Breeding Science
Online ISSN : 1347-3735
Print ISSN : 1344-7610
ISSN-L : 1344-7610
Notes
DNA profiling of pineapple cultivars in Japan discriminated by SSR markers
Moriyuki ShodaNaoya UrasakiSumisu SakiyamaShingo TerakamiFumiko HosakaNarumi ShigetaChikako NishitaniToshiya Yamamoto
著者情報
ジャーナル フリー HTML

2012 年 62 巻 4 号 p. 352-359

詳細
Abstract

We developed 18 polymorphic simple sequence repeat (SSR) markers in pineapple (Ananas comosus) by using genomic libraries enriched for GA and CA motifs. The markers were used to genotype 31 pineapple accessions, including seven cultivars and 11 breeding lines from Okinawa Prefecture, 12 foreign accessions and one from a related species. These SSR loci were highly polymorphic: the 31 accessions contained three to seven alleles per locus, with an average of 4.1. The values of expected heterozygosity ranged from 0.09 to 0.76, with an average of 0.52. All 31 accessions could be successfully differentiated by the 18 SSR markers, with the exception of ‘N67-10’ and ‘Hawaiian Smooth Cayenne’. A single combination of three markers TsuAC004, TsuAC010 and TsuAC041, was enough to distinguish all accessions with one exception. A phenogram based on the SSR genotypes did not show any distinct groups, but it suggested that pineapples bred in Japan are genetically diversed. We reconfirmed the parentage of 14 pineapple accessions by comparing the SSR alleles at 17 SSR loci in each accession and its reported parents. The obtained information will contribute substantially to protecting plant breeders’ rights.

Introduction

The pineapple (Ananas comosus (L.) Merr.) is the most economically important edible plant of the family Bromeliaceae, which includes about 2,000 species, most epiphytic and many strikingly ornamental (Morton 1987). Pineapple is cultivated in most tropical and subtropical countries and in other regions with mild climates, ranking third in world production among tropical fruits, after banana and citrus (Botella and Smith 2008). Many pineapple cultivars are grown, differing in characteristics such as plant and fruit size, flesh color and flavor and leaf margin type. Nearly all cultivars for commercial production are classified into a particular “type” category; examples include Cayenne, Queen, Maipure, Red Spanish, Singapore Spanish, Abacaxi and Cabezona (Wee and Thongtham 1991).

In Japan, high-quality pineapple fruits can be produced only during the summer in the Ryukyu Islands, which stretch southwest from Kyushu to Taiwan (Republic of China), because the islands have a subtropical climate with mild winters and hot summers. Fruits harvested in winter are not suitable for the fresh-fruit market, because of low temperatures during fruit maturation. Pineapple cultivation in the Ryukyu Islands and Okinawa Prefecture started in the 1920s or 1930s after immigrants from Taiwan brought pineapples to these islands and the pineapple canning industry was important from the 1950s to the 1970s (Lin 1983, Watanabe 1961). After the trade of processed pineapple fruits was liberalized in 1990, the proportion of pineapple production intended for the fresh-fruit market gradually increased. In 2010, pineapple production in Okinawa was about 10,000 t (Ministry of Agriculture, Forestry and Fisheries Statistical Yearbook; http://www.maff.go.jp/j/tokei), 60% for fresh fruit consumption and the remainder for processing.

Systematic pineapple breeding started in Okinawa Prefecture in 1989 and seven new elite cultivars have since been released for the fresh-fruit market. Several different types of cultivars (Cayenne, Queen, Maipure, Spanish and others), breeding lines and foreign accessions have been used as sources of specific characteristics (e.g., early ripening, high sugar content and low acidity). To establish effective breeding strategies, it is necessary to assess the genetic backgrounds of Japanese cultivars and other breeding materials by using molecular markers. In addition, it will be necessary to establish DNA profiling technique to protect new elite cultivars of pineapple.

In the plant variety protection (PVP) system in Japan, two main points were added by “Amendment of the Act in 2005” (http://www.hinsyu.maff.go.jp/en/about/overview.pdf) under the national policy for strengthening of intellectual property right. One was that coverage of plant breeders’ rights (PBR) was expanded for products directly obtained from harvested material of the protected variety, because variety identification technique by DNA analysis has been developed. Another was extension of the duration of PBR for 30 years for fruit trees and woody plants. Therefore, DNA profiling technique would be important for protection of PBR in fruit species including pineapple.

Up to now, several DNA profiling techniques have been used for cultivar identification and for evaluating genetic diversity in pineapple. Ruas et al. (1995) used random amplified polymorphic DNA (RAPD) markers to estimate the relationships among four major pineapple cultivars in Brazil and Popluechai et al. (2007) analyzed nine pineapple cultivars in Thailand with 40 RAPD primers. Kato et al. (2004) used amplified fragment length polymorphism (AFLP) markers to evaluate 148 accessions of A. comosus and 14 of related species. Among the available molecular markers, simple sequence repeat markers (SSRs, also known as microsatellites) provide a reliable method for cultivar identification because of their co-dominant inheritance and the abundance of alleles per locus (Weber and May 1989). Wohrmann and Weising (2011) developed 18 EST-SSR loci that showed polymorphism in pineapple. However, DNA profiling in pineapple by SSR markers has been rarely studied.

