Characterization of the Cytosolic β-N-Acetylglucosaminidase from Bifidobacterium longum subsp. longum

Abstract

The BLLJ_1391 protein from Bifidobacterium longum subsp. longum JCM1217, a cytosolic β-N-acetylglucosaminidase belonging to glycoside hydrolase family (GH) 20, hydrolyzed lacto-N-triose II (LNTri) as well as chitin oligosaccharides. Its reaction was found to follow a substrate-assisted mechanism with anomeric retention, which is common for GH 20 enzymes. Homologous enzymes are found in genomic sequences of B. longum subsp. infantis, Bifidobacterium bifidum, and Bifidobacteium breve, all of which are infant gut-associated species of Bifidobacterium. The distribution resembles that of 1,3-β-galactosyl-N-acetylhexosamine phosphorylase, suggesting that the enzyme plays a role in metabolism of human milk oligosaccharides by hydrolyzing LNTri generated via the cytosolic hydrolysis of lacto-N-tetraose (LNT) by LNT 1,3-β-galactosidase.

Abbreviations

GH, glycoside hydrolase family; GlcNAc_n, β-1,4 linked homooligosaccharide of GlcNAc with degree of polymerization of n; GLNBP, 1,3-β-galactosyl-N-acetylhexosamine phosphorylase; GNB, galacto-N-biose (Galβ1,3GlcNAc); HMOs, human milk oligosaccharides; LNB, lacto-N-biose I (Galβ1,3GlcNAc); LNT, lacto-N-tetraose (Galβ1,3GlcNAcβ1,3Galβ1,4Glc); LNTri, lacto-N-triose II (GlcNAcβ1,3Galβ1,4Glc); MU-GlcNAc, 4-methylumbelliferyl 2-acetamido-2-deoxy-β-D-glucopyranoside; MU-GlcN (TAC), 4-methylumbelliferyl 2-thioacetamido-2-deoxy-β-D-glucopyranoside; pNP-GalNAc, 4-nitrophenyl 2-acetamido-2-deoxy-β-D-galactopyranoside; pNP-Glc, 4-nitrophenyl β-D-glucopyranoside; pNP-GlcNAc, 4-nitrophenyl 2-acetamido-2-deoxy-β-D-glucopyranoside; pNP-LNB, 4-nitrophenyl β-D-galactopyranosyl-(1→3)-2-acetamido-2-deoxy-β-D-glucopyranoside.

INTRODUCTION

Several species of the genus Bifidobacterium are known as symbiotic bacteria in the human intestine, and their intestinal colonization is beneficial for human health. They produce multiple enzymes to utilize various saccharides as an important source of carbon and nitrogen.¹⁾ These enzymes are indispensable for bacterial settlement in the intestine.

Intestinal colonization of bifidobacteria is particularly important for the health of infants. The distribution of the species colonized in the gut of an infant is different from that in the gut of an adult. The difference can be explained based on the enzymes of the species present in infants to utilize human milk oligosaccharides (HMOs). HMOs are a mixture of oligosaccharides comprising more than 130 different molecules assignable to one of the 13 core structures with or without fucosylation and/or sialylation modifications.²⁾ Most bifidobacterial species that are often isolated from infant feces, such as Bifidobacterium bifidum, Bifidobacterium longum subsp. infantis, B. longum subsp. longum and Bifidobacterium breve, possess intracellular 1,3-β-galactosyl-N-acetylhexosamine phosphorylase (GLNBP) to catabolize lacto-N-biose I (LNB, Galβ1,3GlcNAc)^{3) 4)} existing at the non-reducing end of predominant core structures of HMOs.^{5) 6)} Among these species, B. bifidum and B. longum subsp. infantis grow in a medium containing HMOs as the sole carbon source.⁷⁾ B. bifidum possess extracellular enzymes to liberate the core structures from HMOs^{8) 9) 10)} and generate LNB from lacto-N-tetraose (LNT, Galβ1,3GlcNAcβ1,3Galβ1,4Glc), the major core structure and one of the major components of HMOs, by the extracellular lacto-N-biosidase.¹¹⁾ LNB is transported into the cell by a specific transporter^{12) 13)} and is phosphorolyzed by GLNBP. On the other hand, B. longum subsp. infantis ingests intact HMOs and hydrolyzes them into monosaccharides by intracellular exolytic enzymes.^{14) 15)}

