2025 年 50 巻 3 号 p. 55-63
Tomato leaf mold caused by Passalora fulva is a significant disease in tomato production. We isolated several types of boscalid-resistant isolates in the Gifu and Mie Prefectures of Japan. Sequencing analysis of succinate dehydrogenase (Sdh) subunits B, C, and D genes strongly indicated that four amino acid substitutions—T78I, N85K, N85S, and H151R in SdhC—conferred boscalid resistance. We conducted SNP assays to detect each mutation using qPCR techniques and revealed that all 35 resistant isolates had one of these mutations in the SdhC. Among the four resistance types, N85K isolates exhibited the highest, N85S isolates showed the lowest, and T78I and H151R isolates displayed moderate resistance to boscalid. These mutations also conferred cross-resistance to other succinate dehydrogenase inhibitor (SDHI) fungicides, including penthiopyrad, pyraziflumid, fluopyram, and isofetamid. A predicted SdhC protein structure, created by I-TASSER, suggests that the amino acid at position 151 is located close to those of positions 78 and 85, likely forming the SDHI-binding pocket of the protein.
Tomato leaf mold, caused by the fungal pathogen Passalora fulva [syn. Cladosporium fulvum, Fulvia fulva], is a significant disease in tomato production, causing severe damage to plant growth, fruit quality, and yield worldwide. Various fungicides, including beta-tubulin inhibitors, quinone outside inhibitors, and ergosterol demethylation inhibitors, have been used to control tomato leaf mold. However, resistance of P. fulva isolates to these fungicides has been reported.1–3) Succinate dehydrogenase inhibitors (SDHIs), such as boscalid, have also been employed to protect tomatoes from P. fulva infection; however, SDHI-resistant isolates were isolated in Japan recently.4,5)
Mitochondrial Complex II comprises four subunits: SdhA (a flavoprotein) and SdhB (an iron-sulfur protein) are on the matrix side of the inner membrane, while SdhC and SdhD are hydrophobic and anchor the complex to the membrane. SDHIs bind to the ubiquinone-binding site of the fungal mitochondrial Complex II, inhibiting mitochondrial respiration.6–8) Initially developed in the 1960s, SDHIs like carboxin and oxycarboxin were used to control diseases caused by basidiomycete fungi.9–12) Boscalid, an SDHI fungicide, was later developed to target true fungi, including basidiomycetes and ascomycete plant pathogens.12) Following boscalid, other SDHIs such as penthiopyrad, pyraziflumid, fluopyram, and isofetamid, with broad antifungal activity against both basidiomycetes and ascomycetes, were introduced. SDHI fungicides have become essential in protecting plants from various plant pathogens.7–18) However, SDHI-resistance has emerged as a significant issue in many plant pathogens like Alternaria alternata, Alternaria solani, Botrytis cinerea, Corynespora cassiicola, Zymoseptoria tritici (=Mycosphaerella graminicola), Pyrenophora teres, Sclerotinia sclerotiorum, and Venturia inaequalis.7,10–13) The most common mutation involves a histidine substitution in SdhB (e.g., B. cinerea, H272Y/R/L/V; A. alternata, H277Y/R; C. cassiicola, H278Y/R; Podosphaera xanthii, H278Y/R).14–18) Mutations in SdhC and SdhD have also been reported in various pathogens.7,10–13)
Nakajima et al. (2021) reported SDHI-resistant isolates of the tomato leaf mold pathogen P. fulva from Japanese fields,4) but the resistance mechanisms remain unclear. To our best knowledge, there is no report of the emergence of boscalid resistant P. fulva strains in countries other than Japan. This study analyzed P. fulva Sdh genes and identified four types of resistance mutations in the SdhC gene.
We used five boscalid-resistant isolates and 15 sensitive isolates from Gifu Prefecture, as well as 30 resistant and 30 sensitive isolates from Mie Prefecture. The isolates from Mie Prefecture, collected in 2018 and 2019, were previously reported by Nakajima et al. (2021).4) Two Gifu isolates (Pf2179 and Pf1942) and three Mie-isolates (M-7, M-24, and M-94) were selected as representative boscalid-resistant strains. Pf1924 was used as a standard boscalid-sensitive strain. All strains were incubated on PDA medium.
