Internal Medicine
Online ISSN : 1349-7235
Print ISSN : 0918-2918
ISSN-L : 0918-2918
Volume 31, Issue 8
Displaying 1-22 of 22 articles from this issue
  • Hideo KATO, Hajime GOTO, Kazumi YUASA, Ryuji `IEKI, Kaoru SHIMADA
    1992Volume 31Issue 8 Pages 961-967
    Published: 1992
    Released on J-STAGE: March 27, 2006
    JOURNAL FREE ACCESS
    Lidocaine concentrations in 49 endotracheobronchial aspirates ranged from 12, 580 to 23μg/ml. The aspirates taken from the larger airway contained higher concentrations of lidocaine than those obtained from the smaller airway. Of the aspirates collected before 10 minutes after the final idocaine administration, the lidocaine concentration of 7 (24.1%) of 29 specimens was greater than 3, 000μg/ml, however, in the aspirates collected after 10 minutes, only 1 (5%) of 20 specimens showed a concentration greater than 3, 000 μg/ml. Using the dilution technique method (DTM) of lidocaine in the fiberscope (FS) suction channel, gradual injection of a 2ml saline solution into the suction channel and removal of the saline solution in the suction channel were performed immediately with a suction machine; the statistically significant differences (p <0.001) between lidocaine concentrations in the specimens before and after the DTM procedure were determined.
    (Internal Medicine 31 : 961-967, 1992)
    Download PDF (632K)
  • Seiki WADA, Hideyuki KITAMURA, Yoshifusa MATSUURA, Yasuyuki KATAYAMA, ...
    1992Volume 31Issue 8 Pages 968-972
    Published: 1992
    Released on J-STAGE: March 27, 2006
    JOURNAL FREE ACCESS
    Hypercalcemia occurred in a patient with non-Hodgkin's (B-cell type) lymphoma when generalized lymphadenopathy developed. Despite low normal plasma parathyroid hormone (PTH), nephrogenous cAMP (NcAMP) was not suppressed, and serum and urine PTH-related protein (PTH-rP) levels were elevated. The plasma level of 1, 25 (OH) 2D was within normal range. The combined chemotherapies successfully reduced the tumor size, serum Ca, PTH-rP, and lactic dehydrogenase. Serum osteocalcin was suppressed while the patient was hypercalcemic, and increased after chemotherapy. In the extract of the tumor tissue obtained post mortem, bioactivity stimulating the production of CAMP in osteoblasts was demonstrated along with the immunoreactive PTH-rP. This is the first report of a B-cell lymphoma producing PTH-rP and its association with humoral hypercalcemia of malignancy.
    (Internal Medicine 31 : 968-972, 1992)
    Download PDF (576K)
  • Toshiharu IJICHI, Itsuro HIGUCHI, Hidetoshi FUKUNAGA, Shuji IZUMO, Mit ...
    1992Volume 31Issue 8 Pages 973-977
    Published: 1992
    Released on J-STAGE: March 27, 2006
    JOURNAL FREE ACCESS
    Recent epidemiologic studies have shown that human T-lymphotropic virus type I (HTLV-I) is associated with polymyositis. To clarify the histological features of HTLV-I positive polymyositis, we studied muscle tissue from two groups of patients with polymyositis, those seropositive for HTLV-I (5 patients) and those seronegative (5 patients). We examined the lymphocyte subsets in muscle biopsies using monoclonal antibodies. In the endomysium, a variable number of T-lymphocytes and macrophages and a smaller proportion of B-lymphocytes were found in both groups. In both HTLV-I positive and negative patients a variable number of T-lymphocytes and macrophages, with a smaller number of B-lymphocytes, were found in the perimysium. As a whole, the T-lymphocytes were predominantly of the helper/inducer phenotype in both groups. We failed to find any specific phenotype distribution among T-cells infiltrating the muscle of HTLV-I carriers with polymyositis.