B. longum subsp. infantis has GLNBP but does not employ it for utilization of HMOs owing to the lack of lacto-N-biosidase.^{14) 16)} The 1,3-β-galactosyl linkage at the non-reducing end of LNT is resistant to most β-galactosidases, but the discovery of cytosolic LNT exo-1,3-β-galactosidase hydrolyzing LNT into galactose and lacto-N-triose II (LNtri, GlcNAcβ1,3Galβ1,4Glc) clarified HMOs utilization within B. longum subsp. infantis.¹⁷⁾ It should be noted that LNTri is a trace component in HMOs even though it is a key intermediate in the biosynthesis of HMOs.²⁾ Most infant-type bifidobacteria, such as B. longum subsp. longum, B. bifidum and B. breve, possess the homologous gene, indicating that the intracellular hydrolysis of LNT is common among such strains.¹⁷⁾ This finding may reflect that a lacto-N-biosidase negative strain utilizes only LNT in HMOs.⁷⁾ Thus, investigating cytosolic hydrolysis of LNtri by β-N-acetylhexosaminidase is important to understand the metabolism of HMOs by bifidobacteria.

Two possible genes encoding β-N-acetylhexosaminidase are found to be encoded in the genomic sequence of B. longum subsp. longum JCM1217.¹⁸⁾ One (BLLJ_0594) is an extracellular protein belonging to the glycoside hydrolase family (GH) 3 within the CAZy database,¹⁹⁾ evaluated by the presence of a signal peptide using the SignalP server.²⁰⁾ The other (BLLJ_1391) is an intracellular protein belonging to the GH 20, a family containing β-N-acetylhexosaminidases and lacto-N-biosidases. In the present study, the characterization of the cytosolic GH 20 enzyme is described.

MATERIALS AND METHODS

Materials. The genomic DNA of B. longum subsp. longum JCM1217 was prepared as reported previously.³⁾ The following enzymes were obtained commercially: restriction endonucleases (New England BioLabs Inc., Beverly, USA) and KODplus DNA polymerase (KOD; Toyobo Co., Ltd., Osaka, Japan). Chitin oligomers (GlcNAc_n, n = 2-6) were purchased from Seikagaku Kogyo Co. (Tokyo, Japan). Chromogenic substrates, 4-nitrophenyl β-glycosides of LNB (pNP-LNB), GlcNAc (pNP-GlcNAc), GalNAc (pNP-GalNAc) and Glc (pNP-Glc), and 4-methylumbelliferyl 2-acetamido-2-deoxy-β-D-glucoside (MU-GlcNAc) were obtained from Sigma-Aldrich Corporation (St. Louis, USA). LNTri was prepared from lactose and UDP-GlcNAc by using a GlcNAc transferase from Helicobacter pylori.²¹⁾ 4-Methylumbelliferyl 2-thioacetamido-2-deoxy-β-D-glucoside {MU-GlcN(TAc)} was synthesized according to the standard procedure.²²⁾ Other reagents were of analytical grade and were obtained commercially. Structures of oligosaccharides used are illustrated in Fig. 1.

Fig. 1

Structures of oligosaccharides used in this study.