2. SDHI sensitivity testP. fulva isolates were cultured on PDA medium. For fungicide sensitivity testing, conidia from PDA medium were collected with sterile water and inoculated on PDA plates with or without SDHI fungicides at 0.1, 0.4, 1.6, 6.4, and 25 mg/L. Mycelial growth was assessed after five days of cultivation at room temperature. The spore suspension (approximately 105/mL) was prepared by swiping with the sterilized brush from 10 days growing mycelia on PDA medium, and the 10 µL of spore suspension was inoculated onto PDA containing fungicides. The SDHI fungicides—boscalid (CAS: 188425-85-6), penthiopyrad (183675-82-3), pyraziflumid (942515-63-1), fluopyram (658066-35-4), and isofetamid (875915-789)—were purchased from FUJIFILM Wako Pure Chemical Corporation (Tokyo, Japan). Although fluopyram is not registered for tomato leaf mold, we select fluopyram for its unique structure. Twenty-five milligrams of active ingredients of fungicide were dissolved in 1 mL of dimethyl sulfoxide (DMSO) (FUJIFILM Wako, Tokyo, Japan), then 6.4 mg/mL, 1.6 mg/mL, 0.4 mg/mL, and 0.1 mg/mL were prepared in DMSO. Resultant fungicide stock solutions (×1000) were added to PDA medium. To the control PDA medium was added 0.1% (v/v) DMSO. Biological replicates were performed three times. Figure 1 represents a comprehensive assessment.
Genomic DNA was extracted from the mycelia of P. fulva isolates. Mycelia were homogenized with a bead beater (FastPrep-24, MP Biomedicals, Tokyo, Japan), and DNA was extracted using the FastDNA SPIN kit (MP Biomedicals, Tokyo, Japan) according to the manufacturer’s instructions. Extracted DNA was stored at −80°C until PCR amplification and qPCR analysis. SdhB, SdhC, and SdhD gene sequences of P. fulva were obtained from the draft genome in JGI MycoCosm (https://mycocosm.jgi.doe.gov). Primers used for PCR amplification are listed in Supplemental Table S1. PCR reactions were performed on a Thermal Cycler TP5600 (Takara Bio, Tokyo, Japan) in a final volume of 50 µL, containing 100 nM of each primer and 1 µL of genomic DNA (50 ng) in KAPATaq Extra PCR Kit (NIPPON Genetics CO. Ltd., Tokyo, Japan). PCR parameters included initial denaturation at 94°C for 2 min, followed by 35 cycles of 10 sec at 94°C, 10 sec at 60°C, and 30 sec at 72°C, with a final step of 30 sec at 72°C. PCR fragments, approximately 1.5 kbp, 0.93 kbp, and 1.0 kbp, were amplified for SdhB, SdhC, and SdhD genes, respectively. PCR products were purified using QIAGEN PCR purification kits (Tokyo, Japan), and sequencing was performed by Eurofins Genomics Co. Ltd. (Tokyo, Japan). Multiple amino acid sequence alignments were performed using the UPGMA method in GENETYX Ver. 16 software. Protein structure prediction for SdhC was conducted using I-TASSER (https://zhanggroup.org/I-TASSER/), and mutation sites were visualized with the PyMOL Molecular Graphics System (http://www.pymol.org).