    (Internal Medicine 31 : 973-977, 1992)
    Download PDF (1285K)
  • Toshiki INOKUCHI, Miyuki ORITA, Kenji IMAMURA, Toshiko TAKAO, Sho ISOG ...
    1992Volume 31Issue 8 Pages 978-983
    Published: 1992
    Released on J-STAGE: March 27, 2006
    JOURNAL FREE ACCESS
    To elucidate whether the presence of fatty liver influences ketogenesis in obesity, the metabolic and hormonal changes in basal and low-dose epinephrine (EPI)-stimulated states were studied in 12 obese patients (OB) with normal glucose tolerance, consisting of 6 without fatty liver (OBN) and 6 with fatty liver (OBF). In the basal state, the total ketone body (TKB) concentration and the TKB to free fatty acid (FFA) ratio were significantly (p<0.01) lower in the OBF than in the OBN group, despite elevated, but comparable, FFA levels in both groups. The basal FFA level and the TKB/FFA ratio correlated with the degree of fatty liver (p <0.05-0.01). EPI infusion resulted in accelerated lipolysis and diminished FFA-induced ketogenesis, similar to the findings of the basal data. These results suggest that fatty liver per se is related to diminished FFA-induced ketogenesis, leading to resistance to ketosis in obestiy.
    (Internal Medicine 31 : 978-983, 1992)
    Download PDF (564K)
  • Makoto IITAKA, Shinji KITAHAMA, Nobuhiko FUKASAWA, Shiro MIURA, Yoshit ...
    1992Volume 31Issue 8 Pages 984-988
    Published: 1992
    Released on J-STAGE: March 27, 2006
    JOURNAL FREE ACCESS
    Serum antibodies to mouse IgG occasionally interfere with two-site immunometric assays in which mouse monoclonal antibodies are used. We examined the titers of antibodies to mouse IgG in serum samples from normal subjects and patients with autoimmune thyroid disease (AITD) using an enzyme-linked immunosorbent assay. Anti-mouse IgG antibodies were positive in 7/119 patients with Graves' disease (5.9%) and 3/60 patients with Hashimoto's thyroiditis (5.0%). One of the 15 patients with a thyroid neoplasm (6.7%) also had antibodies to mouse IgG, as did 5/60 healthy subjects (8.3%). These antibodies were either of the IgG or IgM class. There was no significant difference in the incidence of positive anti-mouse IgG antibody between normal subjects and patients with AITD. It is important to note this high incidence of antibodies to mouse IgG due to the potential of interference with immunometric assays employing mouse monoclonal antibodies.
    (Internal Medicine 31 : 984-988, 1992)
    Download PDF (489K)
  • Atsushi INOUE, Chang−Sung KOH, Naoyuki TSUKADA, Nobuo YANAGISAWA
    1992Volume 31Issue 8 Pages 989-993
    Published: 1992
    Released on J-STAGE: March 27, 2006
    JOURNAL FREE ACCESS
    We examined 8 cases of allergic granulomatous angiitis (AGA). All cases showed peripheral Nerve lesion, comprizing damage of all myelinated fibers, Which was more severe in larger ones. Immunofluorescent deposits of IgE were detected in the peripheral myelin. There was lymphocyte Infiltration both around the endoneural capillaries and in the endoneurium, and an increase of endothelial cells. Nerve ischemia due to obstruction of the vasa nervorum, circulation insufficiency of the small vessels, or immunological abnormality through IgE may play a pathogenetic role in the peripheral neuropathy of AGA.
    (Internal Medicine 31 : 989−993, 1992)
    Download PDF (941K)
  • Shigeyuki AOSHIMA, Hong Rong BANG, Naomichi MASUDA, Kei TAWARAHARA, Ta ...
    1992Volume 31Issue 8 Pages 994-997
    Published: 1992
    Released on J-STAGE: March 27, 2006
    JOURNAL FREE ACCESS
    Routine coronary angiography was performed in order to determine the incidence and clinical condition of coronary artery disease in 37 patients with arteriosclerosis obliterans or aortic aneurysm. Coronary angiography demonstrated significant stenosis in 12 (57%) of 21 patients with arteriosclerosis obliterans and in 7 (44%) of 16 patients with aortic aneurysm. The prevalence of risk factors for arteriosclerosis was similar for patients with arteriosclerosis obliterans and those with aortic aneurysm, and similar for patients with and without coronary artery stenosis. But coronary artery disease is often silent in patients with arteriosclerosis obliterans.
