Carbonate apatite increases gene expression of osterix and bone morphogenetic protein 2 in the alveolar ridge after socket grafting

Abstract

Purpose: After tooth extraction, preservation of the alveolar ridge by socket grafting attenuates bone resorption. Runt-related transcription factor 2 (RUNX2) and SP7/Osterix (OSX) are transcription factors playing an important role in osteoblast differentiation. The purpose of this study was to evaluate the effects of carbonate apatite (CO₃Ap) on osteoblast-related gene and protein expression after socket grafting.

Methods: Alveolar bone and new bone after CO₃Ap grafting were collected at the time of implant placement. Levels of mRNA for RUNX2, SP7/OSX, bone morphogenetic protein 2 (BMP2), BMP7 and platelet derived growth factor B were determined by real-time PCR. Immunostaining was performed using antibodies against RUNX2, SP7/OSX, vimentin and cytokeratin. To evaluate bone resorption rates, cone-beam CT (CBCT) imaging was performed after socket grafting and before implant placement.

Results: CBCT imaging showed that the average degree of bone resorption at the CO₃Ap graft site was 7.15 ± 3.79%. At the graft sites, levels of SP7/OSX and BMP2 mRNA were significantly increased. Replacement of CO₃Ap with osteoid was evident histologically, and in the osteoid osteoblast-like cells were stained for SP7/OSX and vimentin.

Conclusion: These results show that gene expression of both SP7/OSX and BMP2 can be induced by CO₃Ap, suggesting that increased expression of SP7/OSX and vimentin may be involved in the BMP pathway.

Introduction

Tooth extraction sockets heal spontaneously without any intervention. However, when implants are placed in the alveolar ridge after tooth extraction, it is difficult to select the ideal position, implant diameter and length in areas where bone resorption has occurred. Araújo et al. observed morphological changes in the alveolar ridges of dogs 8 weeks after tooth extraction and reported that the buccal alveolar crest was 2 mm lower than the lingual bone crest [1]. Using cone-beam computed tomography (CBCT), Chappuis et al. found that – after anterior tooth extraction – the human buccal bone was absorbed 7.5 mm vertically and 0.8 mm horizontally on average [2]. Implant placement becomes difficult if significant loss of the alveolar ridge occurs after tooth extraction. Therefore, dental implants can only be placed after socket grafting or guided bone regeneration (GBR) has been performed, and the grafted bone is stabilized. Alveolar ridge preservation by socket grafting minimizes morphological changes and volume loss due to alveolar bone resorption immediately after tooth extraction, and for this bone grafting materials are required [3]. Recently, carbonated apatite (CO₃Ap) granules have been developed and used for maxillary sinus floor elevation and GBR to obtain the required bone height for placement of dental implants [4]. Evaluation of the efficacy and safety of CO₃Ap granules for two-stage maxillary sinus floor elevation using radiographic and histological examination of bone biopsies has demonstrated excellent biocompatibility and replacement by bone [5]. When human bone marrow mesenchymal stem cells (hBMCs) are cultured on hydroxyapatite (HA) or CO₃Ap discs, the growth rate of hBMCs is significantly faster than on cell culture dishes, and the gene expression of osteoblast differentiation markers such as alkaline phosphatase and osteocalcin is significantly increased [6]. Maxillary sinus floor elevation has been performed using HA, β-tricalcium phosphate (β-TCP) or deproteinized bovine bone mineral, and new bone tissue has been collected from the graft sites at the time of implant placement to detect changes in gene expression. This has revealed increases in the expression of runt-related transcription factor 2 (RUNX2), a key transcription factor associated with osteoblast differentiation, at sites of engraftment of deproteinized bovine bone mineral, in comparison to HA and β-TCP [7]. Osterix (OSX, gene symbol: SP7) is another transcription factor downstream of RUNX2 that is essential for osteoblast differentiation [8]. Bone morphogenetic protein 2 (BMP2) is a potent osteoinductive factor, and has been widely reported to significantly promote osteogenic differentiation and new bone formation of mesenchymal stem cells (MSCs) [9]. Platelet derived growth factor (PDGF) acts as a potent mitogen in a wide range of cell types, including fibroblasts, smooth muscle and bone marrow stromal cells [10]. Vimentin is an intermediate filament characteristic of mesenchymal cells and a major cytoskeletal protein distributed in various cells such as fibroblasts, vascular endothelial cells, smooth and striated muscle cells, osteoblasts, chondrocytes, and nerve sheath cells, which constitute connective tissues [11]. No previous studies have investigated the expression of the osteoblast-related transcription factors, BMP2, PDGF and vimentin in newly generated alveolar bone after CO₃Ap grafting.