4. Construction of qPCR assays for boscalid-resistant mutationsAllele-specific primers for detecting boscalid-resistant mutations in the SdhC gene are shown in Table 1. qPCR reactions were performed on a LightCycler 96 system (Roche, Tokyo, Japan) in a final volume of 20 µL, containing 100 nM of each primer and 1 µL of genomic DNA (20 ng) in TB Green® Premix Ex Taq™ II (Takara Bio, Tokyo, Japan). Amplification included 40 cycles of 10 sec at 95°C, 5 sec at 61°C, and 15 sec at 72°C. Ct values were used for SNP detection.
| Primer name | Sequence (5′→3′) | Purpose |
|---|---|---|
| T78(S) | TACCAGCCACAGATCAC | Forward primer to detect Thr at coden 78 |
| T78I(R) | CTACCAGCCACAGATCAT | Forward primer to detect Thr (ACC) →Ieu (ATC) mutation at coden 78 |
| N85(S1) | ACCTCTCCGCCCTTAA | Forward primer S1 to detect Asn (AAC) at coden 85 |
| N85S(R) | ACCTCTCCGCCCTTAG | Forward primer to detect Asn (AAC) →Ser (AGC) mutation at coden 85 |
| N85(S2) | CCTCTCCGCCCTTAAC | Forward primer S2 to detect Asn (AAC) at coden 85 |
| N85K(AAA) | CCTCTCCGCCCTTAAA | Forward primer to detect Asn (AAC) →Lys (AAA) mutation at coden 85 |
| N85K(AAG) | CCTCTCCGCCCTTAAG | Forward primer to detect Asn (AAC) →Lys (AAG) mutation at coden 85 |
| H151(S) | TTCAACGGCATCAGACA | Forward primer to detect His at coden 151 |
| H151R(R) | TCAACGGCATCAGACG | Forward primer to detect His (CAT) →Arg (CGT) mutation at coden 151 |
| PfsdhCR55 | CAGAACCTGCGTCTCCACATGC | Reverse primer used for SNPs assay for coden 78 and coden 85 |
| PfsdhCR88 | GTGCCAATGCTGAGATAACCGATG | Reverse primer used for SNP assay for coden 151 |
Underline indicates the mutation site of boscalid-resistance SdhC gene
Boscalid-resistant isolates of the tomato leaf mold pathogen P. fulva were first reported in Japan4); however, the resistance mutations were not identified. In this study, we investigated mutations conferring the boscalid resistance. Five resistant isolates from Gifu Prefecture, Japan, were analyzed and grouped into two: highly resistant isolates (Pf1942 and Pf2180), and moderately resistant isolates (Pf2172, Pf2176, and Pf2179). Sensitivity to boscalid for three representative isolates—Pf1924 (sensitive), Pf1942 (high-resistance), and Pf2179 (moderate-resistance) —is shown in Fig. 1 (A–C) and Supplemental Fig. S1. The growth of the sensitive Pf1924 isolate was nearly completely inhibited at 0.4 mg/L, whereas the high-resistance Pf1942 isolate grew well even at 25 mg/L. The growth of the moderate-resistance isolate Pf2179 was not inhibited by the chemical at 1.6 mg/L but was largely inhibited at 25 mg/L.
As amino acid substitutions H272Y/R in the SdhB subunit are common in resistant plant pathogens, we sequenced the SdhB genes from these isolates using the primer set cfsdhB-F and cfsdhB-R (Supplemental Table S1). No mutations were detected in the SdhB gene of either resistance group. We then analyzed the SdhC and SdhD genes and found mutations that cause the amino acid substitution in SdhC in the corresponding gene (Fig. 2A–D). Moderate-resistance isolates Pf2172, Pf2176, and Pf2179 had the same single nucleotide substitution (ACC to ATC) at codon 78, resulting in a substitution from threonine to isoleucine (T78I). High-resistance isolates Pf1942 and Pf2180 shared a mutation (AAC to AAA) at codon 85, causing a substitution from asparagine to lysine (N85K).