Cloning of the BLLJ_1391 gene. PCR primers (forward; GGAACACATATGCCCACATTCGAATATAAGGCTGATGCC, reverse; GCGAGGCGGCCGCTAGCGCTCCCCTACGCAATATGTCC, underlined region shows additional restriction endonuclease site for cloning) were designed for the BLLJ_1391 gene of B. longum JCM1217. PCR was performed with these primers and KOD-plus polymerase (Toyobo Co., Ltd.), using an amplification program consisting of 25 cycles of denaturation at 96°C for 30 s, annealing at 53°C for 30 s, and extension at 68°C for 150 s. The PCR product was inserted into the pCR 2.1-TOPO vector using a TOPO TA cloning kit (Invitrogen Corporation, Carlsbad, USA) and cloned in Escherichia coli TOP10 (Invitrogen Corporation). The nucleotide sequence of the insert was confirmed using a BigDye terminator v3.1 cycle-sequencing kit and a 310 Genetic analyzer (Applied Biosystems Inc., Foster, USA). The cloning plasmid was prepared using Plasimidprep spin kit (GE Healthcare Ltd., Buckinghamshire, UK). After the treatment of the plasmid with NdeI and NotI, the gene fragment was ligated into the pET30b vector at the NdeI and NotI sites using a Ligation High DNA ligation kit (Toyobo Co., Ltd.). The expression plasmid was designed so that a His₆ tag sequence was added to the carboxyl terminus of the protein to facilitate purification. The plasmid DNA was used to transform E. coli BL21 (DE3).

Purification of recombinant BLLJ_1391 protein. The E. coli BL21 (DE3) harboring the expression plasmid was incubated in Luria broth (100 mL) containing 0.05 mg/mL kanamycin at 37°C until the A600 reached 0.6. Isopropyl β-D-thiogalactopyranoside was then added to give a final concentration of 1 mM and the cultures were incubated for 24 h at 25°C. Subsequently, the cells were collected by centrifugation. The expressed BLLJ_1391 protein was extracted from the wet cells (1 g) in 3 mL of 50 mM sodium phosphate buffer (pH 8.0) by sonication. The cell-free extract was loaded onto a Ni-NTA agarose (Qiagen N.V., Venlo, Netherlands) column (1×3 cm) and the protein was eluted with a stepwise gradient of imidazole (1, 10 ; 2, 20 ; 3, 250 mM) in 50 mM sodium phosphate buffer (pH 8.0) containing 0.3 M NaCl. The appropriate fractions were collected and the purity was checked by sodium dodecyl sulfate poly-acrylamide gel electrophoresis (SDS-PAGE).²³⁾ A BenchMark^TM Protein Ladder (Invitrogen Corporation) was used as a standard molecular marker for SDS-PAGE.

Protein concentrations were determined from the absorbance at 280 nm on the basis of theoretical molar absorption coefficients (120,625 M⁻¹ cm⁻¹) determined from the amino acid compositions of BLLJ_1391 protein.²⁴⁾

Enzyme assay. Enzyme activity was routinely determined by the hydrolysis of pNP-GlcNAc. The enzymatic reaction was performed using 50 mM sodium acetate buffer (pH 5.5) containing 1.3 mM of pNP-GlcNAc at 37°C. The hydrolysis of various 4-nitrophenyl glycosides was measured along with the increase in the rate of 4-nitrophenol release at 400 nm, after addition of an equal volume of 1 M Na₂CO₃ to reaction mixture. The hydrolysis of 4-methylumbelliferyl glycosides was monitored with a fluorescence detector (RF-550, Shimadzu Corporation, Kyoto, Japan) at 450 nm with excitation at 360 nm.

Kinetic analysis. To determine the apparent kinetic parameters, pNP-GlcNAc was subjected to hydrolysis in 50 mM sodium acetate buffer (pH 5.5) at 37°C. The initial rates were measured as described in the enzyme assay. The kinetic parameters were calculated by regressing the experimental data (substrate concentration range: 0.1−2 × K_m) with the Michaelis–Menten equation by the curve-fit method using Kaleidagraph^TM ver. 3.51 (Synergy Software Inc., Reading, USA).

