2021 Volume 96 Issue 2 Pages 99-104
Nuclear microsatellite markers were developed for Geranium thunbergii, an herbaceous plant characterized by petal color polymorphism. Utilizing RNA sequencing data obtained by next-generation sequencing techniques, we developed and characterized 19 polymorphic microsatellite markers with two to 12 alleles in the nuclear genome. These markers will be used to reveal the genetic structure and demographic history of G. thunbergii in the Japanese archipelago, which will elucidate the genetic background of flower color polymorphism among populations.
Plants are often characterized by petal color variation within and among populations; this phenomenon is defined as flower color polymorphism. Flower color polymorphism has long been of interest to ecologists and evolutionists (Darwin, 1862; Forsman, 2016). For species with intraspecific floral color variation [e.g., Antirrhinum majus L. (Plantaginaceae), Aquilegia coerulea E. James (Ranunculaceae), Dactylorhiza sambucina (L.) Soó (Orchidaceae), Lysimachia arvensis (L.) U. Manns & Anderb. (Primulaceae) and Raphanus sativus L. (Brassicaceae)], the mechanisms underlying the maintenance of floral diversity have been rigorously investigated (Gigord et al., 2001; Jones and Reithel, 2001; Arista et al., 2013; McCall et al., 2013; Thairu and Brunet, 2015). Based on these investigations, biotic and abiotic elements (e.g., negative frequency-dependent selection, pollinator preference and temperature) are suggested to be important determinants of flower color polymorphism (Narbona et al., 2018). Selectively neutral factors, i.e., genetic drift and gene flow, have also been implicated in the maintenance of flower color polymorphism (Wright, 1978; Narbona et al., 2018). Therefore, it is important to evaluate the relative contributions of different evolutionary forces in maintaining floral color polymorphism within and among populations.
Geranium thunbergii Siebold ex Lindl. & Paxton (Geraniaceae) is a perennial herb distributed throughout the Japanese archipelago. The habitats of this species are lowland forest edges and grassy areas. The species shows a geographic cline in floral color: individuals having purple petals (i.e., purple flowers) are distributed on the western side of the Japanese archipelago, while those having white or pale pink petals (i.e., considered as “white flowers”) are distributed on the eastern side (Akiyama, 2001; Kadota, 2016). Both flower colors (i.e., purple and white) co-occur in central Honshu, the geographically intermediate distribution area of the species. As such, G. thunbergii has floral color variation both within and among populations, and is therefore a suitable plant species for exploring the formation and maintenance mechanisms of flower color polymorphism. In particular, since the geographic distribution pattern of floral color may be related to past neutral demographic history, phylogeographic and population genetics approaches are necessary to reveal the geographic pattern of flower color polymorphism. Tsuchimatsu et al. (2014) indicated that selective pressure by herbivores on white flowers and the anthocyanin-mediated herbivore defense of purple flowers are associated with the flower color polymorphism of G. thunbergii, but a more detailed study (e.g., including migration history) is required to elucidate the geographic pattern of flower color polymorphism in G. thunbergii. In this study, we developed polymorphic microsatellite markers for G. thunbergii to reveal its population genetics and phylogeographic history.
