate transporters

Please find supplementary file(s);

http://dx.doi.org/10.1253/circj.CJ-15-0416

References

• 1.    Álvarez-Lario  B,  Macarrón-Vicente  J. Uric acid and evolution. Rheumatology 2010; 49: 2010–2015.
• 2.    Terkeltaub  R,  Edwards  NL. Disease definition and overview of pathogenesis of hyperuricemia and gouty inflammation. In: Terkeltaub R, Edwards NL, editors. Gout: Diagnosis and management of gouty arthritis and hyperuricemia. New York: Professional Communications, Inc, 2013; 19–47.
• 3.    Edwards  NL. The role of hyperuricemia and gout in kidney and cardiovascular disease. Cleve Clin J Med 2008; 75(Suppl_5): S13–S16.
• 4.   Japanese Society of Gout and Nucleic Acid Metabolism. Revised guidelines for the management of hyperuricemia and gout. Osaka: Medical Review Co. Ltd.; 2010 (in Japanese).
• 5.    Hediger  MA,  Johnson  RJ,  Miyazaki  H,  Endou  H. Molecular physiology of urate transport. Physiology (Bethesda) 2005; 20: 125–133.
• 6.    Wright  AF,  Rudan  I,  Hastie  ND,  Campbell  H. A “complexity” of urate transporters. Kidney Int 2010; 78: 446–452.
• 7.    Feig  DI,  Kang  DH,  Johnson  RJ. Uric acid and cardiovascular risk. N Engl J Med 2008; 359: 1811–1821.
• 8.    Fang  J,  Alderman  MH. Serum uric acid and cardiovascular mortality. JAMA 2000; 283: 2404–2410.
• 9.    Bonora  E,  Targher  G,  Zenere  M,  Saggiani  F,  Cacciatori  V,  Tosi  F, et al. Relationship of uric acid concentration to cardiovascular risk factors in young men: Role of obesity and central fat distribution (The Verona Young Men Atherosclerosis Risk Factors Study). Int J Obes Relat Metab Disord 1996; 20: 975–980.
• 10.    Choi  YJ,  Yoon  Y,  Lee  KY,  Hien  TT,  Kang  KW,  Kim  KC, et al. Uric acid induces endothelial dysfunction by vascular insulin resistance associated with the impairment of nitric oxide synthesis. FASEB J 2014; 28: 3197–3204.
• 11.    Korantzopoulos  P,  Letsas  KP,  Liu  T. Xanthine oxidase and uric acid in atrial fibrillation. Front Physiol 2012; 3: 150.
• 12.    Yu  MA,  Sánchez-Lozada  LG,  Johnson  RJ,  Kang  DH. Oxidative stress with an activation of the renin-angiotensin system in human vascular endothelial cells as a novel mechanism of uric acid-induced endothelial dysfunction. J Hypertens 2010 : 28: 1234–1242.
• 13.    Kang  DH,  Han  L,  Ouyang  X,  Kahn  AM,  Kannelis  J,  Li  P, et al. Uric acid causes vascular smooth muscle cell proliferation by entering cells via a functional urate transporter. Am J Nephrol 2005; 25: 425–433.
• 14.    Price  KL,  Sautin  YY,  Long  DA,  Zhang  L,  Miyazaki  H,  Wei  M, et al. Human vascular smooth muscle cells express a urate transporter. J Am Soc Nephrol 2006; 17: 1791–1795.
• 15.    Zhang  Y,  Yamamoto  T,  Hisatome  I,  Li  Y,  Cheng  W,  Sun  N, et al. Uric acid induces oxidative stress and growth inhibition by activating adenosine monophosphate-activated protein kinase and extracellular signal-regulated kinase signal pathways in pancreatic β cells. Mol Cell Endocrinol 2013; 375: 89–96.
• 16.    Sugihara  S,  Hisatome  I,  Kuwabara  M,  Niwa  K,  Maharani  N,  Kato  M, et al. Depletion of uric acid due to SLC22A12 (URAT1) loss-of-function mutation causes endothelial dysfunction in hypouricemia. Circ J 2015; 79: 1125–1132.
• 17.    Sautin  YY,  Nakagawa  T,  Zharikov  S,  Johnson  RJ. Adverse effects of the classic antioxidant uric acid in adipocytes: NADPH oxidase-mediated oxidative/nitrosative stress. Am J Physiol Cell Physiol 2007; 293: C584–C596.
• 18.    Liu  T,  Zhang  X,  Korantzopoulos  P,  Wang  S,  Li  G. Uric acid levels and atrial fibrillation in hypertensive patients. Intern Med 2011; 50: 799–803.
• 19.    Valbusa  F,  Bertolini  L,  Bonapace  S,  Zenari  L,  Zoppini  G,  Arcaro  G, et al. Relation of elevated serum uric acid levels to incidence of atrial fibrillation in patients with type 2 diabetes mellitus. Am J Cardiol 2013; 112: 499–504.
• 20.    Suzuki  S,  Sagara  K,  Otsuka  T,  Matsuno  S,  Funada  R,  Uejima  T, et al. Gender-specific relationship between serum uric acid level and atrial fibrillation prevalence. Circ J 2012; 76: 607–611.
• 21.    Zhao  Q,  Yu  S,  Huang  H,  Cui  HY,  Qin  M,  Huang  T, et al. Serum uric acid levels correlate with atrial fibrillation in patients with chronic systolic heart failure. Chin Med J 2012; 125: 1708–1712.
• 22.    Tekin  G,  Tekin  YK,  Erbay  AR,  Turhan  H,  Yetkin  E. Serum uric acid levels are associated with atrial fibrillation in patients with ischemic heart failure. Angiology 2013; 64: 300–303.