Effects of pH and temperature on enzymatic activity. The enzymatic activity was measured under standard conditions of pNP-GlcNAc hydrolysis while changing the pH in the reaction mixture with 50 mM buffers. The buffer systems used were sodium acetate (pH 3.5−5.5), 3-morpholinopropanesulfonic acid-Na (pH 6.5−7.5), N-tris(hydroxymethyl)methyl-3-aminopropanesulfonic acid-Na (pH 8.0−9.0) and N-cyclohexyl-3-aminopropanesulfonic acid-Na (pH 9.7−11.0). The final pH values of the reaction solution were determined after addition of the enzyme and the substrates. The optimum temperature of the activity was determined under standard conditions.

Analysis of the anomeric form of the products. The anomeric forms of the hydrolytic product from 1.0 mM GlcNAc₃ and 1.6 mM GlcNAc₄ were determined using an isocratic HPLC method described below.²⁵⁾ The enzymatic reaction was performed using 25 mM sodium acetate buffer (pH 5.5) at 25°C with an enzyme concentration of 5.5 μM. After incubation for the appropriate time, an aliquot (10 μL) of the reaction solution was immediately loaded onto a TSK-GEL Amide-80 column (4.6 × 250 mm, Tosoh Corporation, Tokyo, Japan) and eluted with acetonitrile‒water (7:3 v/v) at a flow rate of 1.5 mL/min at 25°C, separating the GlcNAc oligomer anomers. The initial substrate and products were detected using a UV monitor (absorbance at 215 nm, SPD 7A, Shimadzu Corporation).

Degradation of LNTri and GlcNAc_n. Hydrolysis of LNTri and GlcNAc_n (n = 2‒6) was performed using 50 mM sodium acetate buffer (pH 5.5) at 30°C. Periodically, a portion of the reaction mixture was boiled for 5 min to inactivate the enzyme. The increases in GlcNAc were quantified by monitoring absorbance at 215 nm on HPLC using a TSK-GEL Amide-80 column and eluted with acetonitrile–water (7:3 v/v) at a flow rate of 1.5 mL/min at 80°C.

RESULTS

Basic properties.

Recombinant BLLJ_1391 protein was expressed in E. coli BL21 (DE3) and purified, yielding a 79-kDa protein via SDS-PAGE, as shown in Fig. 2. The enzyme was purified up to 10-fold, as shown in Table 1.

Fig. 2

SDS-PAGE of recombinant BLLJ_1391 protein.

Lane M, BenchMark^TM Protein Ladder (Invitrogen Corporation); 1, Crude extract from Escherichia coli BL21 (DE3) cells containing pET28–BLLJ_1391; 2, Purified recombinant BLLJ_1391 protein.

Table. 1

Purification of the recombinant BLLJ_1391 protein.

Enzyme activity was determined by hydrolytic reaction of 1.3 mM pNP-GlcNAc in 50 mM sodium acetate buffer (pH 5.5) at 37°C.

BLLJ_1391 efficiently hydrolyzed pNP-GlcNAc but did not hydrolyze pNP-LNB and LNT, clearly indicating that it was not a lacto-N-biosidase. The enzyme slightly hydrolyzed pNP-GalNAc (0.018 s⁻¹ at 0.11 mM), but the activity was negligible compared with pNP-GlcNAc (15 s⁻¹ at 0.11 mM), suggesting that it should be categorized as a β-N-acetylglucosminidase rather than a β-N-acetylhexosaminidase. The enzyme did not hydrolyze pNP-Glc.

The enzymatic properties as a function of pH and temperature were determined via the hydrolysis of pNP-GlcNAc (Fig.3). The optimum pH and temperature for optimum activity was 5.5 and 40°C, respectively. The S-v curve of pNP-GlcNAc hydrolysis by the enzyme indicates a typical Michaelis–Menten type relationship. The kinetic parameters were calculated to be k_cat = 200 ± 10 s⁻¹, K_m = 1.3 ± 0.1 mM, and k_cat /K_m = 160 ± 10 s⁻¹mM⁻¹.

Fig. 3

Activity of BLLJ_1391 at various pH and temperatures.