Assembled RNA sequencing data of G. carolinianum L. and G. maculatum Dum. Cours. were obtained from the ONEKP: BLAST for 1,000 Plants repository (https://db.cngb.org/onekp/). A similarity search of the contigs against the National Center for Biotechnology Information non-redundant protein database was conducted using the BLASTX algorithm (Altschul et al., 1990) with an E-value cutoff of 1.0E-5. We screened the sequences with microsatellite regions for ≥ 8 dinucleotide repeats and ≥ 8 trinucleotide repeats using MSATCOMMANDER (Faircloth, 2008), and designed primers using Primer3 software (Rozen and Skaletsky, 2000). A total of 369 primer pairs bordering microsatellites were designed and 141 pairs were selected for PCR amplification trials, using eight individuals from eight populations (Kodaira, Hokkaido Prefecture (Pref.); Saku, Nagano Pref.; Hachioji, Tokyo Pref.; Katsuura, Chiba Pref.; Taki, Mie Pref.; Okayama, Okayama Pref.; Amakusa, Kumamoto Pref.; and Yakushima, Kagoshima Pref.). For all loci, the forward primer was synthesized with one of three different tag sequences (5′-CACGACGTTGTAAAACGAC-3′, 5′-TGTGGAATTGTGAGCGG-3′ or 5′-CTATAGGGCACGCGTGGT-3′) and the reverse primer was tagged with a pig-tail sequence (5′-GTTTCTT-3′) (Brownstein et al., 1996). Genomic DNA was extracted from dried leaves using a modified CTAB method (Milligan, 1992). PCR amplification was carried out following the standard protocol of the Qiagen Multiplex PCR Kit (Qiagen, Hilden, Germany) in a final reaction volume of 10 µl containing approximately 5 ng of DNA, 5 µl of 2× Multiplex PCR Master Mix, 0.01 µM forward primer, 0.2 µM reverse primer, and 0.1 µM M13 primer (fluorescently labeled with Beckman Dye; Beckman Coulter, Brea, CA, USA). The PCR thermal profile involved denaturation at 95 ℃ for 3 min, followed by 35 cycles of 95 ℃ for 30 s, 54 ℃ for 3 min, and 68 ℃ for 1 min, and a final 20-min extension step at 68 ℃. PCR products were loaded onto an auto sequencer (GenomeLab GeXP; Beckman Coulter) to assess fragment lengths using Fragment Analysis Software ver. 8.0 (Beckman Coulter).
The extracted DNA of 23 individuals from Hachioji (Tokyo Pref.), 27 from Mifune (Kumamoto Pref.) and 30 from Nantan (Kyoto Pref.) was used to evaluate allelic polymorphisms. To characterize each microsatellite marker (= 19 markers), four summary statistics were calculated using FSTAT v.2.9.3 (Goudet, 1995) and GenAlEx v.6.501 (Peakall and Smouse, 2012): the number of alleles (A), allelic richness (Ar), expected heterozygosity (He) and observed heterozygosity (Ho). These summary statistics were calculated for each locus and population. The significance of Hardy–Weinberg equilibrium and genotypic equilibrium were tested by chi-squared test using GenAlEx v.6.501. In addition, the FST index (Weir and Cockerham, 1984) between populations was calculated using FSTAT v.2.9.3 for elucidating genetic differentiation among the three populations. Cross-amplification trials of the 19 markers were also performed for the related species G. wilfordii Maxim. (16 individuals from two populations: Onneyu, Hokkaido Pref. and Oshino, Yamanashi Pref.) and G. sibiricum L. (16 individuals from two populations: Nakatonbetsu and Onneyu, Hokkaido Pref.).
For the first primer screening using the auto sequencer, 39 of 141 primer pairs successfully amplified DNA fragments of the predicted size, while the remaining 102 pairs amplified fragments of unpredicted size, produced multiple bands, or failed to amplify any fragment. For the 39 reliable primer pairs that showed clear microsatellite peaks of the predicted fragment size, we conducted a second PCR trial using 80 individuals from three populations. We found that 19 loci were polymorphic across the three populations (Table 1), ranging from two to 12 alleles with He and Ho values ranging from 0.0 to 0.684 and 0.0 to 1.000, respectively (Table 2). Among these 19 loci, five markers (Table 1, Table 2) were found to be identical to sequences that were previously reported as monomorphic microsatellite primers of G. soboliferum var. kiusianum (Kurata et al., 2017). Genetic diversity was highest in the Nantan population (Ar = 2.741, He = 0.297), followed by the populations of Mifune (Ar = 2.060, He = 0.099) and Hachioji (Ar = 1.864, He = 0.098) (Table 2). In the Nantan population, individuals of both flower colors are distributed, while only purple and white flowers are distributed in Mifune and Hachioji, respectively. We confirmed significant departures from Hardy–Weinberg equilibrium at some loci in particular populations. Specifically, we detected significant deviations at VKGP_202, VKGP_2694, VKGP_10356, VKGP_14936, VKGP_19219 and VKGP_32221 in two or three populations in each locus, which may indicate the presence of null alleles at these loci. Significant genetic differentiation among the three G. thunbergii populations was detected using these markers (i.e., Hachioji–Mifune, FST = 0.841; Hachioji–Nantan, FST = 0.574; Mifune–Nantan, FST = 0.647). The genotyping error rate of the 19 markers was 2.18% based on 24 individuals arbitrarily selected from three populations. Note that the remaining 20 primers were inappropriate for performing population genetic studies because all individuals were fixed to an allele (i.e., monomorphic) or a heterozygote genotype (Table 3).