The purpose of this study was to investigate the biochemical and histological characteristics of new bone after CO₃Ap grafting.

Materials and Methods

Patient selection

The study subjects included 13 patients (7 males and 6 females) in an alveolar bone harvesting control group, and 18 patients (6 males and 12 females) in a CO₃Ap graft group. Patients in the control group already had edentulous alveolar ridges at the time of their visit and requested implant treatment of those areas. Patients in the CO₃Ap graft group had undergone tooth extraction due to tooth fracture or severe periodontitis and CO₃Ap socket grafting at the time of tooth extraction, having waited an average of 6.9 months for healing to occur. Patients in the control group had received initial periodontal therapy for an average of 6 months before starting the implant treatment. The mean age of the patients was 60 years, ranging from 38 to 83 years (Table 1). This study was approved by the Institutional Internal Review and Ethics Board of Nihon University School of Dentistry at Matsudo (EC20-25). All participants provided written informed consent. Systemic and local exclusion criteria were defined as any factors that might interfere with dental implant surgery, such as poor liver or kidney function, heart disease, diabetes, or poor oral hygiene.

Table 1 Characteristics of patients in the alveolar bone harvesting control group and CO₃Ap graft group

	Control group	CO3Ap graft group
Males	7	6
Females	6	12
Total	13	18
Age	58.4 ± 12.5	60.7 ± 17.8
Healing period after socket grafting (months)		6.9 ± 2.7
Degree of bone resorption (%)		7.15 ± 3.79
Implant placement sites where bone harvested	Alveolar bone	CO3Ap graft sites
Maxillary anteriors	0	0
Maxillary premolars	1	5
Maxillary molars	1	5
Mandibular anteriors	0	0
Mandibular premolars	3	2
Mandibular molars	8	6

Carbonate apatite (CO₃Ap). Error bars indicate ± SD (n = 13; Alveolar bone, n = 18; CO₃Ap graft)

 

CBCT measurements

CBCT scans were taken after socket grafting and at the time of implant placement (7 months after socket grafting) for radiographic measurement of vertical bone height and thickness of the buccal bone plate, and the results were processed using an open source software package (Slicer 3.6., National Alliance for Medical Image Computing, Boston, MA, USA). In order to calculate degree of bone resorption (%), and to compare the vertical bone heights from the alveolar bone crest to the bottom of the extraction socket immediately after and 7 months after CO₃Ap socket grafting (Fig. 1A).

Sample collection

During dental implant surgery, alveolar bone was collected from the alveolar ridge, and new bone after CO₃Ap socket grafting was sampled using a trephine bar (Fig. 1B). Seven months after CO₃Ap socket grafting, new bone collected from the graft site was soaked in neutral formalin or RNAlater (Merck, Darmstadt, Germany) and stored at 4°C or -80°C.

Fig. 1 Schematic diagram for calculation of bone resorption rate and photograph of harvested bone and trephine bar

(A) CBCT slice section of CO₃Ap graft site at the baseline. To calculate the degree of bone resorption, alveolar bone crests were compared immediately after and 7 months after CO₃Ap socket grafting. Degree of bone resorption (%) = bone resorption / bottom of extraction socket from alveolar bone crest after Co₃AP graft × 100. (B) left panel: trephine bar used for bone harvesting. Right panel: Pictures of harvested bone 7 months after CO₃Ap grafting. Bottom scale is 1 mm.

