Research Papers
Chromatographic printed array strip (C-PAS) method for cultivar-specific identification of sweetpotato cultivars ‘Beniharuka’ and ‘Fukumurasaki’
2023 年 73 巻 3 号 p. 313-321
詳細
2023 年 73 巻 3 号 p. 313-321
Sweetpotato (Ipomoea batatas) cultivars grown in Japan are highly valued for their excellent sweetness, high quality, and good texture. The export volume of sweetpotato from Japan has been rising rapidly, with a 10-fold increase on a weight basis over the last 10 years. However, since sweetpotato is propagated vegetatively from storage roots, it is easy to cultivate and propagate this crop, prompting concerns that Japanese sweetpotato cultivars/lines are being exported overseas, cultivated without permission, or reimported. Therefore, a rapid and accurate cultivar identification methodology is needed. In this study, we comprehensively analyzed the insertion sites of Cl8 retrotransposon to develop a cultivar identification technique for the Japanese cultivars ‘Beniharuka’ and ‘Fukumurasaki’. These two cultivars were successfully distinguished from other cultivars using a minimum of two marker sets. Using the chromatographic printed array strip (C-PAS) method for DNA signal detection, ‘Beniharuka’ and ‘Fukumurasaki’ can be precisely identified using a single strip of chromatographic paper based on multiplex DNA signals derived from the amplicons of the Cl8 insertion sites. Since this method can detect DNA signals in only ~15 minutes, we expect that our method will facilitate rapid, reliable, and convenient cultivar discrimination for on-site inspection of sweetpotato.
Sweetpotato (Ipomoea batatas (L.) Lam), a crop belonging to the genus Ipomoea of the Convolvulaceae family, is a valuable source of vitamins C and E, minerals and dietary fiber. The annual production of sweetpotato worldwide is approximately 89.5 million tons, and this crop is mainly cultivated in Asia, Africa, Central and South America (FAOSTAT 2020). The country with the largest production volume is China, accounting for approximately 55% of worldwide production (FAOSTAT 2020). Sweetpotato is regarded as one of the most important crops in the world and is used for various purposes such as a raw food, feed, processed product, and raw material for producing shochu (a distilled beverage), starch, and pigments.
The export volume of sweetpotato from Japan has increased rapidly over the past ten year, from 584 tons (with a value of 170 million yen) in 2012 to 5,603 tons (with a value of 2.33 billion yen) in 2021 (https://www.maff.go.jp/j/tokei/kouhyou/kokusai/index.html). Nearly 40% of sweetpotato exported from Japan are exported to Hong Kong, followed by Thailand, Singapore, Taiwan and Malaysia. Japanese sweetpotato is also exported to South Asia, North America, Europe, and other parts of the world. Sweetpotato cultivars grown in Japan are highly valued for their considerable sweetness, excellent quality, and good texture. However, since it is easy to cultivate and propagate sweetpotato vegetatively from storage roots, there are concerns about the possibility of Japanese sweetpotato cultivars/lines being exported overseas, cultivated without permission, or reimported.
To address such potentially unauthorized cultivation and to prevent inappropriate import of these plants from overseas at the border, the Japanese government amended the Seed and Seedling Law; the revised Seedling Law came into effect in April 2021 (https://www.maff.go.jp/j/shokusan/syubyouhou/). In order to prevent reverse imports, it is important to develop useful cultivar identification techniques that can be used during customs clearance. If a customs agent finds allegedly infringing goods, both the owner of the variety and the importer must submit evidence within 3 working days after receiving the notification. Therefore, the development of rapid and accurate cultivar identification technology is required. Such technology will help deter reimportation and strengthen the international competitiveness of Japanese agriculture.
Retrotransposons are genetic elements that are transposed by a “copy and paste” mechanism, which involves the reverse transcription of an RNA intermediate and the integration of a cDNA fragment into new genomic loci in the eukaryotic genome (Feschotte et al. 2002, Kumar and Bennetzen 1999, Levin and Moran 2011). Numerous retrotransposon families with high copy numbers exist in plant genomes, and the inserted copies are stably inherited. Therefore, the polymorphisms created by the insertion of retrotransposons have been used to develop molecular markers. Indeed, phylogenetic and genetic diversity analyses have been performed in various plant species using DNA markers derived from retrotransposon insertion polymorphisms (Kalendar et al. 2011, Kumar and Hirochika 2001, Poczai et al. 2013, Schulman et al. 2004).
