Original Article
Antimicrobial Resistant Bacteria Monitoring in Raw Seafood Retailed: a Pilot Study Focused on Vibrio and Aeromonas
2023 年 11 巻 4 号 p. 65-77
詳細
2023 年 11 巻 4 号 p. 65-77
In aquaculture, bacterial infections in sea animals are treated using antimicrobials. As seafood is frequently consumed in its raw form, seafood contaminated with water-borne antimicrobial-resistant bacteria presents a potential transmission route to humans and can influence food safety. In this study, we aimed to determine the abundance of water-borne bacteria in retail raw seafood and to characterize their antimicrobial resistance profiles. In total, 85 retail raw seafood samples (32 fish, 26 shellfish, 25 mollusks, and two crustaceans) were purchased from supermarkets in Japan, and water-borne bacteria were isolated. The isolated bacterial species predominantly included Vibrio spp. (54.1%) and Aeromonas spp. (34.1%). Vibrio or Aeromonas spp. were isolated from more than 70% of the seafood samples. Tetracycline-, sulfamethoxazole-, and/or trimethoprim/sulfamethoxazole-resistant Vibrio or Aeromonas spp. isolates were detected in seven (21.9%) fish samples (two wild-caught and five farm-raised) harboring tet, sul, and/or dfr genes. Sulfamethoxazole- and trimethoprim/sulfamethoxazole-resistant isolates were only detected in farm-raised fish. Tetracycline and sulfamethoxazole are commonly used in aquaculture. These results suggest that water-borne bacteria like Vibrio and Aeromonas spp. should be the primary focus of antimicrobial-resistant bacteria monitoring to effectively elucidate their spread of bacteria via seafood.
The emergence and spread of antimicrobial-resistant bacteria (ARB) and antimicrobial resistance genes (ARGs) have become a major public health concern. As antimicrobials use exerts a selective pressure; therefore, antimicrobials using environments are considered to be ARB and ARGs hotspots1). In human clinical settings, livestock, and livestock-associated food production, ARB are continuously monitored among contaminating bacteria; particularly in clinical settings, coliforms, such as Escherichia coli, are monitored in various countries including Japan2,3).
As antimicrobials are used to treat bacterial infectious diseases in farm-raised seafood, aquaculture is considered a hotspot for the emergence and spread of ARB and ARGs4). Moreover, seafood consumption has increased globally, and it is frequently consumed in a raw form, particularly in Japan, where sashimi and sushi are popular dishes5). Consequently, seafood consumption may represent an important ARB transmission route to humans.
Pathogenic bacteria, such as those that cause food poisoning, are prevalent in seafood, and bacterial contamination in fish is frequent along the food value chain6,7,8). Notably, ARB and ARGs have been studied in seafood and related samples9). However, most previous studies have only focused on pathogenic bacteria. In an aquatic environment, Vibrio and Aeromonas would be candidates indicator bacteria for antimicrobial resistance; Vibrio would be especially suitable as indicator bacteria for marine settings because of their natural habitat10,11). Further, Vibrio and Aeromonas were usually isolated from retailed seafood12,13). However, the species of contaminating bacteria, which usually inhabit aquatic environments, especially Vibrio, in retail raw seafood in Japan and the prevalence of antimicrobial resistance in these bacteria remain unknown14,15).
This study aimed to clarify the prevalence of water-borne bacterial species, specifically Vibrio, in retail seafood intended for raw consumption, as well as their antimicrobial resistance profiles in Japan. This investigation also acts as a pilot study for monitoring ARB in seafood.
In total, 85 fresh domestic seafood samples intended for non-heated raw consumption were purchased from eight supermarkets surrounding Rakuno Gakuen University (Ebetsu, Hokkaido Prefecture, Japan), between July 2020 and September 2021. The samples were refrigerated and not frozen. The type and origin of seafoods distributed varied depending on the season, especially in wild-caught seafoods. To collect a wide variety of seafoods, 3–10 randomly selected samples were purchased every month, for more than one year. The samples comprised 32 fish, 26 shellfish, 25 mollusks, and two crustaceans originating from 10 prefectures. (Tables S1 and S2). Among fish samples, 14 were wild-caught and 18 were farm-raised. All shellfish, mollusk, and crustacean samples were wild-caught. All collected samples were refrigerated at 4°C for up to 24 h before use.