Real-time polymerase chain reaction (PCR)

Bone samples were pulverized and used immediately for isolation of total RNA using TRIzol RNA isolation reagent (Thermo Fisher Scientific, Waltham, MA, USA). Total RNA was quantified at 260 nm using a Nanodrop spectrophotometer. cDNA was synthesized using a PrimeScript RT reagent kit (Takara Bio, Tokyo, Japan). Quantitative real-time PCR for RUNX2, SP7/OSX, BMP2, BMP7 and platelet derived growth factor B (PDGFB) was carried out using TB Green Fast qPCR Mix in a TP950 thermal cycler dice real-time system (Takara Bio). The final reaction mixture (25 µL) containing TB Green Fast qPCR Mix (12.5 µL), 10 µM forward and reverse primers (final concentration, 0.2 µM), and 25 ng (2.0 µL) cDNA was used for the amplification reactions. Relative gene expression was calculated by the ΔΔCt method using GAPDH as the reference gene. The primers used in this study are presented in Table 2.

Table 2 Primers used for real-time PCR analysis

Gene symbol	Primers
GAPDH	Fwd: GCACCGTCAAGGCTGAGAAC Rev: ATGGTGGTGAAGACGCCAGT
RUNX2	Fwd: ATGTGTTTGTTTCAGCAGCA Rev: TCCCTAAAGTCACTCGGTATGTGTA
SP7/OSX	Fwd: GCCATTCTGGGTTGGGTATC Rev: GAAGCCGGAGTGCAGGTATCA
BMP2	Fwd: ATGGATTCGTGGTGGAAGTG Rev: GTGGAGTTCAGATGATCAGC
PDGFB	Fwd: GATACTTTGCGCGCACACAC Rev: GGTTTTCTCTTTGCAGCGAGG
BMP7	Fwd: TGGCAGCATCCAATGAACAAGATCC Rev: TTCCTTTCGCACAGACACCAATGTG

Immunohistochemistry

Alveolar bone and new bone after CO₃Ap socket grafting were collected and fixed in 10% neutral buffered formalin and decalcified with 5% EDTA solution. After paraffin embedding, 5-μm-thick sections were prepared. Bone tissue sections were stained using hematoxylin-eosin (H&E). Immunostaining for RUNX2, SP7/OSX, vimentin and cytokeratin in bone tissues was performed using the EnVision + System, HRP (DAKO, Glostrup, Denmark). Bone tissue sections were manually dewaxed with xylene for 3 min and rehydrated through a graded ethanol series to water. Endogenous peroxidase activity was inactivated by treating the sections with Histo VT One, pH 7.0, for 20 min at 90°C. The sections were then washed three times in phosphate-buffered saline (PBS) for 5 min each time. After washing, the sections were incubated in Protein Block Serum-Free (DAKO) for 10 min. Antibodies against RUNX2 (ab192256; Abcam, Cambridge, UK), SP7/OSX (ab22552; Abcam), vimentin (ab92547; Abcam) and cytokeratin (clone AE1, MAB1612; Merck, Darmstadt, Germany) were applied and the tissue sections were incubated overnight at 4°C. Finally, the sections were washed twice for 5 min with PBS before incubation with REAL EnVision-HRP, Rabbit-Mouse (DAKO) for 30 min at room temperature and treated with Substrate Working Solution (CHROM) for 3 min, followed by counterstaining with Mayer’s hematoxylin.

Statistical analysis

Table 1 shows values of clinical parameters as mean ± standard deviation (SD). The significance of differences in levels of mRNA expression for bone-related transcription factors and growth factors between alveolar bone and new bone after CO₃Ap socket grafting was determined by the Steel-Dwass test and presented as the median and interquartile range. The level of significance was adjusted to 5%. Statistical analyses were performed using Statcel: the useful add-in software forms on Excel, 4th ed. (The Publisher OMS Ltd., Tokyo, Japan).

Results

Background of patients

The study participants comprised 13 patients (7 males and 6 females; mean age 58.4 ± 12.5 years) in the alveolar bone harvesting control group, and 18 patients (6 males and 12 females; mean age 60.7 ± 17.8 years) in the CO₃Ap graft group (Table 1). The average healing period after socket grafting was 6.9 ± 2.7 months, and the average degree of bone resorption after socket grafting was 7.15 ± 3.79% (Table 1). Implant placement sites where bone was harvested are shown in the lower part of Table 1. Vertical bone height and thickness of the buccal bone plate after CO₃Ap grafting and vertical bone height 7 months after CO₃Ap socket grafting are shown in Table 3. There was no correlation between the thickness of the buccal bone plate and the extent of bone resorption.