In this study, we developed 18 new genomic SSR markers in pineapple by using an enriched genomic library approach. We used them in cultivar identification, genetic diversity analysis, and parentage reconfirmation of 31 pineapple accessions including Japanese cultivars, breeding lines and foreign accessions.

Materials and Methods

Plant materials and DNA extraction

The 31 materials consisted of seven newly released cultivars from Okinawa Prefectural Agricultural Research Center Nago Branch (OPARC-Nago, Okinawa, Japan); 11 breeding lines from OPARC-Nago; 12 foreign accessions introduced from the USA, Brazil, Taiwan and Australia and one related species, Ananas ananassoides (Table 1). All materials were maintained at OPARC-Nago. Genomic DNA was isolated from young leaves by using a Genomic-tip 20/G (Qiagen, Germany) as described by Yamamoto et al. (2006) or by using a DNeasy Plant Mini Kit (Qiagen, Germany) according to the manufacturer’s instructions.

Table 1 Pineapple accessions used in this study
Accession name Parentage Origin and type Parentage assessed by SSR markers
Gold Barrel Cream Pineapple × McGregor ST-1 cultivar, bred by OPARC-Nagoa parentage confirmed except for TsuAC018
Haney Bright Mitsubishi Smooth Cayenne × I-43-908 cultivar, bred by OPARC-Nago
Julio Star N67-10 × Cream Pineapple cultivar, bred by OPARC-Nago parentage confirmed
N67-10 selection from Hawaiian Smooth Cayenne cultivar, bred by OPARC-Nago identical genotype to Hawaiian Smooth Cayenne
Soft Touch Hawaiian Smooth Cayenne × I-43-880 cultivar, bred by OPARC-Nago parentage confirmed
Summer Gold Cream Pineapple × McGregor ST-1 cultivar, bred by OPARC-Nago parentage confirmed
Yugafu Cream Pineapple × HI101 cultivar, bred by OPARC-Nago parentage confirmed
Okinawa No. 2 Mitsubishi Smooth Cayenne × I-43-908 breeding line, bred by OPARC-Nago
Okinawa No. 3 Mitsubishi Smooth Cayenne × I-43-908 breeding line, bred by OPARC-Nago
Okinawa No. 9 N67-10 × Cream Pineapple breeding line, bred by OPARC-Nago parentage confirmed
Okinawa No. 13 Cream Pineapple × Okinawa No. 2 breeding line, bred by OPARC-Nago parentage confirmed
Okinawa No. 17 Yugafu × Summer Gold breeding line, bred by OPARC-Nago parentage confirmed
Okinawa No. 19 Yugafu × Soft Touch breeding line, bred by OPARC-Nago parentage confirmed
Okinawa No. 20 Yugafu × Summer Gold breeding line, bred by OPARC-Nago parentage not confirmed, candidate parentage of Yugafu × N67-10
Okinawa No. 21 Yugafu × A1031 breeding line, bred by OPARC-Nago parentage between Okinawa No. 21 and Yugafu confirmed
Okinawa No. 22 A882 × Soft Touch breeding line, bred by OPARC-Nago parentage confirmed
Okinawa No. 23 Julio Star × Okinawa No. 12 breeding line, bred by OPARC-Nago parentage between Okinawa No. 23 and Julio Star confirmed
Okinawa No. 24 Soft Touch × Summer Gold breeding line, bred by OPARC-Nago parentage confirmed
A. ananasoides indigenous, introduced from Brazil, A. ananasoides
A882 Ripely Queen × Puerto Rico breeding line
Bogor Smooth Cayenne × Singapore Spanish breeding line
Cream Pineapple indigenous, introduced from USA, Maipure type
Hawaiian Smooth Cayenne indigenous, introduced from USA, Cayenne type identical genotype to N67-10
HI101 breeding line, introduced from USA
I-43-880 unknown, introduced from Brazil
McGregor ST-1 indigenous, introduced from Australia, Queen type
MD2 58-1184 × 59-443 cultivar, introduced from USA
Red Spanish indigenous, intoroduced from Brazil, Spanish type
Seijyo Cayenne indigenous, introduced from Taiwan, Cayenne type
Tainung No. 11 (Smooth Cayenne × Mouritius) × Smooth Cayenne cultivar, introduced from Taiwan
Tainung No. 17 Smooth Cayenne × Rough cultivar, introduced from Taiwan
a  OPARC-Nago: Okinawa Prefectural Agricultural Research Center Nago Branch

SSR development

We used genomic DNA of pineapple ‘N67-10’ to construct SSR-enriched genomic libraries for GA and CA motifs by the method described by Nunome et al. (2006). The repeat-enriched genomic DNA was ligated into the pCR2.1-TOPO vector (TOPO TA Cloning Kit, Invitrogen, the Netherlands). Plasmid DNA was isolated and sequenced with the BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, USA) according to the manufacturer’s instructions. Sequencing analysis was conducted with an ABI PRISM 3130xl sequencer (Applied Biosystems, USA).

