2022 年 72 巻 3 号 p. 248-256
The Japanese domestic tobacco (Nicotiana tabacum L.) cultivar ‘Kokubu’ shows high powdery mildew resistance that is controlled by splice-site mutations of two MILDEW LOCUS O genes, NtMLO1 and NtMLO2. We investigated the existence of the same NtMLO1/2 splice mutations in the genomes of various tobacco varieties cultivated in Japan and other countries. In total, 14 Japanese domestic cultivars, which were mainly distributed in Kagoshima, had splice-site mutations in both NtMLO1 and NtMLO2. In addition, tobacco cultivars containing only the NtMLO1 splice-site mutation were found in various tobacco production areas in Japan, but no cultivars with only the NtMLO2 splice-site mutation were detected. Moreover, the NtMLO1 splice-site mutation was detected in native Asian, Oriental and cigar tobacco varieties. Consequently, we speculate that these powdery mildew-resistant tobacco cultivars were generated relative recently in the Kagoshima area when a spontaneous mutation occurred at the NtMLO2 splice site in a cultivar already containing the NtMLO1 splice-site mutation and that the NtMLO1 splice-site mutation occurred during the early period of tobacco seed dissemination from the Americas to Asia and Japan.
Tobacco (Nicotiana tabacum L.) is a Solanaceae plant that originated from tropical or subtropical America but is now commercially cultivated in more than 120 countries. It is thought that tobacco seeds were initially introduced into Japan by the Portuguese or Spaniards in the 16th–17th centuries, but this has not been confirmed. Tobacco plant cultivation and smoking tobacco quickly spread in Japan (Handa 2009). The Edo Shogunate of Japan banned or restricted tobacco cultivation several times to secure annual tributes of rice. These policies led to the cultivation of tobacco in isolated mountains and remote areas that were not fit for rice farming, which in turn led to the development and accumulation of technologies unique to each habitat. The plant type and leaf shape became differentiated by the selection of tobacco suitable for local weather and climatic conditions. Additionally, the taste and aroma were diversified by the development of drying methods, and so-called domestic cultivars were gradually established in each region (Ohashi 1984). According to a survey by the Leaf Tobacco Division, Ministry of Finance conducted in 1898, there were more than 170 domestic tobacco cultivars in Japan, and these cultivars have been divided into six groups (‘Daruma’, ‘Nakano’, ‘Usuha’, ‘Hatano’, ‘Suifu’ and ‘Kokubu’) on the basis of leaf shape (Ohashi 1984).
The Japanese domestic tobacco cultivar ‘Kokubu’ was isolated as a new variety from the fields of the Kokubu area of Kagoshima (Satsuma) during the Bunka Period (1804–1818) (Eyama 1992). Kagoshima is a famous tobacco cultivation area of Japan, and several other domestic cultivars, such as ‘Maru’, ‘Izumi’, ‘Tarumizu’ and ‘Ibusuki’, were cultivated in the past. Because the cured leaves of cultivar ‘Kokubu’ have superior characteristics for kiseru smoking, Kokubu became a famous tobacco production area of Japan.
The cultivar ‘Kokubu’ is resistant to the plant fungal disease powdery mildew owing to recessive alleles at two loci. This resistance was identified by Wan (1962), and Fujimura et al. (2016) revealed that this resistance results from splice-site mutations of two MILDEW LOCUS O genes, NtMLO1 and NtMLO2. The MLO genes encode a plant-specific seven-transmembrane domain protein that localizes to the plasma membrane (Devoto et al. 2003). The N. tabacum genome contains 15 MLO genes forming seven clades, and the two MLO genes of clade V, NtMLO1 and NtMLO2, are related to powdery mildew susceptibility (Appiano et al. 2015). Splice-site mutations in the NtMLO1 and NtMLO2 genes of cultivar ‘Kokubu’ confer resistance to powdery mildew owing to the resulting deletions or insertions in the transcripts of both genes that lead to the production of incorrect transcripts (Fujimura et al. 2016). Powdery mildew resistance as a result of loss-of-function MLO alleles has been observed in various dicots and monocots, such as pea (Pavan et al. 2011), Arabidopsis (Consonni et al. 2006), tomato (Bai et al. 2008), cucumber (Nie et al. 2015) and barley (Büschges et al. 1997). The powdery mildew resistance trait of ‘Kokubu’ has been introduced into the various modern tobacco varieties (Hamamura et al. 1981).