| Locus | Primer sequence (5’−3’) | Size range (bp) | Motif | BLASTX top hit description [species] | E-value | ONEKP ID | |
|---|---|---|---|---|---|---|---|
| VKGP_202 | F: | CAGCAAGCACCATGTTACCC | 150–153 | (AG)9 | UDP-galactose transporter 2 isoform X1 [Carex littledalei] | 2.00E-63 | VKGP-2000202 |
| R: | AGTGAAGCTCAAGAGAAGCG | ||||||
| VKGP_2694 | F: | TCTCCTCCTTCCATTGCCTG | 318–339 | (AG)10 | kinesin-like protein KIN-4A isoform X1 [Ricinus communis] | 0 | VKGP-2002694 |
| R: | CGACCTTCACACAGCAATCC | ||||||
| VKGP_3319 | F: | CAGAAACAGAGACCATAGCGTC | 167–169 | (AG)9 | hypothetical protein EZV62_019291 [Acer yangbiense] | 5.00E-109 | VKGP-2003319 |
| R: | TGTCTGCGAAGAGAGTACGG | ||||||
| VKGP_4952 | F: | AACCAGACCCTTGTAGCTCC | 326–330 | (AC)9 | No hit | VKGP-2004952 | |
| R: | CTTTGGAGCTCATTTGAACGTG | ||||||
| VKGP_10356 | F: | TCCTTTCTTCCTTGGTTTCCTG | 183–197 | (AG)9 | protease Do-like 7 [Ziziphus jujuba] | 0 | VKGP-2010356 |
| R: | TCTCCATGCACAACTCCTCC | ||||||
| VKGP_14936 | F: | TAGACCCAATTCAGCCTCGG | 269–281 | (AAC)10 | F-box/LRR-repeat protein 4 [Syzygium oleosum] | 3.00E-20 | VKGP-2014936 |
| R: | CTCACCAGTTTCCGATTCGC | ||||||
| VKGP_19219 | F: | ATGCGAAGGTGGAGAAGACG | 257–266 | (AG)8 | DUF502 domain-containing protein [Cephalotus follicularis] | 5.00E-11 | VKGP-2019219 |
| R: | TCTCTCGGCCTGATACAGTG | ||||||
| VKGP_25965 | F: | GTTAAGAATGCGGGCGGTAG | 334–337 | (ATC)8 | hypothetical protein FH972_002063 [Carpinus fangiana] | 8.00E-112 | VKGP-2025965 |
| R: | AGCAAAGCGAATGTCTCACG | ||||||
| VKGP_26672*1 | F: | TGTTTCTGTTCCGTTGACCC | 102–124 | (AG)9 | probable glutathione peroxidase 4 [Rhodamnia argentea] | 9.00E-95 | VKGP-2026672 |
| R: | AAGCTCCCATCTCCGATTCC | ||||||
| VKGP_29328 | F: | GCATTCCTACACAGCATCGG | 211–214 | (ATC)17 | hypothetical protein CISIN_1g018444mg [Citrus sinensis] | 4.00E-87 | VKGP-2029328 |
| R: | ATCCCAGAGGTGCAGACAAG | ||||||
| VKGP_31098 | F: | GCAGATTGGAATGTTGGTGC | 370–376 | (AGC)9 | No hit | VKGP-2031098 | |
| R: | TTGCAAAGCCATCACCCATG | ||||||
| VKGP_31943 | F: | GCATTACGTACACTGGCTGG | 263–266 | (AAC)8 | ataxin-2 homolog [Malus domestica] | 7.00E-06 | VKGP-2031943 |