Isolation of BacteriaFor bacterial isolation, the edible parts excluding the digestive tract were used. Twenty-five grams of each sample was shredded using sterilized scissors and placed in a sterile plastic bag containing 225 mL of alkaline peptone water supplemented with 2% sodium chloride (Nissui Pharmaceutical, Co., Ltd. Tokyo, Japan). Each sample was homogenized at 200 rpm for 1 min using a stomacher (EXNIZER-400, Organo, Tokyo, Japan). One hundred microliters of the homogenized sample was plated onto TCBS (Eiken Co. Ltd., Tokyo, Japan) and CHROMagar™ Vibrio agar (CHROMagar, Paris, France). The homogenized samples were incubated at 30°C for 24 h as a preculture; the precultures were then plated onto TCBS and CHROMagar™ Vibrio agar. The agars were incubated at 30°C for 24 h, and a maximum of 10 colonies were isolated from each sample; two colonies/color from each plate (yellow and green colonies grown on TCBS agar, as well as purple, blue, and cream-colored colonies grown on CHROMagar™ Vibrio agar) were used for further analysis.
Bacterial IdentificationThe bacterial species of each isolate was determined using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry on a Bruker MALDI Biotyper system (Bruker Daltonics, Bremen, Germany)16). Additionally, PCR was performed to confirm the bacterial species in genus of Vibrio and Aeromonas (Table S3)17,18,19,20). In subsequent experiments, isolates from each agar plate showing the same color and antimicrobial susceptibility profile were considered as a single isolate.
Susceptibility to AntimicrobialsSusceptibility to antimicrobials was determined using the agar dilution method, and resistance breakpoints were defined in accordance with the Clinical Laboratory Standards Institute guidelines21). Escherichia coli ATCC25922 was used as a quality control strain in CLSI M45. The following antimicrobials were tested against Vibrio and Aeromonas isolates: cefotaxime, chloramphenicol, ciprofloxacin, gentamicin, tetracycline, and trimethoprim/sulfamethoxazole. Additionally, ampicillin, cefazolin, and sulfamethoxazole were tested against Vibrio strains (all obtained from Sigma-Aldrich, St. Louis, MO).
Detection of ARGsARGs were screened according to antimicrobial susceptibility phenotypes. Primers used for detecting ARGs are shown in Table S4. For tetracycline-resistant isolates, tet genes were detected17,22). For trimethoprim/sulfamethoxazole- or sulfamethoxazole-resistant isolates, sul and dfr genes were detected23,24,25).
Statistical AnalysisThe Chi-squared test was used to compare the isolation rates of bacteria among the samples. Statistical significance was set at p<0.05.
Vibrio spp. (54.1%; n=46) was isolated from 85 raw seafood samples, followed by Aeromonas spp. (34.1%; n=29), Shewanella spp. (17.6%; n=15), and Photobacterium spp. (10.6%; n=9) (Table 1). The combined isolation rate forVibrio or Aeromonas spp. was 74.1%. Vibrio and Aeromonas spp. were commonly isolated from commercially available fresh seafood intended for raw consumption in Japan. These results are consistent with previously reported bacterial isolation rates from raw seafood even though the types of seafoods and distribution channels vary from region to region13). Vibrio spp. and Aeromonas spp. have been recognized as typically water-borne and several of their species have been identified as potential food-borne pathogens and causative agents of fish diseases15,26). Notably, the rates of Vibrio spp. isolated from wild-caught shellfish were higher than those isolated from wild-caught fish. Aeromonas spp. was isolated at higher rates in wild-caught and farm-raised fish than in shellfish and mollusks. These variations in isolation rates are likely caused by the diversity of microbiomes associated with different types of seafood and their growing environments27). Despite limitations of sample size and location, we demonstrated that Vibrio or Aeromonas spp. could be frequently isolated from raw seafood, sold in retail stores in Japan, consistent with their status as water-borne bacteria. However, further verification, using a larger number of samples from different regions, is necessary to confirm whether the research results are widely applicable.