Furthermore, some other domestic tobacco cultivars of Japan are powdery mildew resistant (Ohashi 1984), and many, such as ‘Maru’ and ‘Izumi’, originated in Kagoshima. Thus, we hypothesized that the powdery mildew resistant loci of such domestic cultivars may have been introduced from ‘Kokubu’. Because this resistance is caused by the two natural recessive mutations in the NtMLO1/2 genes, it is reasonable to assume that ‘Kokubu’ was either generated by crossing two varieties each having a splice-site mutation in either the NtMLO1 or NtMLO2 gene, or by a spontaneous mutation of the NtMLO gene in a variety already having a splice-site mutation in the other NtMLO gene. If this hypothesis is correct, then there should be varieties containing a single mutant of NtMLO1 or NtMLO2 among Japanese domestic tobacco cultivars. However, it is unclear when and how these two natural mutations formed, and existence of cultivars harboring a single of the NtMLO gene mutation has not been confirmed.
To investigate these hypotheses, we determined the presence of NtMLO1/2 splice-site mutations in 84 Japanese domestic tobacco cultivars and 94 foreign tobacco varieties using an allele-specific PCR method (Komatsu et al. 2020). We identified 14 Japanese domestic cultivars with NtMLO1/2 splice-site mutations, and we also identified some Japanese domestic cultivars and foreign varieties containing only the NtMLO1 splice-site mutation. Consequently, we developed a hypothesis for the origins of the two splice-site mutations.
Tobacco seeds were obtained from the genetic resources of the Leaf Tobacco Research Center, Japan Tobacco Inc. In total, 84 Japanese domestic cultivars from various tobacco production areas were used for the analysis. In addition, 30 native tobacco varieties of Asia (Philippines, Indonesia, Thailand, India and Nepal), 6 native tobacco varieties of the Americas (Brazil, Colombia and Canada), 35 Oriental tobacco varieties (Turkey, Greece and the former Yugoslavia) and 23 cigar tobacco varieties from various countries (Canada, USA, Colombia, Puerto Rico and the Philippines) were used for the analysis. Many of these varieties have been selected in their respective regions and cultivated for many years. The origin and leaf shape of each variety were provided in the Leaf Tobacco Research Center genetic resources database.
Splice-site mutation analysisGenomic DNA was isolated from young leaf tissues using a Gentra Puregene Cell kit (QIAGEN) according to the manufacturer’s instructions. The splice-site mutations in the NtMLO1/2 genes were analyzed using the duplex allele-specific PCR method described in Komatsu et al. (2020). The obtained PCR fragments were separated using a QIAxcel Advanced System (QIAGEN), and the presence of splice-site mutations was determined by the amplification or non-amplification of DNA fragments with the primer pairs specific for the mutant or wild type of each NtMLO gene.
Phylogenetic analysisGenotyping data for each Japanese domestic cultivar and modern tobacco varieties K326 (flue-cured variety) and TN90 (burley tobacco) as an outgroup were obtained from 30 simple sequence repeat (SSR) markers and 31 loci. The sequences of SSR markers used are provided in Table 1. Each forward primer was labeled with a FAM, VIC, TET or NED fluorescent dye (Applied Biosystems) at the 5ʹ end, and a tail sequence (5ʹ-GTGTCTT-3ʹ) was added to each reverse primer. PCR amplification was performed using a QIAGEN Multiplex kit, modified to three set for multiplex reactions in accordance with Komatsu et al. (2020). The PCR products were diluted 50-fold, and 1 μl of Hi-Di formamide (Thermo Fisher Scientific) was added to 10 μl of diluted solution. The mixture was heated for 5 min at 96°C, cooled rapidly on ice, electrophoresed using a 3730xl DNA Analyzer (Life Technology, Applied Biosystems) and analyzed using GeneMapper ver. 4.0 software (Applied Biosystems). A dendrogram was constructed by the neighbor-joining method (Nei et al. 1983) using Populations 1.2.3 (Langella 1999), and a phylogenetic tree was constructed using MEGA X software (megasoftware.net). The reliability of each node was evaluated by 1000 trials of the bootstrap method.