| R: | GGATCCGACCTCCCAAATCC | ||||||
| VKGP_32221 | F: | GAGTGAGCAGAGTCTCGAGG | 399–427 | (AG)9 | two-component response regulator ARR12-like [Juglans regia] | 0 | VKGP-2032221 |
| R: | AGACGGAGACAGAGCTTCTC | ||||||
| VKGP_87603*1 | F: | CCGACAGAGAAGCTACGAAC | 123–134 | (AG)9 | No hit | VKGP-2087603 | |
| R: | TCGTGACTCAGTGACCTTCC | ||||||
| VKGP_92431*1, 2 | F: | AAGCAGAGAGGTCGATCGAG | 131–141 | (AG)9 | No hit | VKGP-2092431 | |
| R: | AGTGTGTGAGAGACTGTACGG | ||||||
| VKGP_108374*1 | F: | CAGACGCGGACAAAGCTAAG | 168–172 | (AG)9 | No hit | VKGP-2108374 | |
| R: | TGAACAGCGGGTAAAGAGAG | ||||||
| VKGP_108676*1 | F: | GAGCAGGAGAGAGAAGCAATC | 129–141 | (AG)9 | hypothetical protein [Gossypium harknessii] | 7.00E-44 | VKGP-2108676 |
| R: | AGCAGTTCGTGTACATTGCG | ||||||
| YGCX_17221 | F: | AGAGGGACCAAACCACTGTC | 160–181 | (AAC)9 | hypothetical protein GH714_022102 [Hevea brasiliensis] | 3.00E-49 | YGCK-2017221 |
| R: | AGGTCAGTGCATGTAGAGGC | ||||||
| YGCX_28878 | F: | ACACTCCTTCCCATGATCCG | 395–419 | (ATC)9 | uncharacterized protein LOC109022334 [Juglans regia] | 6.00E-09 | YGCX-2028878 |
| R: | TCTTCTACGCCAACCACCTC | ||||||
| Locus | Hachioji (n = 23) [white] | Mifune (n = 27) [purple] | Nantan (n = 30) [purple/white] | Total | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| A | Ar | He | Ho | A | Ar | He | Ho | A | Ar | He | Ho | A | Ar | He | Ho | |
| VKGP_202 | 2 | 1.948 | 0.091 | 0.000*** | 2 | 1.839 | 0.071 | 0.000*** | 2 | 2.000 | 0.391 | 0.000*** | 3 | 2.357 | 0.184 | 0.000 |
| VKGP_2694 | 4 | 3.454 | 0.279 | 0.136* | 6 | 4.455 | 0.239 | 0.111*** | 5 | 4.024 | 0.453 | 0.444 | 8 | 5.584 | 0.324 | 0.231 |
| VKGP_3319 | 1 | 1.000 | 0.000 | 0.000 | 1 | 1.000 | 0.000 | 0.000 | 1 | 1.000 | 0.000 | 0.000 | 2 | 2.000 | 0.000 | 0.000 |
| VKGP_4952 | 2 | 1.727 | 0.044 | 0.046 | 2 | 1.839 | 0.071 | 0.074 | 2 | 1.533 | 0.033 | 0.033 | 2 | 1.600 | 0.050 | 0.051 |
| VKGP_10356 | 2 | 2.000 | 0.500 | 1.000*** | 2 | 2.000 | 0.458 | 0.708** | 3 | 2.552 | 0.355 | 0.310 | 4 | 3.169 | 0.438 | 0.673 |
| VKGP_14936 | 1 | 1.000 | 0.000 | 0.000 | 2 | 1.857 | 0.074 | 0.000*** | 2 | 2.000 | 0.500 | 1.000*** | 3 | 2.373 | 0.191 | 0.333 |