A total of 384 plasmid sequences were obtained: 192 from GA-enriched genomic libraries and 192 from CA-enriched libraries. Plasmid sequences with no insert were excluded from further analysis, and the minimum number of SSR repeats for marker development was set as eight repeats for di-nucleotide motifs of GA/CT or CA/GT. Primer pairs were designed with the Primer3 Web interface (Rozen and Skaletsky 2000, http://frodo.wi.mit.edu/primer3/input.htm). The general primer-picking conditions included a primer size of 20–25 bp (optimum 23 bp), a primer Tm of 57–67°C (optimum 63°C), a maximum Tm difference of 1°C, a primer GC content of 50%–60% (optimum 55%) and a product size range of 100–300 bp.

SSR analysis

SSR-PCR amplification was performed in a 10-μL reaction mixture containing 5 μL of GoTaq Master Mix including GoTaq DNA Polymerase (Promega, USA), 5 pmol each of forward primer (fluorescently labeled with Fam, Vic, or Ned) and reverse primer (unlabeled), and 5 ng of genomic DNA. DNA was amplified in 35 cycles of 94°C for 1 min, 55°C for 1 min and 72°C for 2 min and a final extension of 10 min at 72°C. The nucleotide sequence of “gtttctt” was added to the 5′ end of reverse primers as pig-tailing (Brownstein et al. 1996), in order to promote adenylation and facilitate accurate genotyping. The amplified PCR products were separated and detected in a PRISM 3100 DNA sequencer (Applied Biosystems, USA). The sizes of the amplified bands were scored against internal-standard DNA (400HD-ROX, Applied Biosystems, USA) by GeneScan software (Applied Biosystems, USA).

Data analysis

Using the CERVUS v. 2.0 software (Marshall et al.1998) and MarkerToolKit v. 1.0 (Fujii et al. 2008), we estimated the expected heterozygosity (HE) at single-locus SSR markers in the tested pineapple cultivars. HE was calculated using an unbiased formula from allele frequencies as 1 − ∑pi2 (1 ≤ im), where m is the number of alleles at the target locus and pi is the allele frequency of the ith allele at the target locus.

Parent-offspring relationships were tested by comparing the SSR alleles in each accession with those of its reported parents; the data were analyzed using the MARCO software (Fujii et al. unpublished). MinimalMarker software (Fujii et al. 2007) was used to identify minimal marker subsets to distinguish all cultivars and to find identical genotypes generated from the 18 SSR markers for the 31 accessions.

A phenogram of the 31 accessions was constructed by using the unweighted pair-group method with using arithmetic mean (UPGMA) based on the similarities between genotypes estimated by Dice’s coefficient: Dc = 2nxy/(nx + ny), where nx and ny represent the number of putative SSR alleles for materials X and Y, respectively, and nxy represents the number of putative SSR alleles shared between X and Y. NTSYS-pc v. 2.1 software (Rohlf 1998) was used to visualize the phenogram.

Results

SSR marker development

We sequenced 384 plasmid clones from GA- and CA-enriched genomic libraries of ‘N67-10’ (192 clones from each library). After exclusion of clones with no inserts, ambiguous nucleotide sequences, no repeat motifs, and duplication, 110 sequences that contained at least eight repeats of a di-nucleotide motif remained from the GA-enriched genomic library. These sequences contained 8 to 49 repeat motifs of (GA)/(CT), with 16.8 on average. The average insert size of the clones obtained was about 202 bp, ranging from 84 to 443 bp. Ninety-eight sequences were obtained from the CA-enriched library containing 8 to 31 repeats of (CA)/(GT), with an average of 12.8. The average insert size of the clones obtained was about 255 bp, ranging from 122 to 552 bp. A total of 42 primer pairs were designed with the Primer3 program: 23 for GA repeats and 19 for CA repeats.

We screened and evaluated the 42 SSR primer pairs by using eight pineapple accessions: ‘N67-10’, ‘Cream Pineapple’, ‘Julio Star’, ‘Summer Gold’, ‘Yugafu’, Okinawa No. 17, ‘Soft Touch’ and Okinawa No. 19. Out of the 42 SSR marker candidates, 24 were excluded from further analysis because of no amplification or unstable amplification of the target band. The remaining 18 markers (7 with GA-repeat motifs and 11 with CA-repeat motifs) were used for SSR analysis of all 31 pineapple accessions (Table 2). Among the seven GA-repeat SSR markers, five showed perfect repeats of a GA motif, whereas TsuAC010 and TsuAC013 had combined motifs of (GT)14A(AG)12 and (AGAGAT)3(AG)12, respectively. Out of the 11 CA-repeat SSRs, nine showed perfect repeats of a CA motif, whereas TsuAC018 and TsuAC023 had an interrupted CA motif of (CA)10A(AC)9 and a combined motif of (CA)10(TA)11, respectively.

