1992 Volume 31 Issue 8 Pages 1016-1022
A gene amplification method of Mycobacterium tuberculosis DNA by the polymerase chain reaction (PCR) has been devised. A primer pair used in this study is 5'GTTGCCGTGGCGG TATCGG3' and 5'GCGACATTACGGGGCAGGTGG3', which brackets a 152-base region encoding the 65KD antigen, and a specific probe is 5'TTTGGGGTCATCTTTGGAGCG3'. The procedure could be completed within 2 days. The specificity and the sensitivity of the PCR for M. tuberculosis complex in identifying M. tuberculosis complex did not conflict with the conventional methods at all. Using this method, we could diagnose three cases of the disease, which had been very difficult to diagnose by the conventional methods, by detecting the DNA from the blood, liver biopsy specimen, lung aspirate, and pleural effusion.
(Internal Medicine 31 : 1016-1022, 1992)