| Primer pairs | Primer No. |
Fowerd primer Sequence | Fluorescent labels |
Reverse primer sequence |
|---|---|---|---|---|
| Group 1 | 1 | TGAGTACATGTTATCTACAAGATCAGGA | FAM | GTGTCTTAATAAAGAATGCTATTCGGTGATACCAG |
| 2 | TGTCTCGTGAAGCATGAA | VIC | GTGTCTTGGAAATGGAGGATCTCGT | |
| 3 | AATTCCTTTCTATCTCTAACTACTACTACA | NED | GTGTCTTCTTTACCTTCCATCTTTTTAATTGTGTATC | |
| 4 | CCTTTCTGACTTGCTTACGACTACAAA | NED | GTGTCTTGTCTATCACTGACTTTGGTTCCCCTGAA | |
| 5 | TGACCACATGAAGGTGCATT | NED | GTGTCTTGAGCTAGAAATAGGTTGTTTGGG | |
| 6 | TTTGGTGAGGTGTTACGATAAAGA | FAM | GTGTCTTTCCACACCAAACATCAACTTT | |
| 7 | TTCGGCTACCAGCACTATACC | PET | GTGTCTTTCTTATTTGCTGCAGGAATGC | |
| 8 | CCCGGCTGATGATATGTGTA | VIC | GTGTCTTTCACGAGGAAGGAGAATGGT | |
| 9* | TTTGGAATCAATAAGACGACAA | FAM | GTGTCTTTTGACCAGTAGGCTTATCACACA | |
| 10 | CTCGAACGAACATGTATACTTCGTGTA | PET | GTGTCTTGATTACGAGTCTGTCTCCTTCTTCTAA | |
| 11 | GGGCCTACCTATAGAAATAGATATACTTTAAC | PET | GTGTCTTGTGTCTTTCGTATAGATGAGTAACAGAACTTGTCC | |
| Group 2 | 12 | GTCTACGATCCCATTGCTTTTTAT | FAM | GTGTCTTTGTGATTTACGTAATTGGTTTGCT |
| 13 | CAATACCTAAATTTGAGGAGGTTGT | FAM | GTGTCTTTTAATTTTCAGCTAGAGAGAGAGATGAG | |
| 14 | ACCCCTCTCCTAATTAATTTCCAAC | VIC | GTGTCTTCGGATCGTAAATTTTAGGCAAGAAG | |
| 15 | TTCACAGGGTGGGAAAATGT | FAM | GTGTCTTACTCCTAAACCTCGCCCAAC | |
| 16 | GAGCCACATAACCCATACATCTCTATT | NED | GTGTCTTTTACCTGGGAAAGGAAGCTTGTTGATT | |
| 17 | CAAACGCCCACTTAGTCTATCCAAAAA | PET | GTGTCTTGTAGAAAAATCAGGTCGGCACATGAGG | |
| 18 | GGATGTGGATGCGGGTAA | VIC | GTGTCTTCAAACGGTGCAGTGTTCTGT | |
| 19 | CTTCTTCCTAAGCCGAGGGT | NED | GTGTCTTTTGATGATAGAACGCAACTCG | |
| 20 | TGATCACACTTGATAGCCTAAAGAA | NED | GTGTCTTCGCACGACCTATACCCATTT | |
| 21 | GGAGAGAGATGATATTTAAGTGGTTTCT | PET | GTGTCTTGTCTCTTTTCTAACCTCTCCAACTATTTTATGCAG | |
| Group 3 | 22 | TCCCAGTGAAGATTAGCTTTCAAGA | PET | GTGTCTTGGCACAAAGTATCAGTTAAAGCAAC |
| 23 | GGATCTTGCCCATAATCTTAATTTCTCA | VIC | GTGTCTTGTTCGCTGGATGTTGCAGAGAATTTTT | |
| 24 | GTATGCAGGAATGAAATTACCACAATAG | NED | GTGTCTTGAATATTTATGGCTTGTTTCAGACCAC | |
| 25 | GTAAAAATGGGGAGACATCACGAAAAC | FAM | GTGTCTTGAAGAGGGAGTTTCCTTTACTTGAGAT | |
| 26 | GTTTGCAGATTGCACAGCTT | VIC | GTGTCTTTGCTGAGATCATTGTGAGGC | |
| 27 | AGTTGCAGGATTGTTCGCTT | FAM | GTGTCTTCGACTGCAAGAGTTGGCAAT | |
| 28 | ATTCTTAAACACTCCACACAAAAACAAG | VIC | GTGTCTTACTATTAAGTTTTGATGAACCCGTAT | |
| 29 | GCACAAACTCGATTCAGAACATGCAAT | NED | GTGTCTTAAATCAGTTAGTTAGACGGTGCTAGACG | |
| 30 | AGGTTCAATGGTTGGGAGAAATTAAC | PET | GTGTCTTCATGATGTTGTGGTCTTACTTTGTAATG |
* No. 9 marker was detected for two loci.