(A) The effect of pH on activity, (B) The effect of temperature on activity. The substrate concentration was 1.3 mM PNP-GlcNAc.

BLLJ_1391 hydrolyzed the oligosaccharides derived from both HMOs and chitin (LNTri and GlcNAc_n, respectively) to liberate GlcNAc from their non-reducing ends efficiently, as shown in Table 2. In comparison with the hydrolyses of a series of GlcNAc_n, the rate decreased with the increase in “n,” indicating that the enzyme preferred smaller chitin oligosaccharides.

Table. 2

Relative rates of hydrolysis of LNTri and GlcNAc_n by BLLJ_1391 protein.

Substrate concentrations were 0.67 mM, whereas the enzyme concentration was 80 nM.

Mechanism of the enzymatic reaction.

The anomeric composition of each degradation product of GlcNAc₃ and GlcNAc₄ by the BLLJ_1391 was analyzed by HPLC. The standard equilibrium ratios of α:β anomers for GlcNAc_n at 0 min were approximately 3:2. Figure 4 shows the HPLC profiles of the hydrolytic products from GlcNAc₃ and GlcNAc₄ by the BLLJ_1391. The ratio of the β-anomeric forms of GlcNAc in the reaction were much higher than that of the α-anomeric forms, indicating that the hydrolytic reaction proceeded with the retention of anomeric configuration of the glycosidic bond in the substrates. BLLJ_1391 hydrolyzed MU-GlcN(TAc) much slower than MU-GlcNAc (Fig. 5), suggesting that the hydrolysis proceeded with a substrate-assisted catalysis mechanism,^{22) 26) 27) 28)} as reported with other GH 20 enzymes.

Fig. 4

Anomeric analyses of the hydrolytic products from GlcNAc_n by BLLJ_1391.

(A) GlcNAc₃ (1.6 mM), (B) GlcNAc₄ (1.0 mM). Enzyme concentration was 5.5 μM. The reaction products were analyzed by a TSK-GEL Amide-80 column (4.6 × 250 mm, Tosoh Corporation), and eluted with acetonitrile-water (7 : 3 v/v) at a flow rate of 1.0 mL/min at 25°C.

Fig. 5

Time courses of hydrolysis of MU-GlcNAc and MU-GlcN(TAc) by BLLJ_1391.

Symbols indicate MU-GlcNAc (closed circle) and MU-GlcN(TAc) (open circles). Substrate concentrations were 0.063 mM. Enzyme concentration was 14 nM.

DISCUSSION

B. longum subsp. longum JCM 1217 possesses a single GH 20 enzyme. We have revealed that the enzyme is a β-N-acetylglucosminidase capable of utilizing both the oligosaccharides derived from HMOs and chitin. The distribution of GH 20 enzymes in genome-sequenced species of Bifidobacterium is shown in Table 3. All the other genome-sequenced strains of B. longum subsp. longum available on KEGG Organisms (http://www.genome.jp/kegg/catalog/org_list.html, accessed on April 16, 2013) possess a single GH 20 enzyme, which is highly homologous with BLLJ_1391. B. breve also possesses a single homologous GH 20 enzyme. B. longum subsp. infantis possesses three intracellular GH 20 enzymes, all of which were characterized to hydrolyze both LNTri and GlcNAc₂.²⁹⁾ B. bifidum possesses four GH 20 proteins, three of which are extracellular enzymes. One of the extracellular GH 20 enzymes (BbhI) hydrolyzed LNTri but not GlcNAc₂.³⁰⁾ Another extracellular GH 20 enzyme (BbhII) showed weak hydrolytic activities on pNP-GlcNAc and mucin-type core 2 trisaccharide.³⁰⁾ The other enzyme (LnbB) is a lacto-N-biosidase, which degrades lacto-N-tetraose into lactose and LNB.¹¹⁾ The intracellular GH 20 protein (BbhIII) has yet to be characterized. On the other hand, none of the genome-sequenced strains of Bifidobacterium animalis, asolescentis, dentium and asteroides, which are not habitants of intestine of human infant, possesses GH 20 protein.