Table 2 Characteristics of 18 nelwly developed SSR markers in pineapple
SSR locus
Accession nos.a
Primer sequence (5′-3′) Repeat motif Target size (bp) No. of allels (HE) Heterozygosity
TsuAC004
AB716708
F: ATGTTGGTCAAAGGGCTGTT
R: gtttcttTCATGATCACACTGGAGATTTG
(AG)16 144 5 0.67
TsuAC007
AB716709
F: GCAGCGGTAAGATCTGCTTT
R: gtttcttTCCTTCTCTCCACCTCTTCATT
(GA)21 102 4 b
TsuAC008
AB716710
F: GAAATGGTACTGCTTCACTGTTC
R: gtttcttATACGGGGAAATAGGCACAA
(GA)16 173 5 0.71
TsuAC010
AB716711
F: TGAGTTGTGTCATTGTGTGTCA
R: gtttcttGGGGGTCTCCATACATTTTT
(GT)14A(AG)12 207 7 0.76
TsuAC013
AB716712
F: TTATGCAGGAAAATAGGGGG
R: gtttcttCATGCATCATAAATTCGTGTCC
(AGAGAT)3(AG)12 139 4 0.55
TsuAC018
AB716713
F: GCATCGATCTCCATGCAAAC
R: gtttcttAAAGGAAACAAGGAGGATGTGA
(CA)10A(AC)9 120 5 0.59
TsuAC019
AB716714
F: TTCATCCTATGGTTTCCCCA
R: gtttcttGTGGGTTCAACTGAGTAGCAAT
(AC)13 177 4 0.09
TsuAC021
AB716715
F: AATCAAAGTGATTCCCCTTCC
R: gtttcttTCTGACATAGGGCTTGCACA
(CA)21 141 4 0.50
TsuAC023
AB716716
F: TCGAAAAGAGGATGCTGGAT
R: gtttcttTCCGCAGTGTAGGCATGTAA
(CA)10(TA)11 143 5 0.73
TsuAC024
AB716717
F: GTCGCCAATCAAATTCCAGT
R: gtttcttCTCACGAAACATGAATCACCA
(AC)9 126 3 0.52
TsuAC026
AB716718
F: GGGATTAACTTTTCCAGGGG
R: gtttcttTTGGATTCCTCGTTTGCATT
(AC)8 200 4 0.09
TsuAC028
AB716719
F: TGACACCATAGAGGAGGGGT
R: gtttcttGCTCAAGGACAATCCACCAT
(AC)8 220 3 0.57
TsuAC030
AB716720
F: GAGAGAGAAAAGAGTTTCGACAG
R: gtttcttCTTCAAAATGGTCTAACGTACC
(AG)27 149 4 0.43
TsuAC035
AB716721
F: TTCCTAGCCAACACTACTACAGA
R: gtttcttTGCAGCTTCTTTTCCTGGTT
(GA)9 96 3 0.45
TsuAC038
AB716722
F: TTGCAGCAAACCAAGTCAT
R: gtttcttGGAGGTGTAGTCAATTAGGAGAA
(AC)11 327 3 0.48
TsuAC039
AB716723
F: CCCTGTATGGGTAGCATTGAA
R: gtttcttAAAAGGTATCACGAAAGCGA
(AC)8 91 3 0.54
TsuAC040
AB716724
F: AAATTCTCTTCATGCACACG
R: gtttcttTGCTTCATGAGATCTAAACTGG
(AC)8 99 4 0.61
TsuAC041
AB716725
F: CTCTCTTATGGCACAACCCTG
R: gtttcttCCTGGTGAGTAATCTATATGCTG
(AC)11 279 4 0.58
Average 4.1 0.52
a  DDBJ accession numbers

b  Heterozygosity not evaluated because of the existence of null allele

Genetic identification of pineapple

We identified 74 putative alleles in the 31 pineapple accessions with the 18 SSR markers (Table 2). The number of alleles per locus ranged from three at five of the loci (TsuAC024, TsuAC028, TsuAC035, TsuAC038 and TsuAC039) to seven at TsuAC010, with an average value of 4.1 (Table 2). The expected heterozygosity (HE) ranged from 0.09 at TsuAC019 and TsuAC026 to 0.76 at TsuAC010, with an average value of 0.52.

The 31 pineapple accessions could be successfully differentiated from one another by the 18 SSR markers, with the exception of ‘N67-10’ and ‘Hawaiian Smooth Cayenne’ (Table 3 and Fig. 1). A single combination of three markers (TsuAC004, TsuAC010 and TsuAC041) was enough to distinguish 30 accessions (all except for ‘N67-10’ and ‘Hawaiian Smooth Cayenne’) on the basis of at least one difference in SSR genotype. Furthermore, ten marker subsets consisting of six SSR markers each (e.g., TsuAC004, TsuAC008, TsuAC010, TsuAC030, TsuAC039 and TsuAC041) could differentiate 30 accessions on the basis of two or more SSR genotype differences.