Table 3 Vertical bone height and thickness of the buccal bone plate after CO₃Ap grafting and vertical bone height 7 months after socket grafting in the CO₃Ap graft group

No. of Patients	Vertical bone height after CO3Ap grafting	Vertical bone height 7 months after socket grafting	Degree of bone resorption (%)	Thickness of the buccal bone plate after CO3Ap grafting
1	12.0	11.6	3.33	1.1
2	11.3	10.5	7.08	0.7
3	10.0	9.1	9.0	3.5
4	11.1	10.3	7.21	1.6
5	11.8	11.5	2.54	1.1
6	10.8	10.2	5.56	0.9
7	13.6	12.5	8.09	1.0
8	10.2	9.4	7.84	0.5
9	11.3	10.4	7.96	1.6
10	11.9	11.1	6.72	2.1
11	8.1	7.6	6.17	2.9
12	9.3	8.5	8.6	0.7
13	10.1	9.1	9.9	0.8
14	9.9	9.8	1.01	1.6
15	10.5	10.1	3.81	1.3
16	9.6	9.2	4.17	0.9
17	8.6	7.1	17.4	0.7
18	11.4	10.0	12.3	1.3
Mean ± SD	10.6 ± 1.3	9.9 ± 1.4	7.15 ± 3.79	1.35 ± 0.79

Carbonate apatite (CO₃Ap)

 

Expression of osteoblast-related genes

The effects of CO₃Ap socket grafting on the expression of osteoblast-related genes have never been investigated previously. In the CO₃Ap graft group, the levels of mRNA for SP7/OSX and BMP2 were significantly increased relative to the alveolar bone harvesting control group (Fig. 2A, C). However, the expression levels of RUNX2, PDGFB and BMP7 mRNA were not increased significantly (Figs. 2A, C, 3A). There were no differences in RUNX2, OSX, BMP2, PDGFB and BMP7 mRNA expression between the maxillary and mandibular bone graft sites (Figs. 2B, D, 3B).

Immunohistochemical analyses

Osteoid matrix formation was evident 7 months after CO₃Ap socket grafting, suggesting that the CO₃Ap had accelerated calcification in the area of new bone formation (Fig. 4A-C). Immunohistochemical analyses of sections of new bone after CO₃Ap socket grafting showed that cells around the osteoid were stained more strongly for SP/7OSX and vimentin (Fig. 4G-L) than for RUNX2 (Fig. 4D-F). Osteoid-related cells showed no staining for cytokeratin (Fig. 4M-O).

Fig. 2 Relative expression levels of RUNX2, SP7/OSX, BMP2 and PDGFB

(A) levels of RUNX2 and SP7/OSX mRNA in the alveolar bone (n = 13) and CO₃Ap graft sites (n = 18) shown by box plots (median and interquartile range). (B) levels of RUNX2 and SP7/OSX mRNA in the maxillary molars (n = 10) and mandibular molars (n = 8) after socket grafting with CO₃Ap shown by box plots. (C) levels of BMP2 and PDGFB mRNA in the alveolar bone and CO₃Ap graft sites shown by box plots. (D) levels of BMP2 and PDGFB mRNA in maxillary molars and mandibular molars after socket grafting with CO₃Ap shown by box plots. *P < 0.05.

Fig. 3 Relative expression levels of BMP7

(A) levels of BMP7 mRNA in the alveolar bone (n = 8) and CO₃Ap graft sites (n = 12) shown by box plots (median and interquartile range). (B) levels of BMP7 mRNA in the maxillary molars (n = 6) and mandibular molars (n = 6) after socket grafting with CO₃Ap shown by box plots.

Fig. 4 Histological and immunohistochemical analyses of bone tissue after CO₃Ap socket grafting

(A, B, C) H&E staining of bone biopsies. Immunohistochemical analyses of bone biopsies: (D, E, F) RUNX2, (G, H, I) SP7/OSX, (J, K, L) vimentin and (M, N, O) cytokeratin. Osteoid formation was observed at the sites of CO₃Ap grafting (A; ×4, B; ×20, C; ×40). (D, E, F) RUNX2, (G, H, I) SP7/OSX and (J, K, L) vimentin-positive cells can be observed around the osteoid (arrow). Yellow bars each represent 100 μm.