| Bacterial species (%) | Total | Fish | Shellfish | Mollusks | Crustacean | |
| Wild-caught | Farm-raised | Wild-caught | Wild-caught | Wild-caught | ||
| (n = 85) | (n = 14) | (n = 18) | (n = 26) | (n = 25) | (n = 2) | |
| Vibrio spp. | 54.1 | 28.6 | 50.0 | 73.1 | 48.0 | 100 |
| Aeromonas spp. | 34.1 | 71.4 | 61.1 | 3.8 | 24.0 | 50.0 |
| Shewanella spp. | 17.6 | 14.3 | 0 | 10.8 | 24.0 | 0 |
| Photobacterium spp. | 10.6 | 7.1 | 27.8 | 3.1 | 4.0 | 0 |
| Staphylococcus spp. | 7.1 | 0 | 0 | 1.5 | 20.0 | 0 |
| Morganella spp. | 5.9 | 7.1 | 5.6 | 1.5 | 4.0 | 50.0 |
| Pseudomonas spp. | 3.5 | 21.4 | 0 | 0 | 0 | 0 |
| Other | 11.8 | 21.4 | 5.6 | 1.5 | 16.0 | 50.0 |
| Either Vibrio or Aeromonas spp. | 74.1 | 78.6 | 72.2 | 73.1 | 72.0 | 100 |
| Antimicrobial resistance rates (%) | Wild-caught fish (n = 13) |
Farm-raised fish (n = 22) |
Shellfish (n = 52) |
Mollusks (n = 24) |
Crustacean (n = 4) |
| Tetracycline | 7.7 | 13 | 0 | 0 | 0 |
| Sulfamethoxazole | 0 | 8.7 | 0 | 0 | 0 |
| Trimethoprim/sulfamethoxazole | 0 | 4.3 | 0 | 0 | 0 |
| Ampicillin | 61.5 | 82.6 | 82.7 | 75 | 100 |
In total, 115 Vibrio spp. and 65 Aeromonas spp. were isolated and used for susceptibility to antimicrobials (Tables 2, 3, and S5). Tetracycline resistance rates in Vibrio spp. isolates derived from wild-caught and farm-raised fish were 7.7% and 13.0%, respectively. Tetracycline resistance rates in Aeromonas spp. isolates derived from wild-caught and farm-raised fish were 3.2% and 4.0%, respectively. Among Vibrio spp., derived from farm-raised fish, resistance rates to sulfamethoxazole and trimethoprim/sulfamethoxazole were 8.7% and 4.3%, respectively. The trimethoprim/sulfamethoxazole resistance rate in Aeromonas spp. was 12.5%. In many countries, including Japan, tetracycline, trimethoprim, and sulfamethoxazole derivatives are commonly used antimicrobials in aquaculture, and may serve as selective pressures for ARB3,4,9,28). Notably, in our study, isolates resistant to sulfamethoxazole- and/or trimethoprim/sulfamethoxazole were detected only in samples derived from farm-raised fish, suggesting a possible link to the situation of antimicrobials usage in aquaculture. Moreover, the prevalence of antimicrobial-resistant Vibrio and Aeromonas spp. in seafood indicates the use of antimicrobials in aquaculture. Among all sample types, more than 60% of Vibrio spp. isolates displayed ampicillin resistance. Further, approximately 10% of Aeromonas spp. isolates from wild-caught fish, farm-raised fish, and mollusk samples displayed cefotaxime resistance. Vibrio and Aeromonas showed intrinsic resistance to these antimicrobials through chromosome-mediated resistance mechanisms15,26). None of the Vibrio and Aeromonas spp. isolates were resistant to the other antimicrobials tested in our study. The antimicrobial resistance rates observed in our study are consistent with those reported in other countries, such as China, Norway, Thailand, and USA13,29,30,31). Further, ARB contamination in seafood preparation could occur through various sources including human handlers8,32,33). To qualify the ARB-mediated risk to human health via seafood, identifying suitable ARB markers capable of evaluating contamination in seafood is important34). Therefore, additional research on the prevalence of antimicrobial-resistant water-borne bacteria, especially on Vibrio and Aeromonas spp., is required to enhance seafood safety.