Table 3 Genotypes of 18 SSR markers in pineapple accessions used in this study
Cultivar name SSR genotypes
TsuAC004 TsuAC007 TsuAC008 TsuAC010 TsuAC013 TsuAC018 TsuAC019 TsuAC021 TsuAC023 TsuAC024 TsuAC026 TsuAC028 TsuAC030 TsuAC035 TsuAC038 TsuAC039 TsuAC040 TsuAC041
Gold Barrel 135/143 101/101 178/180 212/232 139/139 109/109 177/177 118/118 138/168 126/131 203/203 217/223 145/158 88/95 330/330 93/95 95/95 276/276
Haney Bright 135/137 101/101 176/186 207/232 126/135 121/121 177/177 118/118 132/132 126/126 203/203 223/223 145/158 95/95 330/336 95/95 95/95 275/279
Julio Star 137/143 101/101 176/180 212/212 139/139 109/121 177/177 143/143 132/168 126/131 203/203 217/223 145/145 88/95 330/336 93/95 95/97 276/276
N67-10 137/143 101/101 176/186 207/212 135/139 121/121 177/177 118/143 132/144 126/131 203/203 217/223 145/145 88/95 330/336 93/95 95/99 276/279
Soft Touch 137/143 101/101 176/186 212/214 139/151 111/121 177/177 118/143 138/144 126/131 203/203 223/223 145/158 95/95 336/336 91/93 95/103 276/276
Summer Gold 135/135 101/101 180/186 212/232 139/139 109/121 177/177 118/118 138/168 126/131 203/203 217/223 145/158 88/95 330/336 95/95 97/99 276/279
Yugafu 135/135 101/101 186/186 207/207 139/139 121/121 177/177 118/118 132/144 126/131 203/203 217/217 145/145 88/95 336/336 93/95 95/95 276/279
Okinawa No. 2 135/143 101/101 176/186 207/232 126/135 121/121 177/177 118/118 132/132 126/126 203/203 219/223 145/158 95/95 330/336 93/95 95/95 275/279
Okinawa No. 3 135/143 101/101 176/186 207/232 126/135 121/121 177/177 118/118 132/132 126/126 203/203 219/223 145/145 88/95 330/336 93/95 95/95 275/276
Okinawa No. 9 135/137 101/101 180/186 212/212 139/139 109/121 177/177 143/143 132/168 126/131 203/203 217/223 145/145 95/95 336/336 95/95 95/97 276/279
Okinawa No. 13 135/143 101/101 186/186 207/232 126/139 121/121 177/177 118/143 132/144 126/131 203/203 217/223 145/145 95/95 336/336 93/93 95/97 275/275
Okinawa No. 17 135/135 101/101 186/186 207/232 139/139 109/121 177/177 118/118 138/144 126/131 203/203 217/223 145/145 88/95 336/336 95/95 95/97 276/279
Okinawa No. 19 135/143 101/101 176/186 207/212 139/139 111/121 177/177 118/143 138/144 126/131 203/203 217/223 145/158 88/95 336/336 93/93 95/103 276/276
Okinawa No. 20 135/137 101/101 186/186 207/212 135/139 121/121 177/177 118/118 132/144 126/131 203/203 217/217 145/145 95/95 330/336 95/95 95/95 276/279
Okinawa No. 21 135/135 101/101 186/186 207/232 139/139 109/121 177/177 118/118 138/144 126/131 203/203 217/223 145/145 95/95 330/336 93/93 95/95 279/279
Okinawa No. 22 137/143 101/101 178/186 214/214 135/139 117/121 177/177 143/143 138/138 126/131 203/203 223/223 145/158 88/95 336/336 93/93 97/103 276/276
Okinawa No. 23 135/143 101/101 180/180 212/232 139/139 109/109 177/177 143/143 138/168 131/131 203/203 217/217 145/145 88/95 330/330 95/95 97/97 276/279
Okinawa No. 24 135/143 101/101 180/186 214/232 139/151 109/121 177/177 118/118 138/168 126/131 203/203 223/223 145/158 95/95 336/336 91/95 95/99 276/276
A. ananasoides 145/153 86/110 178/184 216/226 126/126 118/118 189/204 155/163 158/158 129/129 199/203 219/219 151/156 88/88 324/324 93/93 97/97 277/277
A882 137/137 101/101 178/178 207/214 135/135 117/121 177/177 143/143 132/138 126/126 203/203 223/223 145/145 88/89 336/336 93/95 97/97 276/276
Bogor 135/143 101/101 176/178 207/232 135/139 121/121 177/177 118/143 138/144 131/131 203/203 223/223 145/158 95/95 330/336 93/95 95/99 276/279
Cream Pineapple 135/137 101/101 180/186 207/212 139/139 109/121 177/177 118/143 144/168 131/131 203/203 217/217 145/145 88/95 330/336 93/95 95/97 275/276
Hawaiian Smooth Cayenne 137/143 101/101 176/186 207/212 135/139 121/121 177/177 118/143 132/144 126/131 203/203 217/223 145/145 88/95 330/336 93/95 95/99 276/279
HI101 135/143 null/null 178/186 207/214 139/139 117/121 177/177 118/143 132/132 126/131 203/203 217/217 145/145 88/95 336/336 93/95 95/95 276/279
I-43-880 137/137 101/101 176/176 212/214 139/151 111/111 177/177 118/143 138/138 126/126 203/203 223/223 158/158 95/95 336/336 91/95 97/103 276/276
McGregor ST-1 135/143 null/null 178/186 232/232 135/139 121/121 177/177 118/118 138/138 126/131 203/203 223/223 145/158 95/95 330/336 93/95 95/99 276/279
MD2 135/137 101/101 178/178 207/232 135/139 117/117 177/177 143/143 132/138 126/126 203/203 217/223 145/145 88/95 330/336 93/95 95/103 275/276
Red Spanish 135/137 101/101 178/178 233/233 135/139 117/117 175/177 118/143 132/132 126/126 207/209 217/219 145/158 95/95 330/336 95/95 95/95 276/279
Seijyo Cayenne 137/137 101/101 176/178 207/233 135/139 117/121 177/177 118/118 132/132 126/126 203/203 217/217 145/158 88/95 330/336 95/95 95/99 276/279
Tainung No. 11 135/143 101/101 186/186 207/232 139/139 121/121 177/177 118/118 138/144 126/131 203/203 217/223 145/158 95/95 336/336 95/95 95/99 276/276
Tainung No. 17 135/137 101/101 176/186 207/232 135/139 121/121 177/177 118/118 132/138 126/131 203/203 217/223 145/158 88/95 330/336 93/93 95/95 276/279
Fig. 1