In addition, an analytical method based on next-generation sequencing (NGS) technology was developed to identify numerous retrotransposon insertion sites and to efficiently detect cultivar-specific insertion sites (Hirata et al. 2020, Monden et al. 2014c). This technique can detect genome-wide insertion sites of a known transposable element (TE) without the need for whole-genome sequence information (Monden et al. 2014c). DNA markers for cultivar identification using retrotransposon insertion polymorphisms are highly cultivar-specific and can clearly distinguish cultivars in many crops, including wheat (Triticum aestivum), sweetpotato, azuki bean (Vigna angularis), common bean (Phaseolus vulgaris), and cultivated strawberry (Fragaria × ananassa) (Hirata et al. 2020, Monden et al. 2014c, Takai and Tahara 2011, Tanaka et al. 2015, Yamane et al. 2012, Yamashita et al. 2008). An active retrotransposon family named Cl8 was recently identified using the method developed by Monden et al. (2014a). Cl8 is an LTR (long terminal repeat) type retrotransposon with many copies in the sweetpotato genome. Cl8 exhibits high levels of insertion polymorphisms among sweetpotato cultivars (Sasai et al. 2019). Therefore, by analyzing the genome-wide insertion sites of Cl8 by high-throughput sequencing, it could be possible to develop a DNA marker that can accurately identify sweetpotato cultivars.
We previously used the chromatographic printed array strip (C-PAS) method to discriminate between strawberry cultivars (Monden et al. 2014b). This method has some important advantages over standard DNA detection methods such as agarose/acrylamide gel electrophoresis, as signals for DNA detection via C-PAS are produced with higher sensitivity in a shorter time frame without the need to prepare or stain a gel. Moreover, this method can be used to visualize signals derived from several independent PCR products of any size simultaneously. C-PAS also allows several independent PCR amplicons of the same size to be precisely distinguished. By contrast, the detection of the signals derived from these amplicons on an agarose gel must be performed with caution regarding size in order to achieve sufficient resolution of these multiplex PCR amplicons; moreover, amplicons of the same size cannot be resolved. Furthermore, the C-PAS method does not require the use of experimental equipment, making it quite valuable not only for laboratory research, but also for on-site inspection of plant cultivars and agricultural products in customs facilities.
In this study, we analyzed the insertion sites of Cl8 to develop a cultivar identification technique for the sweetpotato cultivars ‘Beniharuka’ and ‘Fukumurasaki’. ‘Beniharuka’ is a sticky, good-tasting popular table-use cultivar that has been widely cultivated in Japan in recent years. ‘Beniharuka’ is released in 2007 and comprises a considerable part of sweetpotato export from Japan. Its share accounted for 18.2% of the cultivation area in 2020 (MAFF 2022). ‘Beniharuka’ is derived from a cross between the seed parent ‘Kyushu No. 121’ and the pollen parent ‘Harukogane’ (Kai et al. 2010). ‘Fukumurasaki’ is a purple-fleshed cultivar with a high sugar content and good taste released in 2018, for which efforts are currently being made to expand production areas and promote exports. In fact, ‘Fukumurasaki’ is currently being evaluated for overseas registration. ‘Fukumurasaki’ is derived from a cross between the seed parent ‘Kyukei 255’ and the pollen parent ‘Purple Sweet Lord’ (Kai et al. 2021). Utilizing high-throughput sequencing, we comprehensively identified the insertion sites of the retrotransposon Cl8 and selected insertion sites that can distinguish ‘Beniharuka’ and ‘Fukumurasaki’ from other sweetpotato cultivars. Using the C-PAS method for DNA signal detection, we evaluated sweetpotato cultivars based on multiplex DNA signals derived from the amplicons of the Cl8 retrotransposon. Our method should facilitate the development of a rapid and convenient cultivar discrimination assay for on-site inspection.
Sixty-four sweetpotato cultivars/lines were used to generate a sequencing library (Supplemental Table 1), consisting of major cultivars accounting for approximately 90% of the cultivation area in Japan according to data from the Ministry of Agriculture, Forestry, and Fisheries (MAFF), as well as landraces and genetic resources (MAFF 2022). Genomic DNA was extracted from young leaves of these cultivars and lines using a DNeasy Plant Mini kit (QIAGEN, Hilden, Germany) or ISOSPIN Plant DNA (Nippon Gene Co., Ltd., Tokyo, Japan).