Tail sequence (5ʹ-GTGTCTT-3ʹ) was added to the reverse primer.
The susceptibility of tobacco plants to powdery mildew was confirmed using the method described in Fujimura et al. (2016). The tobacco plants were grown in clay pots in a greenhouse maintained at 25°C. The powdery mildew spore solution (approximately 2.5 × 104 spore/ml) was splayed on the tobacco plants, and they were checked for disease symptoms at 3 weeks after inoculation.
To determine the presence of NtMLO1/2 splice-site mutations, 84 Japanese domestic cultivars originating from various tobacco production areas were analyzed (Table 2). Among them, 14 cultivars had splice-site mutations in both NtMLO1 and NtMLO2 genes and showed high resistance against powdery mildew. Interestingly, 13 of 14 cultivars originated from Kagoshima and the leaf shape of each cultivar is ‘Kokubu’ type. The remaining cultivar, ‘Bingo (Ito)’, was cultivated in Hiroshima and has the ‘Suifu’-type leaf shape.
| Cultivar | NtMLO1 | NtMLO2 | Leaf type | Origin |
|---|---|---|---|---|
| Aizu | W | W | Suifu | Fukushima |
| Akatsuka (Kataikari) | M | W | Suifu | Niigata |
| Akatsuka (Matsuyama-Edo) | W | W | Suifu | Niigata |
| Awa (Chisha) | W | W | Daruma | Tokushima |
| Awa (Senmai) | W | W | Daruma | Tokushima |
| Awa (Tayou) | W | W | Daruma | Tokushima |
| Awa (Yamashiro) | W | W | Daruma | Tokushima |
| Awa (Sadamitsu) | W | W | Daruma | Tokushima |
| Bichu | W | W | Suifu | Okayama |
| Bichu (Nochi) | W | W | Suifu | Okayama |
| Bingo (Ito) | M | M | Suifu | Hiroshima |
| Bingo (Shinsaka) | W | W | Suifu | Hiroshima |
| Bungo | W | W | Daruma | Ohita |
| Daruma (Chu-daruma) | M | W | Daruma | Tochigi |
| Daruma (Oh-daruma) | M | W | Daruma | Tochigi |
| Daruma (Takeda-daruma) | M | W | Daruma | Ohita |
| Daruma (Fuku-daruma) | M | W | Daruma | Ibaraki |
| Daruma (Batou 12) | M | W | Daruma | Ibaraki |
| Ensyu | W | W | Daruma | Shizuoka |
| Hatano | W | W | Hatano | Kanagawa |
| Hatano (Kankou) | W | W | Kanagawa | |
| Higashine | W | W | Suifu | Yamagata |
| Higashiyama | W | W | Suifu | Iwate |
| Higo (Takachiho) | W | W | Suifu | Kumamoto |
| Hino (Oh-ha) | W | W | Daruma | Tottori |
| Hino (Shou-ha) | W | W | Tottori | |
| Hino (Tachi-ha) | W | W | Suifu | Tottori |
| Hirae tabako | W | W | Kagoshima | |
| Ibusuki (Kensaki) | W | W | Suifu | Kagoshima |
| Ibusuki (Kensakitamarishouha) | W | W | Suifu | Kagoshima |
| Ibusuki (Oh-muhei) | W | W | Suifu | Kagoshima |
| Ibusuki (Shou-muhei) | W | W | Suifu | Kagoshima |
| Ibusuki (Bulgaria) | W | W | Suifu | Kagoshima |
| Ibusuki primitive 1 | W | W | Suifu | Kagoshima |
| Ikusaka | W | W | Suifu | Nagano |
| Izumi | M | M | Kokubu | Kagoshima |
| Izumi (Komatsu) | M | M | Kokubu | Kagoshima |
| Izumi (Kamimasumi) | M | M | Kokubu | Kagoshima |
| Izumi (Tanoue) | M | M | Kokubu | Kagoshima |
| Joza | W | W | Daruma | Fukuoka |
| Kangaku | M | M | Kokubu | Kagoshima |
| Katsuyama | M | W | Daruma | Fukui |
| Kirigasaku | W | W | Daruma | Chiba |
| Kibi | M | W | Suifu | Okayama |
| Kokubu (Oh-horo) | M | M | Kokubu | Kagoshima |
| Kokubu (Ko-horo) | M | M | Kokubu | Kagoshima |
| Kuro (No. 1) | M | W | Suifu | Kumamoto |
| Kuro (No. 2) | M | W | Suifu | Kumamoto |
| Kurokamiyama | W | W | ||
| Maru | M | M | Kokubu | Kagoshima |
| Maru (Kagoshima) | M | M | Kokubu | Kagoshima |