| VKGP_19219 | 2 | 1.948 | 0.091 | 0.000*** | 4 | 3.329 | 0.180 | 0.192 | 4 | 3.523 | 0.222 | 0.103*** | 6 | 3.511 | 0.164 | 0.099 |
| VKGP_25965 | 1 | 1.000 | 0.000 | 0.000 | 1 | 1.000 | 0.000 | 0.000 | 2 | 2.000 | 0.444 | 0.133*** | 2 | 2.000 | 0.148 | 0.044 |
| VKGP_26672 | 2 | 1.930 | 0.087 | 0.000*** | 3 | 2.185 | 0.072 | 0.074 | 3 | 2.862 | 0.213 | 0.233 | 5 | 3.647 | 0.124 | 0.103 |
| VKGP_29328 | 1 | 1.000 | 0.000 | 0.000 | 1 | 1.000 | 0.000 | 0.000 | 2 | 1.786 | 0.064 | 0.067 | 2 | 2.000 | 0.022 | 0.022 |
| VKGP_31098 | 2 | 1.696 | 0.043 | 0.044 | 2 | 1.839 | 0.071 | 0.074 | 2 | 1.533 | 0.033 | 0.033 | 4 | 2.722 | 0.049 | 0.050 |
| VKGP_31943 | 1 | 1.000 | 0.000 | 0.000 | 1 | 1.000 | 0.000 | 0.000 | 2 | 2.000 | 0.346 | 0.000*** | 2 | 2.000 | 0.115 | 0.000 |
| VKGP_32221 | 4 | 3.588 | 0.210 | 0.045*** | 5 | 3.703 | 0.181 | 0.115** | 7 | 5.376 | 0.484 | 0.400 | 12 | 5.391 | 0.292 | 0.187 |
| VKGP_87603 | 1 | 1.000 | 0.000 | 0.000 | 1 | 1.000 | 0.000 | 0.000 | 4 | 3.983 | 0.634 | 0.333* | 5 | 4.743 | 0.211 | 0.111 |
| VKGP_92431 | 3 | 2.608 | 0.124 | 0.130 | 3 | 2.531 | 0.139 | 0.074* | 3 | 2.615 | 0.292 | 0.269 | 5 | 3.266 | 0.185 | 0.158 |
| VKGP_108374 | 2 | 1.727 | 0.044 | 0.046 | 4 | 2.846 | 0.111 | 0.115 | 2 | 1.533 | 0.033 | 0.033 | 4 | 1.911 | 0.063 | 0.065 |
| VKGP_108676 | 3 | 2.391 | 0.084 | 0.087 | 2 | 1.938 | 0.105 | 0.111 | 4 | 3.531 | 0.242 | 0.233 | 5 | 3.550 | 0.144 | 0.144 |
| YGCX_17221 | 1 | 1.000 | 0.000 | 0.000 | 1 | 1.000 | 0.000 | 0.000 | 4 | 3.916 | 0.684 | 0.276*** | 6 | 5.461 | 0.228 | 0.092 |
| YGCX_28878 | 4 | 3.390 | 0.268 | 0.217 | 4 | 2.778 | 0.107 | 0.111 | 6 | 4.318 | 0.215 | 0.231 | 9 | 3.498 | 0.197 | 0.186 |
| Average | 2.1 | 1.864 | 0.098 | 0.092 | 2.5 | 2.060 | 0.099 | 0.093 | 3.2 | 2.741 | 0.297 | 0.217 | 4.7 | 3.199 | 0.165 | 0.134 |
A, number of alleles per locus; Ar, allelic richness; He, expected heterozygosity; Ho, observed heterozygosity; n, number of individuals genotyped. Asterisks denote significant departure from Hardy–Weinberg equilibrium (*P < 0.05, **P < 0.01, ***P < 0.001). Petal color is indicated with population name.