Phenogram of the 31 pineapple accessions evaluated in this study. The phenogram was produced using the UPGMA method based on Dice’s coefficient.

We constructed a phenogram of the 31 accessions based on SSR analysis (Fig. 1). The accession belonging to the related species A. ananasoides was clearly separated from the other 30 pineapple accessions. These 30 pineapple accessions were not separated into distinct groups but seemed to be mingled together, and there was little relationship between the cultivar types and the genetic distances based on the SSR analysis. Although some accessions were used representing several types, i.e., ‘Cream Pineapple’ (Maipure type), ‘McGregor ST-1’ (Queen type), ‘Red Spanish’ (Spanish type), ‘Seijyo Cayenne’ and ‘Hawaiian Smooth Cayenne’ (Cayenne type), no distinct groups were found.

Parentage analysis

We examined parent-offspring relationships of 15 pineapple cultivars and breeding lines bred by OPARC-Nago by using 17 SSR genotypes of the 18 loci (Table 3, all except for TsuAC007). SSR analysis suggested that ‘N67-10’ had been selected and bred from a sport or mutant of ‘Hawaiian Smooth Cayenne’ (Ikemiya et al. 1984). The parentage analysis was conducted by comparing SSR alleles in the accessions and their reported parents. The parentage of ten accessions (‘Soft Touch’, ‘Summer Gold’, ‘Yugafu’, ‘Julio Star’ and Okinawa No. 9, 13, 17, 19, 22 and 24) was reconfirmed: in each of these accessions, the SSR alleles at each locus were consistent with one allele being contributed by each of the reported parents. Parent-offspring relationships were also reconfirmed between Okinawa No. 21 and ‘Yugafu’ and Okinawa No. 23 and ‘Julio Star’; but in each case, the second parent was not available for testing. A discrepancy at one SSR locus TsuAC018 was found for ‘Gold Barrel’ and its reported parents ‘Cream Pineapple’ and ‘McGregor ST-1’, which might have been caused by a mutation, otherwise the existence of a null allele, i.e., 109/null, 109/121 and 121/null genotypes for ‘Gold Barrel’, ‘Cream Pineapple’ and ‘McGregor ST-1’, respectively. In the case of Okinawa No. 20, the SSR data were inconsistent with the reported parentage (‘Yugafu’ × ‘Summer Gold’) but suggested another possible set of parents (‘Yugafu’ × ‘N67-10’).

Discussion

Interest in plant breeders’ rights is increasing worldwide. The International Union for the Protection of New Varieties of Plant (UPOV; http://www.upov.int/index_en.html) promotes the development and use of effective systems of plant variety protection. The BMT (Biochemical and Molecular Techniques, and DNA-Profiling in Particular) working group of UPOV agreed to establish DNA profiling techniques for protecting plant breeders’ rights. In Japan, ten DNA profiling manuals for major crops, including rice (Oryza sativa L.), kidney bean (Phaseolus vulgaris L.), adzuki-bean (Vigna angularis (Willd.) Ohwi & Ohashi.), strawberry (Fragaria × ananassa Duchesne), sweet cherry (Prunus avium L.) and Japanese pear (Pyrus pyrifolia Nakai), have been released on the Plant Variety Protection home page (http://www.hinsyu.maff.go.jp/en/en_top.html). Among them, methods for the use of SSR markers in fruit species are given for sweet cherry and Japanese pear.