Discussion

In comparison to autologous bone grafts, artificial bone grafts have a disadvantage in that they do not fit well with the existing bone and healing takes a longer time. However, they have the advantage of not being invasive to the patient. Typical synthetic graft materials used for artificial bone grafting are HA, β-TCP and CO₃Ap. After transplantation, β-TCP reacts with body fluids, is absorbed, and replaced by new bone. The solubility of β-TCP in body fluids is higher than that of HA [12]. A comparative study using CBCT to assess alveolar bone resorption at 6 months after alveolar ridge grafting using β-TCP or bovine-derived xenogeneic bone (Bio-Oss) revealed that 17.5% of β-TCP and 1% of Bio-Oss were absorbed. Bone resorption after socket grafting is reportedly less in extent when Bio-Oss is used [13]. In this study, the average extent of bone resorption was 7.15% about 7 months after CO₃Ap grafting, indicating that CO₃Ap caused less bone resorption than β-TCP (Table 1).

RUNX2 and SP7/OSX are osteoblast-related transcription factors reportedly involved in osteoblast differentiation and bone formation [8,14]. SP7/OSX mRNA levels were significantly increased in new bone 7 months after CO₃Ap grafting (Fig. 2). Although RUNX2 expression is observed in SP7/OSX-knockout mice, SP7/OSX is not expressed in RUNX2-knockout mice [8]. These findings suggest that the OSX gene is downstream of RUNX2. On the other hand, BMP-2 induces SP7/OSX transcription through distal-less homeobox 5 (Dlx5) independently of RUNX2 [15]. BMP2 induces osteogenic differentiation of MSCs, and stimulates SP7/OSX expression via the transcription factor Dlx5 [15,16]. PDGF-BB promotes bone regeneration by enhancing the osteogenic and angiogenic abilities of bone marrow stromal cells [10]. Gene therapy using PDGFB prevents osteomalacia and increases trabecular bone formation in mice through increased expression of SP7/OSX and RUNX2 [17]. In the present study, the level of BMP2 mRNA was increased significantly in new alveolar bone after socket grafting with CO₃Ap (Fig. 2). Ridge augmentation is performed when alveolar bone width and height are insufficient for placement of a dental implant in the proper position, and decortication is applied in combination with bone grafting [18,19,20,21].

Histologically, H&E staining demonstrated osteoid formation at the site of CO₃Ap grafting (Fig. 4A-C). Similarly to previous studies, CO₃Ap granules exhibited excellent biocompatibility, and bone biopsies demonstrated that they could replace human bone [5].

Levels of SP7/OSX and BMP2 mRNA were increased significantly by CO₃Ap grafting, and H&E staining of the bone revealed that CO₃Ap was replaced by osteoid. These findings suggest that differentiation of osteoblasts is induced at the site of CO₃Ap grafting, unlike existing bone. Furthermore, the results of immunostaining suggest that SP7/OSX is able to induce osteoblast differentiation via the BMP pathway after CO₃Ap grafting.

Conflicts of Interest

The authors have no potential conflicts of interest to report.

Funding

This study was supported in part by the Japan Society for the Promotion of Science KAKENHI Grants and Scientific Research (C) (Nos. 17K11994, 18K09583, 20K09945, 21K09922, 23K09173) from the Ministry of Education, Science, Sports, and Culture of Japan. Nihon University Multidisciplinary Research Grant for 2021.