Table. 3

Distribution of GH 20 enzymes in genome-sequenced strains of the genus Bifidobacterium.

*Numbers in the parentheses indicate the number of cytosolic enzymes. **All the three enzymes were characterized (Ref. 29)). ***The three extracellular enzymes of another strain, B. bifidum JCM1254, were characterized (Ref. 11), 30)).

The phylogenetic tree of the Pfam Glyco_hydro_20 (PF00728) sequences of the GH 20 enzymes of Bifidobacterium species is shown in Fig. 6. The intracellular enzymes form a cluster sharing identities higher than 55%. On the other hand, each extracellular enzyme of B. bifidum forms a distinct clade. The enzymes in the cluster are supposed to hydrolyze both LNTri and GlcNAc₂ because all the three B. longum subsp. infantis enzymes²⁹⁾ and BLLJ_1391, all of which hydrolyze both, located at various positions in the cluster.

Fig. 6

Phylogenetic tree of GH 20 enzymes of various species of the genus Bifidobacterium

Unrooted trees were constructed using the ClustalW program with the amino acid sequences of Pfam: Family Glyco_hydro_20.

The distribution of the homologous protein of BLLJ_1391 in bifidobacteria seems similar with that of GLNBP,⁵⁾ the key enzyme for the utilization of HMOs. These strains are often isolated from infant feces. LNT is one of the major components of HMOs^{2) 31)} and some bifidobacterial strains such as B. longum subsp. longum and B. breve consume only LNT in HMOs.⁷⁾ LNT is possibly transported into the cell through the galacto-N-biose (GNB, Galβ1,3GalNAc)/LNB transporter in the absence of GNB and/or LNB, since the solute binding protein binds LNT with a significant binding constant even though the value is much smaller than those of GNB and LNB.^{7) 12)} The utilization of LNT is explained with the existence of the intracellular GH42 LNT 1,3-β-galactosidase¹⁷⁾ generating LNTri. Thus, the roles of the intracellular GH 20 enzymes in bifidobacteria are related based on their ability to utilize HMOs by degrading LNTri into lactose and GlcNAc.

BLLJ_1391 hydrolyzes GlcNAc_n as well as LNTri, suggesting that it might be involved in utilizing chitin. Chitinases are normally categorized in either GH 18 or GH 19. B. longum subsp. longum JCM1217 does not possess any gene encoding a GH 18 or GH 19 protein, suggesting that the strain lacks chitinase activity. On the other hand, GH 18 genes are found in the genomic sequence of B. longum subsp. infantis and B. breve, suggesting that the intracellular GH 20 enzymes in these species may play dual roles for utilizing LNTri and GlcNAc_n.

ACKNOWLEDGMENTS

This work was supported in part by a grant from the Program for Promotion of Basic Research Activities for Innovative Biosciences (PROBRAIN). We are grateful to Ms. M. Kiriya for technical assistance during the course of this study.