To assess whether T78I and N85K confer resistance to boscalid, we analyzed the SdhC gene of 21 boscalid-sensitive Japanese isolates, mainly from Gifu Prefecture. qPCR assays based on allele-specific PCR were conducted, with primer sets designed to detect the resistance mutations and wild-type genes (Table 1). Using genomic DNA from the SDHI-sensitive strain (Pf1924) and T78I-type resistant strain (Pf2179), the primer set T78(S) and PfsdhCR55 amplified relevant DNA fragments significantly for the sensitive strain (Ct: 17.5) but negligibly for the resistant strain (Ct: 29.2) (Fig. 3A). Conversely, the primer set T78(R) and PfsdhCR55 amplified the DNA fragments specifically for the resistant strain (Ct: 16.7) but not for the sensitive strain (Ct: >30) (Fig. 3A). In the same way, N85K(AAA) assays were conducted and the primer set N85K(AAA) and PfsdhCR55 amplified the DNA fragments specifically for the resistant strain Pf1942 (Fig. 3B). Two qPCR assays, namely T78I and N85K(AAA), showed that all 21 sensitive isolates lacked T78I and N85K mutations, strongly suggested that these mutations confer boscalid resistance (Supplemental Table S2).
We have identified the two types of amino acid substitutions in SdhC as boscalid-resistant mutations in the strains isolated in Gifu Prefecture. We further analyzed whether other isolates, which were isolated in Mie Prefecture in year 2018 and 2019, carried these mutations. Genomic DNA from 30 boscalid-resistant isolates were used to identify the presence of these mutations by means of the qPCR assays for T78I and N85K(AAA) (Table 2). The T78I mutation was absent in all resistant isolates from Mie Prefecture, while only three isolates—M-4, M-5, and M-6—had the N85K(AAA) mutation. These results suggest that the other 27 resistant isolates should harbor different type(s) of boscalid-resistant mutations.
| Strain name | Coden 78 mutation | Coden 85 mutation | Coden 151 mutation | Resistance mutation | Number of isolates | ||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| T78(S) | T78I (R) | N85(S2) | N85K(AAA) | N85K(AAG) | N85(S1) | N85S(R) | H151(S) | H151R(R) | |||
| M-2, M-3, M-11, M-12, M-13, M-14, M-16, M-33, M-34, M-36, M-38, M-39, M-40, M-42, M-44, M56, M-58, M-59, M-60, M-63, M-72, M-74, M-75, M-76, M-77, M-78, M-79, M-80, M-81, M-92 | + | − | + | − | − | + | − | + | − | Sensitive | 30 |
| Pf2172*, Pf2176*, Pf2179* | − | + | + | − | − | + | − | + | − | T78I | 3 (3) |
| Pf1942*, Pf2180*, M-4, M-5, M-6 | + | − | − | + | − | + | − | + | − | N85K(AAA) | 5 (2) |
| M-90, M-93, M-94, M-96 | + | − | − | − | + | + | − | + | − | N85K(AAG) | 4 |
| M-7, M-8, M-27, M-29, M-46, M-47, M-48, M-49, M-50 | + | − | + | − | − | − | + | + | − | N85S | 9 |
| M-24, M-25, M-26, M-30, M-31, M-32, M-51, M-52, M-53, M-84, M-85, M-86, M-87, M-88 | + | − | + | − | − | + | − | − | + | H151R | 14 |
“+” indicates amplification of the relevant DNA fragments in each qPCR assay (Ct values <20). Isolates belonging positive (+) in T78(S), N85(S2), N85(S1), and H151(S) assays indicate that they have no resistance mutation of T78I, N85K, N85S, and H151R in SdhC, respectively. Isolates belonging to positive (+) in T78I(R), N85K(AAA), N85K(AAG), M85S(R), and H151R(R) assays indicate that they have resistance mutation, T78I, N85K(AAA), N85K(AAG), N85S, and H151R in SdhC, respectively.
Sequencing of the SdhB, SdhC, and SdhD genes in several Mie isolates revealed three new boscalid-resistance mutations. Isolate M-94 had an N85K substitution in SdhC; however, codon 85 (AAC) was changed to AAG, instead of AAA as in isolate Pf1942 (Fig. 2E). Isolate M-7 had an N85S (AAC to AGC) substitution (Fig. 2F), and isolate M-24 had an H151R (CAT to CGT) substitution (Figs. 2G, H).