References

• 1.  Araújo MG, Lindhe J (2005) Dimensional ridge alterations following tooth extraction. An experimental study in the dog. J Clin Periodontol 32, 212-218.
• 2.  Chappuis V, Engel O, Shahim K, Reyes M, Katsaros C, Buser D (2015) Soft tissue alterations in esthetic postextraction sites: a 3-dementional analysis. J Dent Res 94, 187S-193S.
• 3.  Iasella JM, GreenWell H, Miller RL, Hill M, Drisko Scheetz JP (2003) Ridge preservation with freeze-dried bone allograft and a collagen membrane compared to extraction alone for implant site development: clinical and histologic study in humans. J Periodontol 74, 990-999.
• 4.  Kudoh K, Fukuda N, Kasugai S, Tachikawa N, Koyano K, Matsushita Y et al. (2019) Maxillary sinus floor augmentation using low-crystalline carbonate apatite granules with simultaneous implant installation: First-in-human clinical trial. J Oral Maxillofac Surg 77, 985.e1-985.e11.
• 5.  Nakagawa T, Kudoh K, Fukuda N, Kasugai S, Tachikawa N, Koyano K et al. (2019) Application of low-crystalline carbonate apatite granules in 2-stage sinus floor augumentation: a prospective clinical trial and histomorphometric evaluation. J Periodontal Implant Sci 49, 382-396.
• 6.  Nagai H, Kobayashi-Fujioka M, Fujisawa K, Ohe G, Takamaru N et al. (2015) Effects of low crystalline carbonate apatite on proliferation and osteoblastic differentiation of human bone marrow cells. J Mater Sci Mater Med 26, 99.
• 7.  Caubet J, Ramis JM, Ramos-Murguialday M, Morey M Á, Monjo M (2015) Gene expression and morphometric parameters of human bone biopsies after maxillary sinus floor elevation with autologous bone combined with Bio-Oss® or BoneCeramic®. Clin Oral Implants Res 26, 727-735.
• 8.  Nakashima K, Zhou X, Kunkel G, Zhang Z, Deng JM, Behringer RR et al. (2002) The novel zinc finger-containing transcription factor osterix is required for osteoblast differentiation and bone formation. Cell 108, 17-29.
• 9.  Shen H, Zhuang Y, Zhang C, Zhang C, Yuan Y, Yu H et al. (2022) Osteoclast-driven osteogenesis, bone remodeling and biomaterial resorption: a new profile of BMP2-CPC-induced alveolar bone regeneration. Int J Mol Sci 23, 12204.
• 10.  Zhang M, Yu W, Niibe K, Zhang W, Egusa H, Tang T et al. (2018) The effects of platelet-derived growth factor-BB on bone marrow stromal cell-mediated vascularized bone regeneration. Stem Cells Int 2018, 3272098.
• 11.  Franke WW, Schmid E, Osborn M, Weber K (1979) Intermediate-sized filaments of human endothelial cells. J Cell Biol. 81, 570-580.
• 12.  Neo M, Nakamura T, Ohtsuki C, Kokubo T, Yamamuro T (1993) Apatite formation on three kinds of bioactive material at an early stage in vivo: a comparative study by transmission electron microscopy. J Biomed Mater Res 27, 999-1006.
• 13.  Jung RE, Philipp A, Annen BM, Signorelli L, Thoma DS, Hämmerle CHF et al. (2013) Radiographic evaluation of different techniques for ridge preservation after tooth extraction: a randomized controlled clinical trial. J Clin Periodontol 40, 90-98.
• 14.  Ducy P, Zhang R, Geoffroy V, Ridall AL, Karsenty G (1997) Osf2/Cbfa1: a transcriptional activator of osteoblast differentiation. Cell 89, 747-754.
• 15.  Lee MH, Kwon TG, Park HS, Wozney JM, Ryoo HM (2003) BMP-2-induced osterix expression is mediated by Dlx5 but is independent of Runx2. Biochem Biophys Res Commun 309, 689-694.
• 16.  Cai H, Zou J, Wang W, Yang A (2021) BMP2 induces hMSC osteogenesis and matrix remodeling. Mol Med Rep 23, 125.
• 17.  Chen W, Baylink DJ, Jones JB, Neises A, Kiroyan JB, Rundle CH et al. (2015) PDGFB-based stem cell gene therapy increases bone strength in the mouse. Proc Natl Acad Sci USA 112, 3893-3900.
• 18.  Hämmerle CH, Karring T (1998) Guided bone regeneration at oral implant sites. Periodontol 2000 17, 151-175.
• 19.  Canto FRT, Garcia SB, Issa JPM, Marin A, Bel EAD, Defino HLA (2008) Influence of decortication of the recipient graft bed on graft integration and tissue neoformation in the graft-recipient bed interface. Eur Spine J 17, 706-714.
• 20.  Lee SH, Lim P, Yoon HJ (2014) The influence of cortical perforation on guided bone regeneration using synthetic bone substitutes: a study of rabbit cranial defects. Int J Oral Maxillofac Implants 29, 464-471.
• 21.  Acar AH, Yolcu U (2019) Bone decortication rate and guided bone regeneration under an occlusive titanium dome: Micro-CT analysis. Annals of Medical Research 26, 329-334.