| Maru (Kagomaru) | M | M | Kokubu | Kagoshima |
| Maru (Ryuou) | M | M | Kokubu | Kagoshima |
| Maru (Tabuse 3) | M | M | Kokubu | Kagoshima |
| Matsukawa | W | W | Suifu | Fukushima |
| Matsukawa (Kanto) | W | W | Suifu | Fukushima |
| Matsukawa (Ohkoshichikanari) | W | W | Suifu | Fukushima |
| Mihara | W | W | Hiroshima | |
| Mihara (Awa) | W | W | Daruma | Hiroshima |
| Miura | W | W | Daruma | Kanagawa |
| Miyazaki | M | W | Kokubu | Miyazaki |
| Nakano | M | W | Nakano | Shiga |
| Nanbu | M | W | Suifu | Iwate |
| Ogasawara primitive | W | W | Ogasawara-jima | |
| Ohkusa (Hanken) | W | W | Suifu | Aichi |
| Ohkusa (Ishiken) | W | W | Suifu | Aichi |
| Okinawa | M | W | Suifu | Okinawa |
| Renge | W | W | Fukushima | |
| Renge (shirobana) | W | W | Daruma | Saitama |
| Saga primitive | W | W | Suifu | Saga |
| Sakusyu (Aka-arifuku) | W | W | Suifu | Okayama |
| Sakusyu (Nawashiro-arifuku) | W | W | Suifu | Okayama |
| Seinaiji | M | W | Suifu | Nagano |
| Suifu (Kataikari) | M | W | Suifu | Ibaraki |
| Suifu (Oh-ha) | W | W | Hatano | Ibaraki |
| Suifu (Mineshima) | W | W | Ibaraki | |
| Tarumizu | M | W | Kokubu | Kagoshima |
| Tarumizu (Ishiodori) | M | M | Kokubu | Kagoshima |
| Tsurugi | W | W | Suifu | Ishikawa |
| Ueji | M | W | Suifu | Mie |
| Usuha | W | W | Usuha | Niigata |
| Yoshino | W | W | Daruma | Nara |
| Yonezawa | W | W | Suifu | Yamagata |
| Yonezawa (Kanto) | W | W | Suifu | Yamagata |
This table shows the existence of splice-site mutations in NtMLO1/2 genes (W: wild type, M: mutant), leaf type (‘Suifu’, ‘Kokubu’, ‘Daruma’, ‘Nakano’, ‘Hatano’ or ‘Usuha’ type), and original cultivation area (indicated by Prefecture name) of each cultivar. Leaf types and origins of some cultivars are unknown (vacant cells).
In total, 18 cultivars had a mutation only in the NtMLO1 splice site. These varieties were from various tobacco production areas, ranging from Iwate to Okinawa, and had four types of leaf shape: ‘Kokubu’ and ‘Suifu’ types, having petioles, and sessile ‘Daruma’ and ‘Nakano’ types (Fig. 1). However, there was no correlation between the NtMLO1 splice-site mutation and leaf shape, and the cultivars with the ‘Suifu’- or ‘Daruma’-type leaf shape did not necessarily have the NtMLO1 splice-site mutation. Cultivar ‘Tarumizu (Ishiodori)’ contained splice-site mutations in both NtMLO1 and NtMLO2 genes, whereas cultivar ‘Tarumizu’ had a splice-site mutation only in the NtMLO1 gene, and both had the ‘Kokubu’-type leaf shape. All five ‘Daruma’ group cultivars we tested in this study had NtMLO1 splice-site mutation. We tested three ‘Suifu’ group cultivars, and only cultivar ‘Suifu (Kataikari)’ had NtMLO1 splice-site mutation. Here, cultivars with the NtMLO1 splice-site mutation showed susceptibility against powdery mildew (data not shown). We did not find a variety that has a mutation only in the NtMLO2 splice site among the tested Japanese domestic cultivars.
Leaf types of Japanese domestic tobacco cultivars harboring only the NtMLO1 splice-site mutation. Each cultivar was selected and cultivated in the individual tobacco production area (‘Origin’) of Japan. ‘Daruma’- and ‘Nakano’-type leaves are sessile, and ‘Suifu’- and ‘Kokubu’-type leaves have petioles. All these cultivars are susceptible to powdery mildew. The leaves in the upper part of the figure show the typical shape of each leaf type.