New qPCR assays were developed to detect N85K(AAG), N85S, and H151R mutations (Figs. 3C–E). These assays were applied to 30 sensitive and 30 resistant isolates from Mie Prefecture, as well as five resistant isolates from Gifu Prefecture. All resistant isolates carried one of five SdhC mutations: T78I, N85K(AAA), N85K(AAG), N85S, or H151R (Table 2). The N85K(AAA) mutation, identified in Gifu isolates (Pf1942 and Pf2180), was present in Mie isolates M-4, M-5, and M-6. Additionally, N85K(AAG), N85S, and H151R were detected in four, nine, and 14 resistant isolates from Mie Prefecture, respectively. The T78I mutation was found exclusively in Gifu isolates (Pf2172, Pf2176, and Pf2179), and none of the 30 sensitive isolates from either region contained any of the five mutations (Table 2). These findings strongly indicate that the amino acid substitutions T78I, N85K, N85S, and H151R in SdhC confer the boscalid resistance in P. fulva.
3. Cross-resistance to the five SDHI fungicidesFive types of resistant isolates—Pf2179 (T78I), Pf1942 (N85K-AAA), M-94 (N85K-AAG), M-7 (N85S), and M-24 (H151R)—were tested for sensitivity to boscalid and other SDHI fungicides, including penthiopyrad, pyraziflumid, fluopyram, and isofetamid (Fig. 1 and Supplemental Fig. S1). Two N85K-type strains, such as Pf1942 (N85K-AAA) and M-94 (N85K-AAG) showed similar sensitivity to boscalid and other SDHIs, and the N85K mutation conferred higher resistance to SDHIs compared to other mutations. These two isolates were highly insensitive to boscalid (MIC: >25 mg/L), penthiopyrad (>25 mg/L), pyraziflumid (>25 mg/L) and fluopyram (>25 mg/L) and almost insensitive to isofetamid (≥25 mg/L). In contrast, M-7 (N85S) showed the low resistance to boscalid (MIC: 6.1 mg/L), pyraziflumid (6.4–25 mg/L), fluopyram (1.6–6.4 mg/L) and isofetamid (6.4 mg/L). Meanwhile, M-24 (H151R) and Pf2179 (T78I) displayed moderate resistance to boscalid (MIC: ≥25 mg/L), pyraziflumid (25 or ≥25 mg/L) and fluopyram (6.4 or 1.6–6.4 mg/L) and isofetamid (6.4 or 25 mg/L). All resistant isolates exhibited cross-resistance to the five SDHIs tested; however, fluopyram and isofetamid were slightly more effective than boscalid, penthiopyrad, and pyraziflumid on N85K-type resistance isolates (Supplemental Fig. S1).
4. SdhC protein and SDHI-resistance mutation sites in P. fulva and other plant pathogensWe have shown that the amino acid substitutions at three positions—T78, N85, and H151—in SdhC caused SDHI-resistance in P. fulva. SdhC is a conserved protein; amino acid identity of P. fulva SdhC with that of other fungi includes Zymoseptoria tritici (69%), Pyrenophora teres (51%), Alternaria alternata (52%), Venturia inaequalis (54%), Sclerotinia sclerotiorum (51%), Botrytis cinerea (52%), and Ustilago maydis (32%). Phylogenetic analysis revealed that SdhC of P. fulva belongs to the same clade with that of Z. tritici (Fig. 4B).