    (Internal Medicine 31 :994−997, 1992)
    Download PDF (418K)
  • Fumitaka MORITO, Megumi HIIDA, Akihide OHTA, Masaya YAMAGUCHI
    1992Volume 31Issue 8 Pages 998-1003
    Published: 1992
    Released on J-STAGE: March 27, 2006
    JOURNAL FREE ACCESS
    Many studies have suggested the involvement of multiple genetic loci in the development of systemic lupus erythematosus (SLE). We have analyzed the correlation between various genetic markers and the susceptibility to SLE. In this study, the association of SLE and restriction fragment length polymorphism (RFLP) of T cell receptor gene was evaluated. The cDNA for constant regions of α, β and γ chain were used as probes and RFLPs were analyzed after digestion with Eco RI, Bam HI, Pst I, Pvu II, Hind III and Bgl II. Among them, polymorphisms were detected using Bgl II-and Hind III-digested DNA and C β as a probe. Association with SLE in Japanese patients was found only after digestion with Hind III. The absence of the 13 kb polymorphic band appeared to be correlated with the development of SLE (relative risk = 4.78).
    (Internal Medicine 31 : 998-1003, 1992)
    Download PDF (748K)
  • Hiroaki KANNO, Eiji SAITO, Takayuki FUJIOKA, Tadao YASUGI
    1992Volume 31Issue 8 Pages 1004-1008
    Published: 1992
    Released on J-STAGE: March 27, 2006
    JOURNAL FREE ACCESS
    We investigated serum lipoprotein(a) [Lp(a)] levels in 20 patients with the nephrotic syndrome. Lp(a) levels in the nephrotic syndrome patients were significantly higher than those in a control group (30.4±22.5 vs 10.4±17.7mg/dl). Overall, the serum Lp(a) and lipid levels showed no relationship, but on an individual basis the serum Lp(a) level varied with the serum levels of total cholesterol and low density lipoprotein cholesterol in the nephrotic syndrome patients. Our findings suggest that a decrease in serum albumin led to increased hepatic Lp(a) synthesis. It is well known that thrombotic disease supervenes on hypercoagulability in the nephrotic syndrome, so the determination of Lp(a) levels in these patients may provide information which is useful for preventing thrombotic complications.
    (Internal Medicine 31 : 1004-1008, 1992)
    Download PDF (361K)
  • Masanobu MIYAZAKI, Abul KASHEM, Seizi IHARA, Naohiro YANO, Masayuki EN ...
    1992Volume 31Issue 8 Pages 1009-1015
    Published: 1992
    Released on J-STAGE: March 27, 2006
    JOURNAL FREE ACCESS
    The relation between IgA hyperproduction and restriction fragment length polymorphism (RFLP) of the immunoglobulin heavy chain switch (S) region was examined in Japanese patients with IgA nephropathy (IgAN) using Southern blot hybridization. Polymorphism in the S regions of IgM, IgA1 and IgA2 (SA2) was detected. A significant increase in the frequency of heterozygous phenotype of SA2 was shown in the patients. These patients showed a significant increase in the amount of serum IgA, IgA bearing cells and levels of proteinuria. Although two reports on RFLP of the S region have been published in Europe, the results differed. A comparison of the three reports showed different frequencies in the phenotype of the S region between Caucasian and Japanese patients. These results suggested that there is heterogeneity at the S region in IgAN patients in various countries and that this polymorphism might be associated with IgA hyperproduction and the development of proteinuria in Japanese patients.
    (Internal Medicine 31 : 1009-1015, 1992)
    Download PDF (734K)
  • Yoshimi KIKUCHI, Shinichi OKA, Satoshi KIMURA, Keiji MITAMURA, Kaoru S ...