| Locus | Primer sequence (5’−3’) | Predicted size (bp) | Motif | BLASTX top hit description [species] | E-value | ONEKP ID | |
|---|---|---|---|---|---|---|---|
| VKGP_4891 | F: | CTCCAAGGTACGAGGTGGTC | 345 | (AAC)8 | transcription repressor MYB4-like [Rhodamnia argentea] | 6.00E-89 | VKGP-2004891 |
| R: | GATGTCACGACGTTCACAGC | ||||||
| VKGP_10465 | F: | CAGCATCGTTCTTTCCCACC | 345 | (AAG)13 | LOW QUALITY PROTEIN: probable serine/threonine protein kinase IRE4 [Pistacia vera] | 3.00E-68 | VKGP-2010465 |
| R: | ACGTGCTGTTACAAACTGGG | ||||||
| VKGP_12870 | F: | GGTTGGTTCTGTTTCTGGGC | 276 | (AG)11 | hypothetical protein CMV_011704 [Castanea mollissima] | 0 | VKGP-2012870 |
| R: | CAACCAGCTCACACCTCAAC | ||||||
| VKGP_22151 | F: | TCATTGTGGCGAGCAAGTTC | 172 | (AG)9 | No hits | VKGP-2022151 | |
| R: | TTGCCCGGGTTCTCTTATCC | ||||||
| VKGP_22086 | F: | CCAAATCACTGACCTCCACG | 206 | (AT)9 | NAC domain-containing protein 43-like isoform X2 [Hevea brasiliensis] | 3.00E-21 | VKGP-2022086 |
| R: | TCACAATCTCGTTCTCATCACC | ||||||
| VKGP_23492 | F: | CAACTTGATCATGCACTTGTGC | 289 | (AAC)8 | hypothetical protein G4B88_004180 [Cannabis sativa] | 6.00E-129 | VKGP-2023492 |
| R: | AGTCAGTGCTGGACAAGGAG | ||||||
| VKGP_23939 | F: | TTCGTCTGATTCGGCATTGC | 396, 417 | (AAG)8 | mechanosensitive ion channel protein 10-like [Herrania umbratica] | 0 | VKGP-2023939 |
| R: | TCGGCCATGGAAGGTAGAAG | ||||||
| VKGP_25427 | F: | AAATAGAGGGAACAAGGCGC | 188 | (AG)9 | AMP deaminase/myoadenylate deaminase, putative isoform 1 [Theobroma cacao] | 0 | VKGP-2025427 |
| R: | AGAGTATACGCCTCCATCGC | ||||||
| VKGP_29076 | F: | ATCAGCCACCTCATCACCTC | 230 | (AAC)11 | No hits | VKGP-2029076 | |
| R: | TGGGCATGACGATATCCTGG | ||||||
| VKGP_31603 | F: | GAGAACACAATCCTCGTCGC | 333 | (AG)9 | hypothetical protein [Gossypium lobatum] | 2.00E-27 | VKGP-2031603 |
| R: | AGCTCTCCTCCACTTCTTGC | ||||||
| VKGP_76520 | F: | TCTCACCGACCTTTCCCATC | 132 | (AC)8 | No hits | VKGP-2076520 | |
| R: | CAGTCTCTAGTTGCTCATCAGG | ||||||
| VKGP_78116* | F: | GAGAGGCTTGCGATGGAGAG | 118 | (AG)9 | No hits | VKGP-2078116 | |
| R: | AAAGCTCCACTCAACAACGC | ||||||
| YGCX_1175 | F: | GATTCTGCTTCTCGTGACCC | 176 | (AAG)9 | aldo-keto reductase family 4 member c9-like protein [Trifolium pratense] | 5.00E-06 | YGCX-2001175 |
| R: | GAAGCTCACTGTCTCGTTGC | ||||||
| YGCX_3345 | F: | TCCTCCTGTATCGCCGAAAG | 225 | (AGC)8 | unnamed protein product [Prunus armeniaca] | 2.00E-51 | YGCX-2003345 |
| R: | CCCGAATCCATTTGAGGTGC | ||||||
| YGCX_6368 | F: | CCCTTCCAACAAGTGCATGG | 313 | (AAC)8 | probable transcription factor PosF21 [Cicer arietinum] | 2.00E-08 | YGCX-2006368 |
| R: | AGCTTCTGTGAGGGAGGAAC | ||||||
| YGCX_22751 | F: | TCCTCTGAGCTATGGTGTCAC | 270 | (AAG)9 | senescence/dehydration-associated protein At4g35985, chloroplastic-like isoform X1 [Rosa chinensis] | 1.00E-114 | YGCX-2022751 |