Histidine (H) at position 151 was conserved in SdhC of these eight plant pathogens. Asparagine (N) at position 85 was conserved except in S. sclerotiorum. Threonine (T) at position 78 was found in most plant pathogens but was replaced by proline (P) in B. cinerea and S. sclerotiorum (Fig. 4A). The N85K/S-type SDHI-resistance mutations in P. fulva were reported in Z. tritici (N86K/S),19–21) P. teres (N86S),22–25) and Corynespora cassiicola (N86S)17,26) (Supplemental Table S3). The T78I-type mutation was detected in Z. tritici (T79N/I), and the H151R-type mutation was found in Z. tritici (H152R) and V. inaequalis (H152R).27)
A predicted protein structure of P. fulva SdhC by I-TASSER indicates that H151 is very closely localized to T78 and N85 (Fig. 4C). The amino acid residues I27, W32, M36, S39, I40, and R43 in chicken SdhC, corresponding to L70, P75, W79, S82, A83, and R86 in that of P. fulva, form the ubiquitin-binding pocket (Fig. 4A). These findings suggest that T78I and N85K/S mutations affect the binding of SDHI fungicide to SdhC. The amino acid substitutions identified in this study may not be critical for the enzyme activity, but likely disrupt SDHI binding to the succinate dehydrogenase complex, conferring resistance to SDHI fungicides.
We identified SDHI-resistance mutations, which caused amino acid substitutions T78I, N85K/S, and H151R in the SdhC gene of the tomato leaf mold pathogen P. fulva in this study. SDHIs, classified FRAC GROUP CODE 7 (https://www.frac.info/docs/default-source/publications/frac-code-list/frac-code-list-2024.pdf), have a long history of use.9,10,28) Carboxin, the first SDHI introduced in 1966, was mainly used against rust diseases caused by Puccinia spp., while subsequent SDHIs, such as mepronil, flutolanil, and furametpyr, were developed to control rice sheath blight caused by Rhizoctonia solani. Since the introduction of the first broad-spectrum SDHI, boscalid, in 2003, numerous SDHIs with broad-spectrum antifungal activity against basidiomycetes and ascomycetes have been widely developed and used globally.29,30) However, boscalid-resistant isolates have been detected in many plant pathogens, and FRAC currently assesses SDHI fungicides as having a moderate to high resistance risk.
In most plant pathogens, mutations that cause H272R and H278Y alterations in SdhB in the corresponding gene confer high to very high resistance to many SDHIs, including boscalid. Interestingly, such resistant strains are more sensitive to certain SDHIs, including fluopyram and isofetamid, than wild-type strains.31–35) While most SDHIs, like boscalid, penthiopyrad, and pyraziflumid, feature two rings directly connected by a carboxamide (–CONH–), the structure of fluopyram and isofetamid are notably distinct. In fluopyram and isofetamid, two rings are connected by (–CONHCH2CH2–) and (–CONHCH(CH3)2CO–), respectively. Various SDHIs, used against diverse diseases, has led to the emergence of various SDHI-resistance mutations not only in the SdhB gene but also in the SdhC and SdhD genes in several pathogens.
In this study, we analyzed 35 P. fulva isolates resistant to boscalid, and identified five mutations in three codons in the SdhC (Table 2). While mutations that cause amino acid substitutions in SdhB, such as H272R and H278Y, are common in many SDHI-resistant plant pathogens, no mutations were found in the SdhB genes of P. fulva boscalid-resistant isolates. Instead, the five mutations in the SdhC gene were detected in SDHI-resistant isolates (Fig. 2). Using qPCR assays to detect individual SdhC mutation (Fig. 3), we confirmed that these mutations were absent in sensitive strains (Table 2). These results strongly suggest that T78I, N85K/S, and H151R mutations in the SdhC gene confer the SDHI-resistance in P. fulva (Fig. 1). Among the 35 resistant strains, three, five, four, nine, and 14 strains had T78I, N85K (AAA), N85K (AAG), N85S, and H151R mutations, respectively (Table 2). Although all resistant isolates from Gifu and Mie Prefectures had SdhC mutations, resistance mutations in the SdhB or SdhD genes may also contribute to SDHI-resistance in P. fulva. The qPCR assay protocols developed in this study offer a valuable tool for monitoring SDHI-resistance in P. fulva.