REFERRENCES

• 1)  A. Klijn, A. Mercenier and F. Arigoni: Lessons from the genomes of bifidobacteria. FEMS Microbiol. Rev., 29, 491‒509 (2005).
• 2)  A. Kobata: Structures and application of oligosaccharides in human milk. Proc. Jpn. Acad. Ser. B Phys. Biol. Sci., 86, 731‒747 (2010).
• 3)  M. Kitaoka, J. Tian and M. Nishimoto: Novel putative galactose operon involving lacto-N-biose phosphorylase in Bifidobacterium longum. Appl. Environ. Microbiol., 71, 3158‒3162 (2005).
• 4)  M. Nishimoto and M. Kitaoka: Identification of N-acetylhexosamine 1-kinase in the complete lacto-N-biose I/galacto-N-biose metabolic pathway in Bifidobacterium longum. Appl. Environ. Microbiol., 73, 6444‒6449 (2007).
• 5)  J.Z. Xiao, S. Takahashi, M. Nishimoto, T. Odamaki, T. Yaeshima, K. Iwatsuki and M. Kitaoka: Distribution of in vitro fermentation ability of lacto-N-biose I, a major building block of human milk oligosaccharides, in bifidobacterial strains. Appl. Environ. Microbiol., 76, 54‒59 (2010).
• 6)  S. Fushinobu: Unique sugar metabolic pathways of bifidobacteria. Biosci. Biotechnol. Biochem., 74, 2374‒2384 (2010).
• 7)  S. Asakuma, E. Hatakeyama, T. Urashima, E. Yoshida, T. Kata­yama, K. Yamamoto, H. Kumagai, H. Ashida, J. Hirose and M. Kitaoka: Physiology of consumption of human milk oligosaccharides by infant gut-associated bifidobacteria. J. Biol. Chem., 286, 34583‒34592 (2011).
• 8)  H. Ashida, A. Miyake, M. Kiyohara, J. Wada, E. Yoshida, H. Kumagai, T. Katayama and K. Yamamoto: Two distinct α-L-fucosidases from Bifidobacterium bifidum are essential for the utilization of fucosylated milk oligosaccharides and glycoconjugates. Glycobiology, 19, 1010‒1017 (2009).
• 9)  T. Katayama, A. Sakuma, T. Kimura, Y. Makimura, J. Hiratake, K. Sakata, T. Yamanoi, H. Kumagai and K. Yamamoto: Molecular cloning and characterization of Bifidobacterium bifidum 1,2-α-L-fucosidase (AfcA), a novel inverting glycosidase (glycoside hydrolase family 95). J. Bacteriol., 186, 4885‒4893 (2004).
• 10)  M. Kiyohara, K. Tanigawa, T. Chaiwangsri, T. Katayama, H. Ashida and K. Yamamoto: An exo-α-sialidase from bifidobacteria involved in the degradation of sialyloligosaccharides in human milk and intestinal glycoconjugates. Glycobiology, 21, 437‒447 (2011).
• 11)  J. Wada, T. Ando, M. Kiyohara, H. Ashida, M. Kitaoka, M. Yamaguchi, H. Kumagai, T. Katayama and K. Yamamoto: Bifidobacterium bifidum lacto-N-biosidase, a critical enzyme for the degradation of human milk oligosaccharides with a type 1 structure. Appl. Environ. Microbiol., 74, 3996‒4004 (2008).
• 12)  R. Suzuki, J. Wada, et al.: Structural and thermodynamic analyses of solute-binding protein from Bifidobacterium longum specific for core 1 disaccharide and lacto-N-biose I. J. Biol. Chem., 283, 13165‒13173 (2008).
• 13)  J. Wada, R. Suzuki, S. Fushinobu, M. Kitaoka, T. Wakagi, H. Shoun, H. Ashida, H. Kumagai, T. Katayama and K. Yama­moto: Purification, crystallization and preliminary X-ray analysis of the galacto-N-biose-/lacto-N-biose I-binding protein (GL-BP) of the ABC transporter from Bifidobacterium longum JCM1217. Acta Crystallogr. Sect. F Struct. Biol. Cryst. Commun., 63, 751‒753 (2007).
• 14)  D.A. Sela, J. Chapman, et al.: The genome sequence of Bifidobacterium longum subsp. infantis reveals adaptations for milk utilization within the infant microbiome. Proc. Natl. Acad. Sci. USA, 105, 18964‒18969 (2008).