Genome-specific CAPS markers had greatly contributed to prevent an infringement of breeder’s rights in strawberry (Kunihisa 2011). Packed strawberry fruits imported from Korea labeled as ‘Nyoho’ were identified to be a mix of ‘Redpearl’ and ‘Sachinoka’ by using CAPS markers (Kunihisa et al. 2005). After admonition to dealers and action to the court, the volume of illegally imported strawberry fruits sharply decreased. On the case of sweet cherry, ‘Benishuho’ in which Yamagata Prefecture holds the breeder’s right, was unlawfully taken out overseas by an Australian citizen residing in Tasmania, producing and selling fruits. Thus, Yamagata Prefecture established DNA profiling system for fruit tissues using SSR markers and lodged a criminal complaint against the exporters (Takashina et al. 2007, 2008). The other recent breeder’s rights infringement cases, DNA profiling methods were developed for rush, kidney bean, adzuki-bean and etc. In this study, the SSR-based identification system for major pineapple cultivars in Japan was developed, which will contribute greatly to protecting plant breeders’ rights.

Kato et al. (2004) reported that major cultivar types such as Cayenne, Spanish and Queen, could not be distinctively separated based on AFLP analysis using 148 accessions of A. comosus and 14 of related species. In this study, the 31 pineapple accessions were not clustered into distinct groups in a phenogram constructed from the results of the SSR analysis. Therefore, it is considered that cultivar types have been classified based on morphological similarity, and that DNA analysis was not in good accordance with morphological classification. Further DNA analysis will help us establish an accurate classification system. Our results suggested that abundant genetic variation existed within cultivars and breeding lines in Japan and foreign accessions. Discrete DNA profiling of pineapples by SSR markers will be utilized for cultivar protection systems.

Accurate information about parent-offspring relationships is necessary for efficient breeding programs. SSR markers have been used for parentage analyses of grapes (Bowers and Meredith 1997, Bowers et al. 1999, Sefc et al. 1997), peaches (Testolin et al. 2000, Yamamoto et al. 2003), apples (Kitahara et al. 2005, Moriya et al. 2011) and pears (Sawamura et al. 2008). We examined parent-offspring relationships of 15 pineapple cultivars by using 17 SSR loci and reconfirmed the parentage for 14 of the cultivars. In the case of Okinawa No. 20, a candidate for its true parent combination was identified.

Acknowledgments

We thank Dr. H. Fujii for valuable discussion and suggestions on the experiments and the manuscript.