All five mutations—T78I, N85K/S, and H151R—confer cross-resistance to all examined SDHIs—boscalid, penthiopyrad, pyraziflumid, fluopyram, and isofetamid—though resistance levels vary by fungicide (Fig. 1, Supplemental Fig. S1). N85K-resistant isolates showed high resistance to boscalid, penthiopyrad, and pyraziflumid but moderate resistance to fluopyram and isofetamid. In contrast, N85S-resistant isolates exhibited weak resistance to all SDHIs. The T78I and H151R mutations conferred moderate resistance to boscalid, penthiopyrad, and pyraziflumid but low resistance to fluopyram. These three amino acid residues of SdhC may locate in close proximity (Fig. 4C). Presence of an additional positive charge and/or larger side chain of lysine than asparagine may affect the distance between two predicted α-helices (Fig. 4C) and interaction of fungicides to the protein. Distinct patterns of resistance level to the SDHIs tested probably came from their structural variation. Further structural studies need to elucidate their binding site(s) on SdhC.
Recently, SDHI-resistance mutations in the SdhC gene have been reported in several plant pathogens (Supplemental Table S3). The patterns of SDHI-resistance in P. fulva resemble those of Z. tritici. Amino acid substitutions N86S and H152R were identified in field-resistant isolates, while T79I and N86K were found in laboratory-generated SDHI-resistant isolates of Z. tritici; these correspond to orthologous positions T78I, N85S, N85K, and H151R in P. fulva.19–21) Similar to P. fulva, these resistant isolates showed cross-resistance to SDHIs, with N86K and H152R exhibiting greater resistance than T79I and N86S. They also showed some sensitivity to fluopyram or isofetamid. Field-resistant isolates with the T79N mutation were detected in Z. tritici and were moderately resistant to SDHIs.20)
Although SDHI-resistance mutations at position 78 were restricted to P. fulva and Z. tritici, N85S mutations have been reported in other plant pathogens, including Venturia inaequalis (N85S),27) Pyrenophora teres (N86S),22–24) and Corynespora cassiicola (N75S).18,26) In contrast, the N86K mutation was identified only in laboratory-generated SDHI-resistant isolates of Z. tritici and Coprinus cinereus. This is the first report of T79I-type and N86K-type SDHI-resistance mutations in field isolates of plant pathogens. Furthermore, H151R-type mutations were found in field isolates of Z. tritici (H152R), Ramularia collocygni (H153R), and V. inaequalis (H152R).19–21,27,36) H151R confers high resistance to SDHIs in these pathogens. As shown in Supplemental Table S3, various mutations beyond positions 78, 85, and 151 have been reported in field isolates of plant pathogens. Although H144R, S145R, and G89R mutations in P. fulva were not found in this study, orthologous changes were reported in several plant pathogens. These imply that these mutations may also be found in P. fulva isolates with further monitoring.
Mitochondrial Complex II comprises four subunits: SdhA, SdhB, SdhC and SdhD. The ubiquinone-binding pocket (Q-site) is the binding site of SDHIs, formed by residues of SdhB, SdhC, and SdhD. SDHI-resistance mutations have been identified at multiple SdhC positions in various pathogens, including T78I/N, W79S, S82G, N85K/S, G79R, H144R/Q/Y, S145R, G148R, and H151R, corresponding to positions in P. fulva. These substitutions are grouped into two regions (Supplemental Table S3): positions 78–89, near Q-site residues P75, W79, S82, A83, and R86, and positions 144–165. I-TASSER analysis of P. fulva SdhC structure revealed these regions are close to each other (Fig. 4C). Interestingly, among the nine heme-binding residues (N85, R86, G89, V92, S93, H144, S145, G148, and H151), the substitutions of six positions—N85K/S, G79R, H144R/Q/Y, S145R, G148R, and H151R—have been identified as SDHI-resistance mutations, including in this study of P. fulva (Supplemental Table S3). This suggests that SDHIs bind residues involved in both ubiquinone- and heme-binding, allowing various amino acid changes.
None.
The online version of this article contains supplementary materials (Supplemental Fig. S1, Table S1, Table S2, Table S3), which are available at https://www.jstage.jst.go.jp/browse/jpestics/.