We generated a phylogenetic tree of 84 Japanese domestic cultivars (Fig. 2). The cultivars with the NtMLO1/2 splice-site mutations, including ‘Kokubu’ and ‘Bingo (Ito)’, formed one group. Interestingly, this group contained cultivars ‘Tarumizu’ and ‘Miyazaki’, which have only the NtMLO1 splice-site mutation, but the ‘Kokubu’-type leaf shape. The cultivars with ‘Suifu’- and ‘Daruma’-type leaf shapes were roughly divided into two major groups within the phylogenetic tree. The cultivars having the NtMLO1 splice-site mutation and the ‘Suifu’-type leaf shape were distributed throughout the tree branches. However, the cultivars having the NtMLO1 splice-site mutation and the ‘Daruma’-type leaf shape, which were five ‘Daruma’ group cultivars and cultivar ‘Katsuyama’, formed one group.
Phylogenetic tree of 84 Japanese domestic tobacco cultivars based on 30 markers. Cultivars in red and blue indicate the NtMLO1/2 double and NtMLO1 single mutants, respectively. The symbol at the head of the cultivar name indicates the type of leaf shape; ●: ‘Kokubu’ type, ○: ‘Suifu’ type, ■: ‘Daruma’ type, □: ‘Nakano’ type, ▲: ‘Hatano’ type, and ◇: ‘Usuha’ type. Some cultivars do not have their leaf types listed in the Leaf Tobacco Research Center genetic resource database. The numbers in phylogenetic tree indicate the exceeded bootstrap value by 50. The scale bar at the bottom indicates the genetic distance. Modern tobacco varieties K326 (flue-cured variety) and TN90 (burley tobacco) were added as an outgroup.
Most of the cultivars harboring mutations in the splice sites of both NtMLO1 and NtMLO2 were cultivated in Kagoshima. The cultivars that harbored only the NtMLO1 splice-site mutation were from various tobacco production areas of Japan, and no variety having only the NtMLO2 splice-site mutation was identified among the Japanese domestic tobacco cultivars. Thus, we speculated that the splice-site mutation in the NtMLO1 gene occurred during the early period of tobacco seed distribution in Japan or before the introduction of tobacco seeds into Japan. Thus, varieties harboring the NtMLO2 splice-site mutation might be identified by surveying foreign varieties. To confirm this hypothesis, we assessed the presence of NtMLO1/2 splice-site mutations in various foreign tobacco varieties.
We selected native tobacco varieties derived from various countries, as well as Oriental and cigar tobacco varieties. These varieties had been cultivated in their local areas for long time periods. Because Japan was closed to foreigners from the 17th to 19th centuries, it is unlikely that the tobacco seeds were exported from Japan to foreign countries during this period.
In our analysis, we did not find a foreign tobacco variety with splice-site mutations in both the NtMLO1 and NtMLO2 genes. However, the splice-site mutation in the NtMLO1 gene, which was the same as that in cultivar ‘Kokubu’, was detected in some of the Asian native tobacco varieties of the Philippines, Thailand, India and Nepal, Oriental tobacco varieties of Turkey and the former Yugoslavia, and cigar tobacco varieties of the Philippines, and Florida301 that was bred in USA (Table 3). These results suggest that the NtMLO1 splice-site mutation is not restricted to Japanese domestic cultivars. The NtMLO2 splice-site mutation was not found in any tested foreign tobacco variety.