Library construction and sequencingTo comprehensively identify the retrotransposon insertion sites, the flanking regions of Cl8 insertion sites were amplified by PCR, and the resulting products were sequenced on an Illumina platform. An amplicon sequencing library was constructed as described previously (Hirata et al. 2020, Monden et al. 2014c, Sasai et al. 2019). Genomic DNA was fragmented using gTUBE (~6 kb; Covaris Inc., MA, United States), and forked adaptors were ligated to the fragmented DNA. These forked adaptors were prepared by annealing two different oligos (Forked_Type1 and Forked_Com; Supplemental Table 2). Primary PCR amplification was performed with a Cl8-specific (iMET_PBS) and adaptor-specific (AP2-Type1) primer combination, which used the adaptor-ligated DNA as the template (Supplemental Table 2). Nested PCR amplification was carried out using tailed PCR primers (D501–D508 and D701–D708) with primary PCR products serving as the template. The tailed PCR primers contained the P5 or P7 sequence (Illumina) for hybridization on the sequencing flow cell and several barcodes for multiplex sequencing. Thus, the Cl8-specific primers (i.e., D501–D503) consisted of a P5 sequence, a barcode sequence, and the Cl8 end sequence, while the adapter-specific primers (i.e., D701–D712) consisted of a P7 sequence, a barcode sequence, and an adapter sequence. The primer combinations for each sample (64 cultivars) can be found in Supplemental Table 1.
The resulting PCR products were size-selected (400–600 bp) on agarose gels and purified with a QIAquick Gel Extraction Kit (QIAGEN, Hilden, Germany). The purified products were quantified using a Qubit fluorometer (Invitrogen, Carlsbad, CA, United States), and the size selection range was confirmed on an Agilent 2,200 TapeStation system (Agilent, Santa Clara, CA, United States). A MiSeq sequencing library was prepared by pooling equal amounts of purified barcoded products from each cultivar.
Data analysisThe resulting paired-end reads (150 bp) were analyzed as described previously (Hirata et al. 2020, Monden et al. 2014c, Sasai et al. 2019). The resulting reads were analyzed using Maser, a pipeline execution system of the Cell Innovation Program at the National Institute of Genetics, Japan. Adaptor trimming and quality filtering (QV ≥30) were performed using cutadapt (Martin 2011). Filtered reads were trimmed to a specific length that covered most of the sequences. Reads with ≥10 identical sequences were reduced to a single sequence, converted to FASTA format, and clustered using the BLAT self-alignment program (Kent 2002) under the parameter settings “-tileSize” = 8, “-minMatch” = 1, “-minScore” = 10, “-repMatch” = –1, and “-oneOff” = 2. This clustering analysis produced many clusters, each corresponding to a separate Cl8 insertion site. The MiSeq reads used to analyze the Cl8 insertion sites were deposited under accession number DDBJ: DRA015230.
Confirmation of insertion sites by PCRFifty-five sweetpotato cultivars and lines, including the target cultivars ‘Beniharuka’ and ‘Fukumurasaki’ and their parent cultivars/lines, were used to investigate the power of these markers for cultivar discrimination (Table 1). Primers designed to anneal to the retrotransposon sequence (PBS_LTR primer) and insertion site sequences were used to amplify each insertion site (Table 2). The use of these primers was expected to amplify DNA fragments from cultivars harboring retrotransposon insertions. For example, the PBS_LTR and Cl1136 primer pairs were used to amplify the Cl1136 insertion site (Table 2). Similarly, the Pattern2379 insertion site was amplified using the primer combination PBS_LTR and Pattern2379 (Table 2). Each PCR was run in a 10-μL reaction volume containing 5 μL of GoTaq Colorless Master Mix (Promega), 4 pmol of each primer, and 1 μL of genomic DNA (l0 ng/μL). The cycling conditions were as follows: 94°C for 2 min; 30 cycles of 94°C for 15 s, 60°C for 30 s, and 72°C for 30 s; then 72°C for 5 min. The PCR products were visualized by electrophoresis using Shimadzu’s automated electrophoresis apparatus (MultiNA) or 2% (w/v) agarose gel electrophoresis.