| Antimicrobial resistance rates (%) | Wild-caught fish (n = 31) |
Farm-raised fish (n = 24) |
Shellfish (n = 1) |
Mollusks (n = 8) |
Crustacean (n = 1) |
| Tetracycline | 3.2 | 4.2 | 0 | 0 | 0 |
| Trimethoprim/sulfamethoxazole | 0 | 12.5 | 0 | 0 | 0 |
| Cefotaxime | 9.7 | 12.5 | 0 | 12.5 | 0 |
ARGs were detected in a total of nine tetracycline-, trimethoprim/sulfamethoxazole-, and/or trimethoprim/sulfamethoxazole-resistant Vibrio and Aeromonas spp. isolates derived from seven (21.9%) fish samples (two wild-caught and five farm-raised) from six prefectures (Table 4). The tetD gene was detected in the tetracycline-resistant V. alginolyticus isolate derived from wild-caught fish. In the tetracycline-resistant V. anguillarum isolate, derived from farm-raised fish, tetB and/or tetM genes were detected. In the sulfamethoxazole- and/or trimethoprim/sulfamethoxazole-resistant isolates, sul1 and/or sul2 genes were detected. Moreover, the tetE gene was detected in the tetracycline-resistant A. veronii and A. caviae isolates derived from wild-caught fish and farm-raised fish, respectively. In A. caviae isolates, derived from farm-raised fish, the sul1 and dfrA genes were detected. The genes detected in our study have been frequently detected in various bacterial species derived from seafood15,26,30), and are often transferable across genera35). The tetB and tetM genes were specifically detected in isolates derived from farm-raised fish. A previous study demonstrated that the abundance of tetB and tetM genes in fish and aquatic environments increased after the application of oxytetracycline in aquaculture36). These findings suggest that the antimicrobials use serves as a selective pressure for ARGs-carrying bacteria. Furthermore, farm-raised fish have been shown to contribute to ARGs enrichment in the sediments of aquaculture environments37); thereby, posing a potential risk of their dissemination to the surrounding environments. Overall, antimicrobial usage in aquaculture practices may serve as a source of ARGs, and aquaculture-related ARGs may disseminate through various routes, including food chains and environments5).
| Strain No | Sample No |
Prefectures of origin |
Sample type | Bacterial species | Antimicrobial resistant profiles | Antimicrobial resistance genes |
|
| 52V-8 | 50 | Hokkaido | Wild-caught | Trout fish | V. alginolyticus | Tetracycline | tetD |
| 1V-10 | 1 | Ehime | Farm-raised | Red sea bream | V. anguillarum | Sulfamethoxazole-, Trimethoprim/ sulfamethoxazole-Ampicillin |
sul2 |
| 1V-1D | 1 | Ehime | Farm-raised | Red sea bream | V. anguillarum | Tetracycline-Ampicillin | tetB |
| 45V-1 | 45 | Ehime | Farm-raised | Red sea bream | V. anguillarum | Tetracycline-Sulfamethoxazole-, Trimethoprim/ sulfamethoxazole-Ampicillin |
tetB, tetM,sul1, sul2 |
| 53V-7 | 53 | Aomori | Wild-caught | Mackerel | A. veronii | Tetracycline | tetE |
| 8V-5 | 8 | Kochi | Farm-raised | Young yellowtail |
A. caviae | Trimethoprim/sulfamethoxazole | sul1, dfrA |
| 9V-3 | 9 | Oita | Farm-raised | Greater amberjack |
A. caviae | Trimethoprim/sulfamethoxazole | sul1, dfrA |
| C9V-5 | 9 | Oita | Farm-raised | Greater amberjack |
A. caviae | Trimethoprim/ sulfamethoxazole-Cefotaxime |
sul1, dfrA |
| 18V-9 | 18 | Kagoshima | Farm-raised | Greater amberjack |
A. caviae | Tetracycline | tetE |
As a pilot study for monitoring ARB in seafoods, our data showed that Vibrio spp. and Aeromonas spp. were isolated from more than 70% of raw seafood flesh samples in Japan, and that ARB-harboring ARGs (at least tet, sul, and dfr genes) were isolated in 21.9% of the fish samples. Notably, bacteria derived from farm-raised fish may be influenced by the use of antimicrobials in aquaculture. Given that seafoods are commonly consumed raw, ARB contamination in seafood could represent an important route of transmission to humans9). As seafood consumption continues to increase, sustainably managing marine resources and controlling ARB in aquaculture farms to secure the stable and safe supply of seafood is essential5). Therefore, ARB monitoring, particularly in water- and seafood-borne bacteria, such as Vibrio and Aeromonas spp., is required to ensure sustainable and safe provision of seafood.