• 23.    Su  HM,  Lin  TH,  Hsu  PC,  Lee  WH,  Chu  CY,  Lee  CS, et al. Association of hyperuricemia with cardiac events in patients with atrial fibrillation. Int J Cardiol 2014; 172: 464–465.
• 24.    Nyrnes  A,  Toft  I,  Njølstad  I,  Mathiesen  EB,  Wilsgaard  T,  Hansen  JB, et al. Uric acid is associated with future atrial fibrillation: An 11-year follow-up of 6308 men and women--the Tromso Study. Europace 2014; 16: 320–326.
• 25.    He  X,  Li  S,  Zhan  J,  Xie  S,  Zhang  Z,  Dong  J, et al. Serum uric acid levels correlate with recurrence of paroxysmal atrial fibrillation after catheter ablation. Chin Med J 2013; 126: 860–864.
• 26.    Letsas  KP,  Korantzopoulos  P,  Filippatos  GS,  Mihas  CC,  Markou  V,  Gavrielatos  G, et al. Uric acid elevation in atrial fibrillation. Hellenic J Cardiol 2010; 51: 209–213.
• 27.    Tang  RB,  Dong  JZ,  Yan  XL,  Du  X,  Kang  JP,  Wu  JH, et al. Serum uric acid and risk of left atrial thrombus in patients with nonvalvular atrial fibrillation. Can J Cardiol 2014; 30: 1415–1421.
• 28.    Numa  S,  Hirai  T,  Nakagawa  K,  Ohara  K,  Fukuda  N,  Nozawa  T, et al. Hyperuricemia and transesophageal echocardiographic thromboembolic risk in patients with atrial fibrillation at clinically low-intermediate risk. Circ J 2014; 78: 1600–1605.
• 29.    Nattel  S. New ideas about atrial fibrillation 50 years on. Nature 2002; 415: 219–226.
• 30.    Wakili  R,  Voigt  N,  Kääb  S,  Dobrev  D,  Nattel  S. Recent advances in the molecular pathophysiology of atrial fibrillation. J Clin Invest 2011; 121: 2955–2968.
• 31.   JCS Joint Working Group. Guidelines for pharmacotherapy of atrial fibrillation (JCS 2013): Digest version. Circ J 2014; 78: 1997–2021.
• 32.    Wang  Z,  Fermini  B,  Nattel  S. Sustained depolarization-induced outward current in human atrial myocytes. Evidence for a novel delayed rectifier K+ current similar to Kv1.5 cloned channel currents. Circ Res 1993; 73: 1061–1076.
• 33.    Yamashita  T,  Murakawa  Y,  Hayami  N,  Fukui  E,  Kasaoka  Y,  Inoue  M, et al. Short-term effects of rapid pacing on mRNA level of voltage-dependent K+ channels in rat atrium: Electrical remodeling in paroxysmal atrial tachycardia. Circulation 2000; 101: 2007–2014.
• 34.    Decher  N,  Kumar  P,  Gonzalez  T,  Pirard  B,  Sanguinetti  MC. Binding site of a novel Kv1.5 blocker: A “ foot in the door ” against atrial fibrillation. Mol Pharmacol 2006; 70: 1204–1211.
• 35.    Ravens  U,  Poulet  C,  Wettwer  E,  Knaut  M. Atrial selectivity of antiarrhythmic drugs. J Physiol 2013; 591: 4087–4097.
• 36.    Claycomb  WC,  Lanson  NA,  Stallworth  BS,  Egeland  DB,  Delcarpio  JB,  Bahinski  A, et al. HL-1 cells: A cardiac muscle cell line that contracts and retains phenotypic characteristics of the adult cardiomyocyte. Proc Natl Acad Sci USA 1998; 95: 2979–2984.
• 37.    White  SM,  Constantin  PE,  Claycomb  WC. Cardiac physiology at the cellular level: Use of cultured HL-1 cardiomyocytes for studies of cardiac muscle cell structure and function. Am J Physiol Heart Circ Physiol 2004; 286: H823–H829.
• 38.    Ting  YK,  Morikawa  K,  Kurata  Y,  Li  P,  Bahrudin  U,  Mizuta  E, et al. Transcriptional activation of the anchoring protein SAP97 by heat shock factor (HSF)-1 stabilizes K(v) 1.5 channels in HL-1 cells. Br J Pharmacol 2011; 162: 1832–1842.
• 39.    Tamkun  M,  Knoth  K,  Walbridge  J,  Kroemer  H,  Roden  D,  Glover  D. Molecular cloning channel characterization from of two voltage-gated ventricle. FASEB J 1991; 5: 331–337.
• 40.    Tanabe  Y,  Hatada  K,  Naito  N,  Aizawa  Y,  Chinusi  M,  Nawa  H, et al. Over-expression of Kv1.5 in rat cardiomyocytes extremely shortens the duration of the action potential and causes rapid excitation. Biochem Biophys Res Commun 2006; 345: 1116–1121.
• 41.    Chao  H,  Liu  J,  Lin  J,  Chen  C,  Wu  C,  Cheng  T. Uric acid stimulates endothelin-1 gene expression associated with NADPH oxidase in human aortic smooth muscle cells. Acta Pharmacol Sin 2008; 29: 1301–1312.
• 42.    Kanellis  J,  Watanabe  S,  Li  JH,  Kang  DH,  Li  P,  Nakagawa  T, et al. Uric acid stimulates monocyte chemoattractant protein-1 production in vascular smooth muscle cells via mitogen-activated protein kinase and cyclooxygenase-2. Hypertension 2003; 41: 1287–1293.
• 43.    Schumacher  SM,  Martens  JR. Ion channel trafficking: A new therapeutic horizon for atrial fibrillation. Heart Rhythm 2010; 7: 1309–1315.