| No. | Cultivar name | No. | Cultivar name | No. | Cultivar name |
|---|---|---|---|---|---|
| 1 | Beniharuka | 20 | Annoubeni | 39 | Benihayato |
| 2 | Fukumurasaki | 21 | Daichinoyume | 40 | Joy White |
| 3 | Suzuhokkuri | 22 | Shirosatsuma | 41 | Minamiyutaka |
| 4 | Karayutaka | 23 | Churakoibeni | 42 | Miyanou No. 36 |
| 5 | Murasakihomare | 24 | Tamayutaka | 43 | Kyushu No. 137 |
| 6 | Kyushu No. 121 | 25 | Tamaakane | 44 | Akemurasaki |
| 7 | Harukogane | 26 | Ayamurasaki | 45 | Himeayaka |
| 8 | Kyukei255 | 27 | Annoukogane | 46 | Aikomachi |
| 9 | Purple Sweet Lord | 28 | Beniaka | 47 | Murasakiimo A |
| 10 | Kyukei96013-11 | 29 | Izumi No. 13 | 48 | Konaishin |
| 11 | Benimasari | 30 | Okiyumemurasaki | 49 | Origin Ruby |
| 12 | Kanto No. 123 | 31 | Nourin No. 1 | 50 | Kyushu No. 196 |
| 13 | Beniotome | 32 | Koukei No. 1 | 51 | Churakanasa |
| 14 | Kyukei98160-1 | 33 | Konamizuki | 52 | Silk Sweet |
| 15 | Murasakimasari | 34 | Konahomare | 53 | Nakamurasaki |
| 16 | Koganesengan | 35 | Nourin No. 2 | 54 | Yamagawamurasaki |
| 17 | Beniazuma | 36 | Benikomachi | 55 | Tanegashimamurasaki7 |
| 18 | Koukei No. 14 | 37 | Quick Sweet | ||
| 19 | Shiroyutaka | 38 | Bise |
| Name | Sequences (5ʹ->3ʹ) | Target cultivar(s) | Note |
|---|---|---|---|
| PBS_LTR | GGCTCTGATACCAAATTRAAKCATG | – | Retrotransposon sequence |
| Cl1136 | ACTGATGTCACATAATTCATTGATTGTATG | Beniharuka | Insertion sites for cultivar discrimination |
| Pattern2379 | CGCCCTAGCTTCATTTTAATCCAGT | Beniharuka | |
| Pattern3615 | TGACATTATCTCTTCGGAGGCTTCT | Beniharuka | |
| Pattern4133 | GTTAAAATGTAATAAACACAATAATATGCTAGCCG | Both cultivars | |
| Pattern1680 | GTGATCGAATGAGTAGAGCATGATG | Fukumurasaki | |
| Pattern2626 | GTTAGTAGTTGTAAATTTTTCATAAACCAG | Fukumurasaki | |
| Pattern5354 | GTGACTAGTATAAAGTCATCTTGACACGTG | Fukumurasaki | |
| SS2_F | CTAAAGACAGCTGACCGTGTAGTC | – | Positive control |
| SS2_R | TACTGAGAAACCAACCCATCCTC | – |
Multiplex PCR was used to detect multiple DNA markers in a single PCR. The reaction solution contained 5.0 μL of KOD One PCR Master Mix (TOYOBO, Osaka, Japan), 5.0 ng of DNA, 3.5 pmol of SSII primer mix, 3.0 pmol of Pattern4133 primer mix, 1.5 pmol of Pattern5354 primer mix, and 1.5 pmol of Pattern2379 primer mix. SSII primer mix is a mixture of equal amounts (molar ratio) of SS2_F and SS2_R primers. Pattern4133 primer mix is a mixture of equal amounts (molar ratio) of PBS_LTR and Pattern4133 primers. Pattern5354 primer mix is a mixture of equal amounts (molar ratio) of PBS_LTR and Pattern5354 primers. Pattern2379 primer mix is a mixture of equal amounts (molar ratio) of PBS_LTR and Pattern2379 primers. The cycling conditions were as follows: 98°C for 10 s, followed by 30 cycles of 98°C for 10 s, 62°C for 1 s, and 68°C for 1 s. Primer sequences are listed in Table 2.