| Fish (32; wild caught (14), farm raised (18)) | Shellfish (26) | Mollusks (25) | Crustacean (2) | |||||
| Perciformes | Clupeiformes | Pleuronectiformes | Gadiformes | |||||
| Wild caught | Farm raised | Wild caught | Wild caught | Farm raised | Wild caught | Wild caught | Wild caught | Wild caught |
| Yellowtail (1) | Yellowtail (3) | Trout fish (1) | Flounder (1) | Flounder (1) | Cod fish (1) | Scallops (14) | Octopus (14) | Shrimp (2) |
| Tuna (1) | Tuna (1) | Sardines (1) | Flatfish (1) | Shellfish (6) | Squid (11) | |||
| Atka mackerel (2) | Red sea bream (7) | Surf clam (3) | ||||||
| Mackerel (1) | Greater amberjack (3) |
Oyster (2) | ||||||
| Jack mackerel (1) | Young yellowtail (3) |
Turban shell (1) | ||||||
| Podothecus sachi (1) | ||||||||
| Prefectures | Total (n = 85) |
Wild-caught fish (n = 14) |
Farm-raised fish (n = 18) |
Shellfish (n = 26) |
Mollusks (n = 25) |
Crustacean (n = 2) |
| Hokkaido | 61 | 10 | 0 | 25 | 24 | 2 |
| Ehime | 9 | 1 | 8 | 0 | 0 | 0 |
| Oita | 3 | 0 | 3 | 0 | 0 | 0 |
| Nagasaki | 3 | 0 | 3 | 0 | 0 | 0 |
| Miyagi | 2 | 2 | 0 | 0 | 0 | 0 |
| Kumamoto | 2 | 0 | 2 | 0 | 0 | 0 |
| Aomori | 2 | 1 | 0 | 0 | 1 | 0 |
| Kochi | 1 | 0 | 1 | 0 | 0 | 0 |
| Kagoshima | 1 | 0 | 1 | 0 | 0 | 0 |
| Chiba | 1 | 0 | 0 | 1 | 0 | 0 |
| Bacteiral species or target genes | Prime name | Sequence | Annealing tempature (°C) | Amplicon size (bp) | Reference |
| V. parahaemolyticus | VP 1155272 F | AGCTTATTGGCGGTTTCTGTCGG | 60 | 297 | (Kim et al., 2015) |
| VP 1155272 R | CKCAAGACCAAGAAAAGCCGTC | ||||
| V. cholerae | VC C634002 F | CAAGCTCCGCATGTCCAGAAGC | 60 | 154 | |
| VC C634002 R | GGGGCGTGACGCGAATGATT | ||||
| V. vulnificus | W 2055918 F79 | CAGCCGGACGTCGTCCATTTTG | 60 | 484 | |
| W 2055918 R | ATGAGTAAGCGTCCGACGCGT | ||||
| V. alginolyticus | VA 1198230 F | ACGGCATTGGAAATTGCGACTG | 60 | 199 | |
| VA 1198230 R | TACCCGTCTCACGAGCCCAAG | ||||
| V. mimicus | VMC727581F | ATAAAGCGGGGTGCGTGCA | 60 | 249 | |
| VM C727581R | GATTTGGRAAAATCCKTCGTGC | ||||
| Genus of Vibrio | VG C2694352 F46 | GTCARATTGAAAARCARTTYGGTAAAGG | 60 | 689 | |
| VG C2694352 R734 | ACYTTRATRCGNGTTTCRTTRCC | ||||