| R: | ATCCCTCTCACAATCTGGCC | ||||||
| YGCX_22772 | F: | CTGATGAACTTGGACGACGC | 392 | (AAC)9 | AP2-like ethylene-responsive transcription factor ANT [Herrania umbratica] | 6.00E-36 | YGCX-2022772 |
| R: | ATGTGGAGAGGATCATGGCC | ||||||
| YGCX_23325 | F: | TTGAGCCGGAACAGAGTCAG | 265 | (ACC)8 | RNA-binding protein 38 isoform X3 [Prosopis alba] | 2.00E-44 | YGCX-2023325 |
| R: | CGAGAATGTCACCGAACTGC | ||||||
| YGCX_25909 | F: | GCCACTACAACTGGACTTGC | 404 | (ATC)9 | No hits | YGCX-2025909 | |
| R: | ATCTGCCCTATGAGCTCCAG | ||||||
| YGCX_28044 | F: | ACCATCAATTTGCGGGACAC | 208 | (AAG)14 | protein ENHANCED DISEASE RESISTANCE 2-like [Carica papaya] | 4.00E-22 | YGCX-2028044 |
| R: | GCACCAACATCATCCCTCTC | ||||||
Moreover, we checked for cross-amplification of these polymorphic markers in G. wilfordii and G. sibiricum. In G. wilfordii, although one locus (VKGP_25965) was monomorphic, the other 18 loci were polymorphic across the two populations, ranging from two to four alleles with He and Ho values ranging from 0.0 to 0.633 and 0.0 to 1.000, respectively (Table 4). Allelic richness (Ar) ranged from 1.000 to 3.858 (Table 4). In G. sibiricum, 13 markers showed polymorphisms across the two populations, with the number of alleles ranging from two to three and He and Ho values ranging from 0.0 to 0.500 and 0.0 to 1.000, respectively (Table 4). Allelic richness (Ar) ranged from 1.000 to 2.875 (Table 4). However, six loci (i.e., VKGP_202, VKGP_25965, VKGP_29328, VKGP_31943, VKGP_87603 and YGCX_17221) were monomorphic, and one marker, VKGP_25965, failed to PCR-amplify any fragments for G. sibiricum.
| Locus | G. wilfordii | G. sibiricum | ||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Onneyu (n = 8) | Oshino (n = 8) | Nakatonbetsu (n = 8) | Onneyu (n = 8) | |||||||||||||
| A | Ar | He | Ho | A | Ar | He | Ho | A | Ar | He | Ho | A | Ar | He | Ho | |
| VKGP_202 | 2 | 1.992 | 0.219 | 0.000 | 1 | 1.000 | 0.000 | 0.000 | 1 | 1.000 | 0.000 | 0.000 | 1 | 1.000 | 0.000 | 0.000 |
| VKGP_2694 | 3 | 2.867 | 0.320 | 0.250 | 3 | 2.875 | 0.398 | 0.125 | 2 | 1.875 | 0.117 | 0.125 | 1 | 1.000 | 0.000 | 0.000 |
| VKGP_3319 | 3 | 3.000 | 0.586 | 0.125 | 2 | 2.000 | 0.375 | 0.250 | 1 | 1.000 | 0.000 | 0.000 | 2 | 2.000 | 0.245 | 0.000 |
| VKGP_4952 | 2 | 1.875 | 0.117 | 0.125 | 3 | 2.750 | 0.227 | 0.250 | 2 | 1.875 | 0.117 | 0.125 | 1 | 1.000 | 0.000 | 0.000 |
| VKGP_10356 | 2 | 1.875 | 0.117 | 0.125 | 3 | 2.750 | 0.227 | 0.250 | 1 | 1.000 | 0.000 | 0.000 | 3 | 2.875 | 0.398 | 0.250 |
| VKGP_14936 | 2 | 1.875 | 0.117 | 0.125 | 1 | 1.000 | 0.000 | 0.000 | 2 | 2.000 | 0.500 | 1.000 | 2 | 2.000 | 0.500 | 1.000 |
| VKGP_19219 | 3 | 3.000 | 0.255 | 0.286 | 2 | 1.875 | 0.117 | 0.125 | 2 | 2.000 | 0.245 | 0.000 | 2 | 2.000 | 0.133 | 0.143 |