| Variety | NtMLO1 | NtMLO2 | Class | Origin |
|---|---|---|---|---|
| Dork Dang | W | W | Native | Thailand |
| Hu Chang | W | W | Native | Thailand |
| Hu Lahm | W | W | Native | Thailand |
| Slee | M | W | Native | Thailand |
| Sukhothai | M | W | Native | Thailand |
| Bansud | M | W | Native | Philippines |
| Romero | M | W | Native | Philippines |
| Sinai | W | W | Native | Philippines |
| Orinoco | W | W | Native | Indonesia |
| Done Vittanam (Nallapati) | M | W | Native | India |
| Karravittanam | W | W | Native | India |
| Medarametlanuta | M | W | Native | India |
| Naru (Nellore) | W | W | Native | India |
| Rayala | M | W | Native | India |
| Toka-Aku | W | W | Native | India |
| Rayala (No. 1) | M | W | Native | India |
| RPK | W | W | Native | India |
| Sazi | W | W | Native | India |
| Shah-Kot | W | W | Native | India |
| Sivapuri | W | W | Native | India |
| Snuff (Eluru) | W | W | Native | India |
| Thakeri Ramperr | W | W | Native | India |
| Thatayan | W | W | Native | India |
| Tholan | W | W | Native | India |
| Vadamugam | M | W | Native | India |
| Vazhai Kappal | W | W | Native | India |
| Nepal 1288 | W | W | Native | Nepal |
| Nepal 8039 | M | W | Native | Nepal |
| Nepal 6184 (Damre Kacho) | M | W | Native | Nepal |
| Nepal KY | M | W | Native | Nepal |
| Galpao | W | W | Native | Brasil |
| Brazilian domestic variety | W | W | Native | Brasil |
| Carotte | W | W | Native | Brasil |
| Garcia | W | W | Native | Colombia |
| Ambalema | W | W | Native | Colombia |
| Petit Havana | W | W | Native | Canada |
| Agrinion Djebel | W | W | Oriental | Greece |
| Agrinion Myrodata | W | W | Oriental | Greece |
| Agrinion Smyrna Seed | W | W | Oriental | Greece |
| Basma | W | W | Oriental | |
| Basma Boukia Paranestion | W | W | Oriental | Greece |
| Basma Drama Drama | W | W | Oriental | Greece |
| Basma Drama Ferai | W | W | Oriental | Greece |
| Basma Kavala Amisiana | W | W | Oriental | Greece |
| Basma (5A) Kilikis Lakhanas | W | W | Oriental | Greece |
| Basma Komotini-1 Miskon | W | W | Oriental | Greece |
| Basma Komotini Ova Kallisti | W | W | Oriental | Greece |
| Basma Xanthi Ova Bafika | W | W | Oriental | Greece |
| Basma II Zichna Mesorachi | W | W | Oriental | Greece |
| Kabakoulak Gumenitsa Gumenitsa | W | W | Oriental | Greece |
| Kawalla | W | W | Oriental | Greece |
| Kilikis | W | W | Oriental | Greece |
| Kozani | W | W | Oriental | Greece |
| Mahala | W | W | Oriental | Greece |
| Nigrita | W | W | Oriental | Greece |
| Sochos 1 | W | W | Oriental | Greece |
| Dzebel | W | W | Oriental | Ex-Yugoslavia |
| Otlija | M | W | Oriental | Ex-Yugoslavia |
| Prilep | W | W | Oriental | Ex-Yugoslavia |
| Ravnijak | M | W | Oriental | Ex-Yugoslavia |
| Yaka Bolsunov | W | W | Oriental | Ex-Yugoslavia |
| Akhissar-1 | W | W | Oriental | Turkey |
| Akhissar-1 | W | W | Oriental | Turkey |
| Bafra (Black sea) | M | W | Oriental | Turkey |
| Bursa | M | W | Oriental | Turkey |
| Izmir | W | W | Oriental | Turkey |
| Samsun | M | W | Oriental | Turkey |
| Samsun Holmes | M | W | Oriental | Turkey |
| Smyrna | W | W | Oriental | Turkey |
| Welwendo | W | W | Oriental | |
| Zihina | W | W | Oriental | |
| Beinhart1000-1 | W | W | Cigar | USA |
| Connecticut | W | W | Cigar | USA |
| Florida301 | M | W | Cigar | USA |
| Havana | W | W | Cigar | USA |
| Warne | W | W | Cigar | USA |
| Ottawa705 | W | W | Cigar | Canada |
| Cubita | W | W | Cigar | Colombia |
| Olor | W | W | Cigar | Puerto Rico |
| Espado | M | W | Cigar | Philippines |
| Manilla | M | W | Cigar | Philippines |
| Manilla (Cagayan) | M | W | Cigar | Philippines |
| Oxsinisirn | M | W | Cigar | Philippines |
| Oxviz | M | W | Cigar | Philippines |
| Pampano | M | W | Cigar | Philippines |
| Repollo | M | W | Cigar | Philippines |
| Simmaba | M | W | Cigar | Philippines |
| Simox | W | W | Cigar | Philippines |
| Vizcaya | M | W | Cigar | Philippines |
| Vizoxviz | M | W | Cigar | Philippines |
| Java | M | W | Cigar | |
| Penn Leaf1 | W | W | Cigar | |
| Sumatra | W | W | Cigar | |
| Tuta | W | W | Cigar |
This table shows the existence of splice-site mutations in NtMLO1/2 genes (W: wild type, M: mutant), as well as the class (Native: native variety, Oriental: oriental tobacco variety and Cigar: cigar tobacco variety) and origin (indicated by country name) of the varieties examined. The origins of some varieties are not listed in the Leaf Tobacco Research Center genetic resource database. Ex-Yugoslavia: the former Yugoslavia.