    1992Volume 31Issue 8 Pages 1016-1022
    Published: 1992
    Released on J-STAGE: March 27, 2006
    JOURNAL FREE ACCESS
    A gene amplification method of Mycobacterium tuberculosis DNA by the polymerase chain reaction (PCR) has been devised. A primer pair used in this study is 5'GTTGCCGTGGCGG TATCGG3' and 5'GCGACATTACGGGGCAGGTGG3', which brackets a 152-base region encoding the 65KD antigen, and a specific probe is 5'TTTGGGGTCATCTTTGGAGCG3'. The procedure could be completed within 2 days. The specificity and the sensitivity of the PCR for M. tuberculosis complex in identifying M. tuberculosis complex did not conflict with the conventional methods at all. Using this method, we could diagnose three cases of the disease, which had been very difficult to diagnose by the conventional methods, by detecting the DNA from the blood, liver biopsy specimen, lung aspirate, and pleural effusion.
    (Internal Medicine 31 : 1016-1022, 1992)
    Download PDF (1062K)
  • Yoshiharu MOTOO, Hideki OHTA, Takashi OKAI, Norio SAWABU
    1992Volume 31Issue 8 Pages 1023-1025
    Published: 1992
    Released on J-STAGE: March 27, 2006
    JOURNAL FREE ACCESS
    A 71-year-old female with amyotrophic lateral sclerosis (ALS) developed the syndrome of inappropriate secretion of antidiuretic hormone (SIADH) during respiratory failure due to atrophy of the respiratory muscles. Serum sodium concentration fell to 116 mEq/l and then returned to the normal range after water restriction and respiratory care. This is considered to be the first case report of ALS associated with SIADH.
    (Internal Medicine 31 : 1023-1025, 1992)
    Download PDF (202K)
  • Shinjiro MUNETA, Shuji SAKAI, Hiroshi FUKUDA, Yoichi IMAMURA, Isao MAT ...
    1992Volume 31Issue 8 Pages 1026-1031
    Published: 1992
    Released on J-STAGE: March 27, 2006
    JOURNAL FREE ACCESS
    A 26-year-old female with polysplenia syndrome is reported. She had numerous visceral anomalies including polysplenia, a short pancreas, a preduodenal portal vein, malrotation of the bowel, azygos continuation of the in erior vena cava, bilateral hyparterial bronchi and symmetrical liver lobation. Embryological and clinical considerations of polysplenia syndrome are described.
    (Internal Medicine 31 : 1026-1031, 1992)
    Download PDF (2172K)
  • Nobuo SAKURAI, Yasuo KOIKE, Yoshio HASHIZUME, Akira TAKAHASHI
    1992Volume 31Issue 8 Pages 1032-1037
    Published: 1992
    Released on J-STAGE: March 27, 2006
    JOURNAL FREE ACCESS
    A 67-year old man with prostate cancer showed Balint's syndrome, memory disturbance, anosognosia and hallucinations after having been comatose. Radiological findings indicated bilateral dural arteriovenous malformation (DAVM)and thrombosis at the bilateral transverse sinuses and superior sagittal sinus. Pathological findings showed abnormally dilated veins, diffuse neuron loss and gliosis in the parieto-occipital lobe. The chlormadinone and prostate cancer are speculated to have caused the dural sinus thrombosis which probably induced the DAVM.
    (Internal Medicine 31 : 1032-1037, 1992)
    Download PDF (2636K)
  • Hideki HIDAKA, Hitoshi YASUDA, Masashi KOBAYASHI, Ikuo HATANAKA, Masay ...