Literature Cited
  •  Botella,  J.R. and  M.  Smith (2008) Genomics of pineapple, crowning the king of tropical fruits. In:  Moore,  P. H. and  R.  Ming (eds.) Plant Genetics/Genomics: Genomics of Tropical Crop Plants, Springer, USA, pp. 441–451.
  •  Bowers,  J.E. and  C.P.  Meredith (1997) The parentage of a classic wine grape, Cabernet Sauvignon. Nature Genet. 16: 84–87.
  •  Bowers,  J.,  J.M.  Boursiquot,  P.  This,  K.  Chu,  H.  Johansson and  C.  Meredith (1999) Historical genetics: the parentage of Chardonnay, Gamay and other wine grapes of northeastern France. Science 285: 1562–1565.
  •  Brownstein,  M.J.,  J.D.  Carpten and  J.R.  Smith (1996) Modulation of nontemplated nucleotide addition by tag DNA polymerase: primer modifications that facilitate genotyping. Biotechniques 20: 1004–1010.
  •  Fujii,  H.,  T.  Ogata,  T.  Shimada,  T.  Endo,  T.  Shimizu and  M.  Omura (2007) Development of a novel algorithm and the computer program for the identification of minimal marker sets of discriminating DNA markers for efficient cultivar identification. Plant & Animal Genomes XV Conference, p. 883.
  •  Fujii,  H.,  H.  Yamashita,  T.  Shimada,  T.  Endo,  T.  Shimizu and  T.  Yamamoto (2008) MarkerToolKit: an analysis program for data sets consist of DNA maker types obtained from various varieties. DNA Polymorph. 16: 103–107.
  •  Ikemiya,  H.,  A.  Onaha and  H.  Nakasone (1984) Excellent strain N67-10 in pineapple. Kyushu Agricultural Research 46: 268.
  •  Kato,  C.Y.,  C.  Nagai,  P.H.  Moore,  F.  Zee,  M.S.  Kim,  D.L.  Steiger and  R.  Ming (2004) Intra-specific DNA polymorphism in pineapple (Ananas comosus (L.) Merr.) assessed by AFLP markers. Genet. Resour. Crop Evol. 51: 815–825.
  •  Kitahara,  K.,  S.  Matsumoto,  T.  Yamamoto,  J.  Soejima,  T.  Kimura,  H.  Komatsu and  K.  Abe (2005) Molecular characterization of apple cultivars in Japan by S-RNase analysis and SSR markers. J. Amer. Soc. Hort. Sci. 130: 885–892.
  •  Kunihisa,  M.,  S.  Matsumoto and  N.  Fukino (2005) Cultivar identification of strawberry fruits imported from Korea by use of DNA markers. Bull. Natl. Inst. Veg. Tea Sci. 4: 71–76.
  •  Kunihisa,  M. (2011) Studies using DNA markers in Fragaria × ananassa: genetic analysis, genome structure, and cultivar identification. J. Jpn. Soc. Hort. Sci. 80: 231–243.
  •  Lin,  F. (1983) History of pineapple industry in Okinawa, Okinawa pineapple industrial history publication, Japan, pp. 1–610.
  •  Marshall,  T.C.,  J.  Slate,  L.  Kruuk and  J.M.  Pemberton (1998) Statistical confidence for likelihood-based paternity inference in natural populations. Mol. Ecol. 7: 639–655.
  •  Moriya,  S.,  H.  Iwanami,  K.  Okada,  T.  Yamamoto and  K.  Abe (2011) A practical method for apple cultivar identification and parent-offspring analysis using simple sequence repeat markers. Euphytica 177: 135–150.
  •  Morton,  J. (1987) Pineapple. In:  Morton,  J.F. and  F.L.  Miami (eds.) Fruits of Warm Climates, pp. 18–28.
  •  Nunome,  T.,  S.  Negoro,  K.  Miyatake,  H.  Yamaguchi and  H.  Fukuoka (2006) A protocol for the construction of microsatellite enriched genomic library. Plant Mol. Biol. Rep. 24: 305–312.
  •  Popluechai,  S.,  S.  Onto and  P.D.  Eungwanichayapant (2007) Relationships between some Thai cultivars of pineapple (Ananas comosus) revealed by RAPD analysis. Songklanakarin J. Sci. Technol. 29: 1491–1497.
  •  Rohlf,  F.J. (1998) NTSYS, numerical taxonomy and multivariate analysis system, Ver. 2.01. Exeter Publishing, Ltd., Setauket, New York.
  •  Rozen,  S. and  H.J.  Skaletsky (2000) Primer3 on the WWW for general users and for biologist programmers. In:  Krawetz,  S. and  S.  Misener (eds.) Bioinformatics Methods and Protocols: Methods in Molecular Biology, Humana Press, Totowa, NJ, pp. 365–386.
  •  Ruas,  P.M.,  C.F.  Ruas,  D.J.  Fairbanks,  W.R.  Andersen and  J.S.  Cabral (1995) Genetic relationship among four varieties of pineapple, Ananas comosus, revealed by random amplified polymorphic DNA (RAPD) analysis. Brazilian Journal of Genetics 18: 413–416.
  •  Sawamura,  Y.,  N.  Takada,  T.  Yamamoto,  T.  Saito,  T.  Kimura and  K.  Kotobuki (2008) Identification of parent-offspring relationships in 55 Japanese pear cultivars using S-RNase allele and SSR markers. J. Jpn. Soc. Hort. Sci. 77: 364–373.
  •  Sefc,  K.M.,  H.  Steinkellner,  H.W.  Wagner,  J.  Glossl and  F.  Regner (1997) Application of microsatellite markers to parentage studies in grapevine. Vitis 36: 179–183.
  •  Takashina,  T.,  M.  Ishiguro,  K.  Nishimura and  T.  Yamamoto (2007) Genetic identification of imported and domestic sweet cherry varieties using SSR markers. DNA Polymorphism 15: 101–104.
  •  Takashina,  T.,  R.  Endo,  H.  Fujii and  T.  Yamamoto (2008) Application of the genetic identification method of sweet cherry varieties for processed fruits. DNA Polymorphism 16: 95–98.
  •  Testolin,  R.,  T.  Marrazzo,  G.  Cipriani,  R.  Quarta,  I.  Verde,  M.T.  Dettori,  M.  Pancaldi and  S.  Sansavini (2000) Microsatellite DNA in peach (Prunus persica L. Batsch) and its use in fingerprinting and testing the genetic origin of cultivars. Genome 43: 512–520.
  •  Watanabe,  S. (1961) Cultivation and processing in pineapple, Ryukyu Canned Pineapple Association, Japan, pp. 84–88.
  •  Weber,  J.K. and  P.E.  May (1989) Abundant class of human DNA polymorphisms which can be typed using the polymerase chain reaction. Am. J. Hum. Genet. 44: 388–397.
  •  Wee,  Y.C. and  M.L.C.  Thongtham (1991) Ananas comosus (L.) Merr. In:  Verheij,  E.W.M. and  R.E.  Coronel (eds.) Plant Resources of South-East Asia No. 2 Edible fruits and nuts. Pudoc, Wageningen, the Netherlands, pp. 66–71.
  •  Wohrmann,  T. and  K.  Weising (2011) In silico mining for simple sequence repeat loci in a pineapple expressed sequence tag database and cross-species amplification of EST-SSR markers across Bromeliaceae. Theor. Appl. Genet. 123: 635–647.
  •  Yamamoto,  T.,  K.  Mochida,  T.  Imai,  T.  Haji,  H.  Yaegaki,  M.  Yamaguchi,  N.  Matsuta,  I.  Ogiwara and  T.  Hayashi (2003) Parentage analysis in Japanese peaches using SSR markers. Breed. Sci. 53: 35–40.
  •  Yamamoto,  T.,  T.  Kimura,  T.  Hayashi and  Y.  Ban (2006) DNA profiling of fresh and processed fruits in pear. Breed. Sci. 56: 165–171.
 
© 2012 by JAPANESE SOCIETY OF BREEDING
feedback
Top