| VKGP_25965 | 1 | 1.000 | 0.000 | 0.000 | 1 | 1.000 | 0.000 | 0.000 | 1 | 1.000 | 0.000 | 0.000 | – | – | – | – |
| VKGP_26672 | 2 | 1.992 | 0.219 | 0.000 | 2 | 1.875 | 0.117 | 0.125 | 1 | 1.000 | 0.000 | 0.000 | 2 | 1.875 | 0.117 | 0.125 |
| VKGP_29328 | 2 | 1.875 | 0.117 | 0.125 | 3 | 3.000 | 0.633 | 0.250 | 1 | 1.000 | 0.000 | 0.000 | 1 | 1.000 | 0.000 | 0.000 |
| VKGP_31098 | 3 | 2.867 | 0.320 | 0.375 | 4 | 3.625 | 0.328 | 0.375 | 3 | 2.750 | 0.227 | 0.250 | 3 | 2.750 | 0.227 | 0.250 |
| VKGP_31943 | 2 | 2.000 | 0.430 | 0.125 | 2 | 2.000 | 0.305 | 0.125 | 1 | 1.000 | 0.000 | 0.000 | 1 | 1.000 | 0.000 | 0.000 |
| VKGP_32221 | 2 | 2.000 | 0.500 | 1.000 | 2 | 2.000 | 0.500 | 1.000 | 1 | 1.000 | 0.000 | 0.000 | 2 | 1.875 | 0.117 | 0.125 |
| VKGP_87603 | 2 | 2.000 | 0.305 | 0.125 | 2 | 2.000 | 0.492 | 0.125 | 1 | 1.000 | 0.000 | 0.000 | 1 | 1.000 | 0.000 | 0.000 |
| VKGP_92431 | 3 | 2.867 | 0.320 | 0.125 | 1 | 1.000 | 0.000 | 0.000 | 2 | 1.992 | 0.219 | 0.000 | 1 | 1.000 | 0.000 | 0.000 |
| VKGP_108374 | 2 | 1.992 | 0.219 | 0.250 | 2 | 1.875 | 0.117 | 0.125 | 2 | 1.875 | 0.117 | 0.125 | 2 | 1.875 | 0.117 | 0.125 |
| VKGP_108676 | 1 | 1.000 | 0.000 | 0.000 | 4 | 3.858 | 0.492 | 0.375 | 2 | 1.992 | 0.219 | 0.000 | 3 | 2.867 | 0.320 | 0.375 |
| YGCX_17221 | 2 | 1.875 | 0.117 | 0.125 | 1 | 1.000 | 0.000 | 0.000 | 1 | 1.000 | 0.000 | 0.000 | 1 | 1.000 | 0.000 | 0.000 |
| YGCX_28878 | 2 | 1.992 | 0.219 | 0.000 | 2 | 1.875 | 0.117 | 0.125 | 2 | 1.875 | 0.117 | 0.125 | 2 | 1.875 | 0.117 | 0.125 |
| Average | 2.2 | 2.102 | 0.237 | 0.173 | 2.2 | 2.071 | 0.234 | 0.191 | 1.5 | 1.486 | 0.099 | 0.092 | 1.7 | 1.666 | 0.127 | 0.140 |
A, number of alleles per locus; Ar, allelic richness; He, expected heterozygosity; Ho, observed heterozygosity; n, number of individuals genotyped. One marker, VKGP_25965, failed to PCR-amplify any fragments for G. sibiricum.
Overall, the microsatellite markers developed here will be useful to reveal the genetic structure and demographic history of G. thunbergii in the Japanese archipelago, which will elucidate the genetic background of flower color polymorphism among populations.
The authors thank Daiki Takahashi, Kazutoshi Masuda and Koki Nagasawa for their great help with the sampling. The authors are grateful to Drs. Atsushi Ohwaki and Kenji Horie for granting access to their collection of materials (G. wilfordii and G. sibiricum). We are grateful to the Ashiu Forest Research Station (Kyoto University) for granting us permission to perform field surveys. We are also grateful to the ONEKP: BLAST for 1,000 Plants for kindly allowing us to access the sequence data. This work was supported by JSPS KAKENHI under Grant No. JP16H04827; the Agency for Medical Research and Development National BioResource Project under Grant No. 18km0210136j0002; and Fujiwara Natural History Foundation.