    1992Volume 31Issue 8 Pages 1038-1042
    Published: 1992
    Released on J-STAGE: March 27, 2006
    JOURNAL FREE ACCESS
    A family with multiple spinal xanthomas and sitosterolemia is described. A 48-year-old woman presented with paraplegia due to multiple intradural extramedullary tumors. The patient also showed marked tendon xanthomas and analysis of sterol composition in both plasma and the xanthoma established the diagnosis of the rare inherited metabolic disease, sitosterolemia and xanthomatosis. Two other siblings in the family presented with marked tendon xanthomas and coronary atherosclerosis, but did not show any neurological signs or symptoms. Magnetic resonance imaging (MRI) study revealed multiple intradural extramedullary tumors in spinal canals of the proband and her sister, but not in the other affected sibling (brother). This is the first report of familial occurrence of multiple extramedullary spinal tumors due to the inherited metabolic abnormality.
    (Internal Medicine 31 : 1038-1042, 1992)
    Download PDF (946K)
  • Akihiro ISHIDA, Kazuyoshi SAKAI, Masayoshi AJIOKA, Tetsuo HIRAMATSU, Y ...
    1992Volume 31Issue 8 Pages 1043-1046
    Published: 1992
    Released on J-STAGE: March 27, 2006
    JOURNAL FREE ACCESS
    A 54-year-old man presented with recurrent hemoptysis of one year duration. Computed tomography (CT) and magnetic resonance imaging (MRI) demonstrated a saccular aneurysm of the ascending aorta. The aneurysm was intraoperatively found to have formed on the superior surface of the site of aortotomy suture placed during previous repair of rupture of the sinus of Valsalva and to have a fistulous communication to the lung. CT and MRI were very useful in the diagnosis of the aneurysmas the cause of hemoptysis.
    (Internal Medicine 31 : 1043-1046, 1992)
    Download PDF (859K)
  • Shigeaki MUTO, Yasushi ASANO, Hitoaki OKAZAKI, Shogo KANO
    1992Volume 31Issue 8 Pages 1047-1051
    Published: 1992
    Released on J-STAGE: March 27, 2006
    JOURNAL FREE ACCESS
    The pathogenesis of renal potassium wasting and hypokalemia in classic renal tubular acidosis (type 1 RTA) remains uncertain. The prevailing theory is that K+-Na+ exchange is stimulated due to an inability of the distal tubule to establish a normal steep lumen-peritubular H+ gradient. We encountered a 42-year-old woman with type 1 RTA associated with Sjogren's syndrome, in whom renal potassium wasting and hypokalemia persisted despite sustained correction of systemic acidosis with alkali therapy and increased intake of potassium. In addition, plasma renin activity was markedly increased and the serum aldosterone level was upper-normal despite the hypokalemia. Increased intake of sodium resulted in suppression on the serum aldosterone and correction of renal potassium wasting and hypokalemia. This case shows that secondary hyperaldosteronism, possibly due to an impairment of sodium conservation in the distal tubule, may contribute to the loss of potassium from the distal tubule even after the correction of acidosis.
    (Internal Medicine 31 : 1047-1051, 1992)
    Download PDF (469K)
  • Morihiro OKAZAKI, Hikaru KITANI, Takashi MIFUNE, Fumihiro MITSUNOBU, S ...
    1992Volume 31Issue 8 Pages 1052-1055
    Published: 1992
    Released on J-STAGE: March 27, 2006
    JOURNAL FREE ACCESS
    A 58-year-old fanner was admitted to our hospital because of repeated episodes of anaphylaxis. He had experienced 12 episodes of anaphylactic shock over the previous 17 years. These attacks included three episodes of bee sting. In general, the episodes occurred during farm work (exercise) and within two hours of eating cake in the afternoon. Because an immediate skin reaction to wheat flour was highly positive, a diagnosis of wheat allergy was considered. These findings suggested that his illness was consistent with food-dependent exercise-induced anaphylaxis.