| Genus of Vibrio | Vuni-rpoD-F.4 | CTTTYGCTTCACCGATAGACAT | 60 | 1075 | (Kim et al., 2019) |
| Vuni-rpoD-R | CAAGGCTATCTGACCTACGC | ||||
| V. anguillarum | Van-rpoD-F.7 | CAGACARCAAGAAGAAGACATTCG | 60 | 125 | |
| V. scophthalmi | Vsc-rpoD-F.2 | CCAAGTTCAAAACGCCGTTGCA | 60 | 740 | |
| V. lentus | Vle-rpoD-F.3 | GAACGGTAATCGTCGCTCAGTCC | 60 | 113 | |
| V. alginolyticus | Val-rpoD-F.2 | AATGAAATGATGCTAGACGTATTCCG | 60 | 371 | |
| V. gigantis | Vgi-tox-R | GGCATGATGAAAGCGATAAGCAGT | 60 | 292 | |
| Vuni-tox-F | CCWAARCGCGGTTAYCAAYTKAT | ||||
| V. atlanticus | Vat-recF-F.2 | ATTTGAGAGTTCACTCGCGGGC | 60 | 372 | |
| Vat-recF-F.3 | GCTTAGTTCTCGATAGTGTGTTGC | ||||
| V. harveyi | VH-4F | GTGATGAAGAAGCTTATCGCGATT | 60 | 601 | |
| VH-7R | CGCCTTCTTCAGTTAACGCAGGA | ||||
| V. splendidus | Vspl-tox-R.1 | GTTGTTGCTGGTTCCACTTCAAC | 60 | 218 | |
| Vuni-tox-F | CCWAARCGCGGTTAYCAAYTKAT | ||||
| A. media | A-med F(176) | GGCCAAGCGTCTGCGT | 63 | 70 | (Persson et al., 2015) |
| A-med R(275) | CGCCCTCGTAGCAGAAGTGA | ||||
| A. caviae | A-cav F(4) | TGCTGCTGACCATCCGC | 63 | 99 | |
| A-cav R(74) | GGTGCCTGCGGCTCG | ||||
| A. hydrophila | A-hyd F(533) | AGTCTGCCGCCAGTGGC | 63 | 144 | |
| A-hyd R(677) | CRCCCATCGCCTGTTCG | ||||
| A. veronii | A-Ver F(b1) | CGTGCCGGCTTTGAAGTC | 63 | 224 | |
| A-Ver R(b1-225) | GATCACGTACTTGCCTTCTTCAATA | ||||
| Genus of Aeromonas | A-16S F(270) | CGACGATCCCTAGCTGGTCT | 63 | 461 | |
| A-16S R(731) | GCCTTCGCCACCGGTAT | ||||
| lip | Hydrolipase-F | AACCTGGTTCCGCTCAAGCCGTTG | 55 | 760 | (Sen, 2005) |
| Hydrolipase-R | TTGCTCGCCTCGGCCCAGCAGCT | ||||
| 16S rRNA | Schubertii-16S (UF-2)-F | TACTGGAAACGGTAGCT | 55 | 322 | |
| Schubertii-16S (UF-2)-R | CTGGCAGGTATTAACCACCA | ||||
| 16S rRNA | Popoffii-16S (UF-1)-F | AGTTGGAAACGACTGCT | 55 | 323 | |
| Popoffii-16S (UF-1)-R | GTTGCTGGRTATTAGCCAA | ||||
| ahyB | Elastase-F2 | ACACGGTCAAGGAGATCAAC | 55 | 540 | |
| Elastase-R2 | CGCTGGTGTTGGCCAGCAGG | ||||
| gyrB | gyrB-veronii-F | CCATTTTCAGCGATACCCTGTT | 55 | 101 | |
| gyrB-veronii-R | CTCGTCTTGCAGACGGATGGAG | ||||
| 16S rRNA | Jandaei-16S-F | TACTGGAAACGGTAGCT | 55 | 322 | |
| Jandaei-16S (UR) R | CCAGCAGATATTAGCTACTG | ||||