• 15)  D. Garrido, J.H. Kim, J.B. German, H.E. Raybould and D.A. Mills: Oligosaccharide binding proteins from Bifidobacterium longum subsp. infantis reveal a preference for host glycans. PLoS One, 6, e17315 (2011).
• 16)  M. Kitaoka: Bifidobacterial enzymes involved in the metabolism of human milk oligosaccharides. Adv. Nutr., 3, 422S‒429S (2012).
• 17)  E. Yoshida, H. Sakurama, M. Kiyohara, M. Nakajima, M. Kita­oka, H. Ashida, J. Hirose, T. Katayama, K. Yamamoto and H. Kumagai: Bifidobacterium longum subsp. infantis uses two different β-galactosidases for selectively degrading type-1 and type-2 human milk oligosaccharides. Glycobiology, 22, 361‒368 (2012).
• 18)  S. Fukuda, H. Toh, et al.: Bifidobacteria can protect from enteropathogenic infection through production of acetate. Nature, 469, 543‒547 (2011).
• 19)  B.L. Cantarel, P.M. Coutinho, C. Rancurel, T. Bernard, V. Lombard and B. Henrissat: The Carbohydrate-Active EnZymes database (CAZy): an expert resource for glycogenomics. Nucleic Acids Res., 37, D233‒238 (2009).
• 20)  J.D. Bendtsen, H. Nielsen, G. von Heijne and S. Brunak: Improved prediction of signal peptides: SignalP 3.0. J. Mol. Biol., 340, 783‒795 (2004).
• 21)  S.M. Logan, E. Altman, et al.: Novel biosynthetic functions of lipopolysaccharide rfaJ homologs from Helicobacter pylori. Glycobiology, 15, 721‒733 (2005).
• 22)  S. Knapp, D. Vocadlo, Z. Gao, B. Kirk, J. Lou and S.G. Withers: NAG-thiazoline, an N-acetyl-β-hexosaminidase inhibitor that implicates acetamido participation. J. Am. Chem. Soc., 118, 6804‒6805 (1996).
• 23)  U.K. Laemmli: Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature, 227, 680‒685 (1970).
• 24)  C.N. Pace, F. Vajdos, L. Fee, G. Grimsley and T. Gray: How to measure and predict the molar absorption coefficient of a protein. Protein Sci., 4, 2411‒2423 (1995).
• 25)  D. Koga, T. Yoshioka and Y. Arakane: HPLC Analysis of anomeric formation and cleavage pattern by chitinolytic enzyme. Biosci. Biotechnol. Biochem., 62, 1643‒1646 (1998).
• 26)  I. Tews, A.C. Terwisscha van Scheltinga, A. Perrakis, K.S. Wilson and B.W. Dijkstra: Substrate-assisted catalysis unifies two families of chitinolytic enzymes. J. Am. Chem. Soc., 119, 7954‒7959 (1997).
• 27)  Y. Honda, M. Kitaoka and K. Hayashi: Kinetic evidence related to substrate-assisted catalysis of family 18 chitinases. FEBS Lett., 567, 307‒310 (2004).
• 28)  S.J. Williams, B.L. Mark, D.J. Vocadlo, M.N. James and S.G. Withers: Aspartate 313 in the Streptomyces plicatus hexosaminidase plays a critical role in substrate-assisted catalysis by orienting the 2-acetamido group and stabilizing the transition state. J. Biol. Chem., 277, 40055‒40065 (2002).
• 29)  D. Garrido, S. Ruiz-Moyano and D.A. Mills: Release and utilization of N-acetyl-D-glucosamine from human milk oligosaccharides by Bifidobacterium longum subsp. infantis. Anaerobe, 18, 430‒435 (2012).
• 30)  M. Miwa, T. Horimoto, M. Kiyohara, T. Katayama, M. Kitaoka, H. Ashida and K. Yamamoto: Cooperation of β-galactosidase and β-N-acetylhexosaminidase from bifidobacteria in assimilation of human milk oligosaccharides with type 2 structure. Glycobiology, 20, 1402‒1409 (2010).
• 31)  S. Asakuma, T. Urashima, M. Akahori, H. Obayashi, T. Naka­mura, K. Kimura, Y. Watanabe, I. Arai and Y. Sanai: Variation of major neutral oligosaccharides levels in human colostrum. Eur. J. Clin. Nutr., 62, 488‒494 (2008).