    (Internal Medicine 31 : 1052-1055, 1992)
    Download PDF (283K)
  • Keiji YOSHIOKA, Hiroyuki SHIMIZU, Sadayoshi YOKOO, Hiromu ANDACHI
    1992Volume 31Issue 8 Pages 1056-1059
    Published: 1992
    Released on J-STAGE: March 27, 2006
    JOURNAL FREE ACCESS
    A 62-year-old man was admitted because of paresis of the legs and a bleeding tendency. He was diagnosed as metastatic bone cancer with disseminated intravascular coagulation (DIC). In spite of treatment, his general condition progressively deteriorated and he died of respiratory failure 13 days later. Autopsy revealed a carcinoma in adenoma in the rectum. Although the depth of cancer invasion was confined to the submucosal layer, disseminated carcinomatosis of the bone marrow and tumor emboli in blood vessels of the lung were present.
    (Internal Medicine 31 : 1056-1059, 1992)
    Download PDF (1392K)
  • Masakatsu UCHIHARA, Toshihiko NOUCHI, Teruo HARANO, Michio YAMANE, Hid ...
    1992Volume 31Issue 8 Pages 1060-1064
    Published: 1992
    Released on J-STAGE: March 27, 2006
    JOURNAL FREE ACCESS
    A 64-year-old man was admitted due to ascites. Laboratory data showed hemoglobin 6.7g/dl, mean corpuscular volume 82fl, and ferritin 2, 360ng/ml. Liver biopsy showed hemochromatosis. The diagnosis of β-halassemia was suggested by a decreased ratio of β/α-globin synthesis in vitro (0.26). Cloning of the β-globin gene showed A-to-G mutation in the first base of the ATA box. He was confirmed to be homozygous for this specific allele by β-gene complex analysis and analysis of Southern blot hybridization of the a- and β-globin genes. His two sons were confirmed to be heterozygous for this allele.
    (Internal Medicine 31 : 1060-1064, 1992)
    Download PDF (1091K)
  • Rika ARAKI, Teruo SHIMA, Hiroyuki GOTO, Ichiro IMOTO, Masaru BABA, Mor ...
    1992Volume 31Issue 8 Pages 1065-1068
    Published: 1992
    Released on J-STAGE: March 27, 2006
    JOURNAL FREE ACCESS
    A 59-year-old woman was admitted with scleritis, sinusitis, skin eruptions, nodular lesions of both lung fields in chest X-ray films and renal failure. Skin biopsy and elevation of the titer of anti-neutrophil cytoplasmic antibody confirmed Wegener's granulomatosis. A right nodular goiter was palpated and a diagnosis of thyroid cancer was made based on aspiration cytology. Although combined therapy with cyclophosphamide and corticosteroid was started and the Wegener's granulomatosis improved and disappeared except for the renal lesion, the renal failure worsened and she died. Apparently only 2 cases of Wegener's granulomatosis complicated with carcinoma as in this case have been reported.
    (Internal Medicine 31 : 1065-1068, 1992)
    Download PDF (997K)
  • Hirotaka TATSUKAWA, Junichi OKUDA, Morihiko KONDOH, Miho INOUE, Satosh ...
    1992Volume 31Issue 8 Pages 1069-1072
    Published: 1992
    Released on J-STAGE: March 27, 2006
    JOURNAL FREE ACCESS
    We encountered a case of malignant hyperthermia caused by intravenous lidocaine which had been administered as treatment for a ventricular arrhythmia. The patient, a 72-year-old male, was admitted with chronic renal failure and aortic valvular stenosis. His chronic renal failure progressed, and congestive heart failure developed, and ventricular arrhythmias occurred frequently. For the treatment of these arrhythmias, lidocaine was injected and continuous infusion was started. Despite initial improvement in symptoms and laboratory data following hemofiltration, refractory ventricular tachycardia occurred. The patient was treated with large doses of lidocaine. His body temperature rose to a maximumof 41.7°C, and generalized muscular twitching was observed before he lost consciousness. Serum and urinary myoglobin levels became elevated. This abnormally high fever was relieved only by dantrolene sodium. After we madea diagnosis of malignant hyperthermia and stopped the lidocaine infusion, the high fever resolved quickly. It is important to note that malignant hyperthermia can be caused by lidocaine and amide-linked local anesthetics.
    (Internal Medicine 31: 1069-1072, 1992)
    Download PDF (309K)
feedback
Top