| 16S rRNA | Caviae-16S-F | AGTTGGAAACGACTGCT | 55 | 322 | |
| Caviae-16S-R | CCAGCAGATATTAGCTACTG | ||||
| pla/lip | Lipase-F | ATCTTCTCCGACTGGTTCGG | 55 | 383-389 | |
| Lipase-R | CCGTGCCAGGACTGGGTCTT | ||||
| 16S rRNA | Veronii-16S-F | GAGGAAAGGTTGGTAGCTAATAA | 55 | 688 | |
| Veronii-16S-R | CGTGCTGGCAACAAAGGACAG | ||||
| gyrB | gyrB-bestiarum-F | CACTTCTCCACAGAGCAGGAC | 55 | 182 | |
| gyrB-bestiarum-R | ATCCTCTTTGTCCATATAGGT | ||||
| gyrB | gyrB-eucrenophila-F | AGCAGACTCGGCGACAGCTCT | 55 | 177 | |
| gyrB-eucrenophila-R | CCTCGCGGCCATCGCGCTCG |
| Antimcirobial resistance genes | Prime name | Sequence | Annealing tempature (°C) | Amplicon size (bp) | Reference |
| tet-F | GCGCTNTATGCGTTGATGCA | (Kim et al., 2004) | |||
| tetA | tetA-R | ACAGCCCGTCAGGAAATT | 55 | 387 | |
| tetB | tetB-R | TGAAAGCAAACGGCCTAA | 55 | 171 | |
| tetC | tetC-R | CGTGCAAGATTCCGAATA | 55 | 631 | |
| tetD | tetD-R | CCAGAGGTTTAAGCAGTGT | 55 | 484 | |
| tetE | tetE-R | ATGTGTCCTGGATTCCT | 55 | 246 | |
| tetG | tetG-R | ATGCCAACACCCCCGGCG | 55 | 803 | |
| tetM | tetM-F | GTTAAATAGTGTTCTTGGAG | 55 | 656 | (H. J. Kim et al., 2015) |
| tetM-R | CTAAGATATGGCTCTAACAA | ||||
| tetS | tetS-F | CATAGACAAGCCGTTGACC | 56 | 667 | |
| tetS-R | ATGTTTTTGGAACGACAGAG | ||||
| sul1 | Sul1-F | CGGCGTGGGCTACCTGAACG | 59 | 433 | (Phuong Hoa et al., 2008) |
| Sul1-R | GCCGATCGCGTGAAGTTCCG | ||||
| sul2 | Sul2-F | GCGCTCAAGGCAGATGGCATT | 58 | 293 | |
| Sul2-R | GCGTTTGATACCGGCACCCGT | ||||
| sul3 | Sul3-F | TCAAAGCAAAATGATATGAGC | 54 | 787 | |
| Sul3-R | TTTCAAGGCATCTGATAAAGAC | ||||
| sul4 | sul4_FW | CGCTTCATCGGGGTAAAAT | 58 | 213 | (Xu et al., 2020) |
| sul4_RV | CGGACCTATTAAGATGGGAAA | ||||
| dfrA1,A15,A16,A28 | dfr_group1-1f | GTGAAACTATCACTAATGG | 46 | 471 | (Šeputiene et al., 2010) |
| dfr_group1-1r | ACCCTTTTGCCAGATTTG | ||||
| dfrA8,A12,A13,A21,A22 | dfr_group1-2f | TTGGGAAGGACAACGCACTT | 46 | 382 | |
| dfr_group1-2r | ACCATTTCGGCCAGATCAAC | ||||
| dfrA12,A13,A21,A22 | dfr_group1-3f | GGTGAGCARAAGATYTTTCGC | 46 | 309 | |
| dfr_group1-3r | TGGGAAGAAGGCGTCACCCTC | ||||
| dfrA5,A14,A25,A27 | dfr_group2-1f | GCBAAAGGDGARCAGCT | 44 | 394 | |