We surveyed the splice-site mutations of the NtMLO1 and NtMLO2 genes in various Japanese domestic tobacco cultivars and found that 14 cultivars harbor NtMLO1/2 splice-site mutations. They formed a distinct group in the phylogenetic tree. Among them, 13 cultivars had the ‘Kokubu’-type leaf shape and originated from Kagoshima. However, tobacco cultivars containing only the NtMLO1 splice-site mutation were observed from various tobacco production areas of Japan, and their leaf shapes varied. Additionally, tobacco cultivar containing only the NtMLO2 splice-site mutation was not found. Consequently, we speculated that powdery mildew-resistant tobacco cultivar ‘Kokubu’ was generated relatively recently in the Kokubu area by the occurrence of a spontaneous NtMLO2 splice mutation the ‘Kokubu’-type ancestral tobacco already harboring the NtMLO1 splice-site mutation. Then, this NtMLO1/2 double-mutant tobacco spread to several production areas in Kagoshima and was established as a local domestic cultivar. This may have led to the large number of cultivars with the NtMLO1/2 splice-site mutations in Kagoshima. Cultivar ‘Bingo (Ito)’ has the NtMLO1/2 splice-site mutations, but the leaf shape is ‘Suifu’ type and it originates from Hiroshima. The phylogenetic analysis included cultivar ‘Bingo (Ito)’ in the same group as the other cultivars with the NtMLO1/2 splice-site mutations. Cultivar ‘Bingo (Ito)’ was isolated in 1901 (Ohashi 1984). Therefore, this cultivar is a new variety compared with other ‘Kokubu’ type NtMLO1/2 double-mutant cultivars, and this cultivar might have been generated by breeding in Hiroshima using the NtMLO1/2 double-mutant tobacco introduced from Kagoshima.
Cultivars ‘Tarumizu’ and ‘Miyazaki’, which originated in Kagoshima and Miyazaki, respectively, only have a mutation in the NtMLO1 splice site and have the ‘Kokubu’-type leaf shape. They belong to the group on the phylogenetic tree that contained the NtMLO1/2 double-mutant cultivars although the bootstrap values are lower than 50 in Fig. 2. Consequently, we speculate that both cultivars may have originated from the NtMLO1 single-mutant tobacco that is the common ancestor of the NtMLO1/2 double-mutant cultivars or from progeny of the NtMLO1/2 double-mutant tobacco in which the NtMLO2 splice-site mutation was lost.
Our survey of foreign tobacco varieties showed that the NtMLO1 splice-site mutation occurred not only in Japanese domestic cultivars but also in some of Asian native, Oriental and cigar tobacco varieties. This result indicates that the NtMLO1 splice-site mutation did not occur in Japan. It is unclear when and where the NtMLO1 splice-site mutation occurred during the dissemination of tobacco seeds worldwide, but because it was not detected in the tested native varieties of the Americas, this mutation may have occurred early during the spread of tobacco seeds from the Americas to Asia and Japan via Europe. Japanese domestic tobacco cultivars are thought to have been established from a few ancestral varieties introduced into Japan by the Portuguese and/or Spaniards (Ohashi 1984). Therefore, we speculate that two types of tobacco varieties with and without the NtMLO1 splice-site mutation were included in the tobacco seeds imported into Japan and that both types of seeds were spread through Japan during the national isolation period.
The splice-site mutation in the NtMLO2 gene was not found in foreign tobacco varieties. This result emphasizes that the NtMLO2 splice-site mutation is a spontaneous mutation that occurred in a tobacco plant harboring the NtMLO1 splice-site mutation in Japan.
At present, the cultivation of Japanese domestic tobacco cultivars is decreasing owing to the reduced demand for Japanese domestic tobacco leaves as a tobacco product material, and most of the tobacco varieties cultivated in Japan now are modern flue-cured and burley tobacco varieties used in cigarettes. However, Japanese domestic tobacco cultivars have diverse agronomic traits suitable for each cultivation area. They are useful materials for plant research owing to their diverse genetic traits and have the potential to be good materials for future tobacco breeding.
MA, TT and SS designed this study. MA, TK and SS contributed the splice-site mutation analysis. SS and HU contributed the phylogenetic analysis. MA contributed the powdery mildew susceptibility analysis and drafted the manuscript. All authors read and approved the final manuscript.