| dfr_group2-1r | TTTMCCAYATTTGATAGC | ||||
| dfrA7,A17 | dfr_group2-2f | AAAATTTCATTGATTTCTGCA | 44 | 471 | |
| dfr_group2-2r | TTAGCCTTTTTTCCAAATCT | ||||
| dfrA3b | dfr_group2-3f | TTTATTGTGGTAAGCAATAC | 44 | 201 | |
| dfr_group2-3r | GTATACATCTGCATCAAAAC | ||||
| dfrA3b | dfr_group3-1f | ACCTGCCGATCTGCGTCAT | 52 | 387 | |
| dfr_group3-1r | TCGCAGGCATAGCTGTTCTT | ||||
| dfrA10 | dfr_group3-2f | ACCAGAGCATTCGGTAATCA | 52 | 445 | |
| dfr_group3-2r | TTGGATCACCTACCCATAGA | ||||
| dfrA26 | dfr_group3-3f | CACAGTCTATCGCCTTAATC | 52 | 233 | |
| dfr_group3-3r | ATAGACCACAAAGCTAAACG | ||||
| dfrA6 | dfr_group4-1f | GTTTCCGAGAATGGAGTAAT | 52 | 429 | |
| dfr_group4-1r | GGTACGTGTAATCAATATTTG | ||||
| dfrA24 | dfr_group4-2f | TCACCAAGAAGTCAGAGATT | 52 | 311 | |
| dfr_group4-2r | TAAAACCAGATTCGACTTTC | ||||
| dfrA23 | dfr_group4-3f | AGAATTCCCTTCTCTTTGAT | 52 | 218 | |
| dfr_group4-3r | ATGCCAACAGTTGAGATTAT | ||||
| dfrB1,B2,B3,B4,B5,B6 | dfr_group5-1f | GATCACGTRCGCAAGAARTC | 56 | 95 | |
| dfr_group5-1r | GACTCGACVGCRTASCCTTC | ||||
| dfrA9 | dfr_group5-2f | TGAACCAGAAGATTTAAAACAC | 56 | 384 | |
| dfr_group5-2r | AATGGTCGGGACCTCAGAT | ||||
| dfrA19 | dfr_group5-3f | AGTCGCTGTGGATTCTAAGT | 56 | 455 | |
| dfr_group5-3r | CAATGTGAAAATTGTTCTGG | ||||
| dfrA20 | dfr_group5-4f | ATGATTTGCTTTGGCACTTA | 56 | 250 | |
| dfr_group5-4r | CCACCAATAATGAAGCATGT |
| (n) | Total | Fish | Shellfish | Mollusks | Crustacean | |
| Wild-caught | Farm-raised | |||||
| Genus Vibrio | 115 | 13 | 22 | 52 | 24 | 4 |
| V. alginolyticus | 81 | 10 | 6 | 45 | 18 | 2 |
| V. anguillarum | 14 | 0 | 9 | 5 | 0 | 0 |
| V. harvey | 6 | 0 | 3 | 1 | 0 | 2 |
| other Vibrio spp. | 14 | 3 | 4 | 1 | 6 | 0 |
| Genus Aeromonas | 65 | 31 | 24 | 1 | 8 | 1 |
| A. veronii | 24 | 8 | 11 | 0 | 5 | 0 |
| A. salmonicida | 15 | 11 | 2 | 1 | 1 | 0 |
| A. hydrophila | 9 | 4 | 4 | 0 | 0 | 1 |
| A. caviae | 6 | 2 | 4 | 0 | 0 | 0 |
| A. bestiarum | 4 | 4 | 0 | 0 | 0 | 0 |
| A. media | 3 | 0 | 1 | 0 | 2 | 0 |
| A. eucrenophila | 2 | 1 | 1 | 0 | 0 | 0 |
| A. enteropelogenes | 1 | 0 | 1 | 0 | 0 | 0 |
| A. popoffii | 1 | 1 | 0 | 0 | 0 | 0 |