Multiplex PCR products were confirmed by the C-PAS method described by Monden et al. (2014b). DNA chromatographic paper, C-PAS4 (TBA, Sendai, Japan), was immersed into a mixture of PCR product and dye-containing developing solution for 15 min. The cultivar was identified based on the signal pattern that appeared on the DNA chromatographic paper.
A total of 28,261,219 paired-end reads of 150 bp in 64 sweetpotato cultivars were obtained by MiSeq sequencing (min: 183,256, average: 441,582, max: 1,406,380 reads per cultivar; Supplemental Table 3). We attempted to identify as many insertion sites as possible by performing clustering of trimmed sequences of three different lengths (50 bp, 70 bp, 100 bp). First, the reads trimmed to 50 bp were analyzed as performed in our previous study. After adaptor removal and QC (≥30) trimming, 28,258,151 reads remained (Table 3). Trimming to 50 bp yielded 28,049,540 reads, filtering sequences based on the QC score (≥30) yielded 19,841,974 reads, and removing reads <50 bp yielded 12,009,368 reads. These reads were used for clustering analysis with the BLAT self-alignment program (Kent 2002), which identified 3,012 independent insertion sites in 64 cultivars. Similarly, trimming to 70 bp yielded 28,049,540 reads, filtering sequences based on the QC score (≥30) yielded 19,131,558 reads, and removing reads <70 bp yielded 8,891,787 reads. After clustering analysis of these reads (70 bp long), 2,971 insertion sites were identified. Using the same method, trimming to 100 bp yielded 28,049,540 reads, filtering sequences based on the QC score (≥30) yielded 18,644,172 reads, and removing reads <100 bp yielded 5,733,080 reads. Clustering analysis of these 100-bp reads produced 2,810 independent insertion sites. An optimal threshold was then set to evaluate the presence or absence of Cl8 insertions: if the number of reads in a given cluster at a specific insertion site comprised <0.01% of the entire reads for that line, Cl8 was considered to be absent from that site. This approach yielded genotyping information for the presence (1) or absence (0) of Cl8 insertions in all 64 cultivars, which was summarized in a cross-tabulation table. Finally, the insertion site information obtained from analyzing reads of different lengths (50 bp, 70 bp, and 100 bp) were summarized.
| Analysis_1 | No. of reads | Ratio (%) | No. of clusters |
|---|---|---|---|
| Raw data | 28,261,219 | 100.00 | |
| Adaptor removal and QV (>=30) trimming | 28,258,151 | 99.99 | |
| Trimming to specific length (50 bp) | 28,049,540 | 99.25 | |
| QV (>=30) filtering | 19,841,974 | 70.21 | |
| Outlier filtering (remove less than 50 bp) | 12,009,368 | 42.49 | |
| BLAT clustering | 3,012 | ||
| Analysis_2 | No. of reads | Ratio (%) | No. of clusters |
| Raw data | 28,261,219 | 100.00 | |
| Adaptor removal and QV (>=30) trimming | 28,258,151 | 99.99 | |
| Trimming to specific length (70 bp) | 28,049,540 | 99.25 | |
| QV (>=30) filtering | 19,131,558 | 67.70 | |
| Outlier filtering (remove less than 70 bp) | 8,891,787 | 31.46 | |
| BLAT clustering | 2,971 | ||
| Analysis_3 | No. of reads | Ratio (%) | No. of clusters |
| Raw data | 28,261,219 | 100.00 | |
| Adaptor removal and QV (>=30) trimming | 28,258,151 | 99.99 | |
| Trimming to specific length (100 bp) | 28,049,540 | 99.25 | |
| QV (>=30) filtering | 18,644,172 | 65.97 | |
| Outlier filtering (remove less than 100 bp) | 5,733,080 | 20.29 | |
| BLAT clustering | 2,810 | ||
We compared the insertion sites of the 64 cultivars and selected suitable insertion sites to discriminate ‘Beniharuka’ and ‘Fukumurasaki’ from among the other cultivars. Among the approximately 3,000 insertion sites identified by the above data analysis, we focused on the putative insertion sites that assumed to be specifically present in the target cultivars and their parental cultivars. For ‘Beniharuka’, the insertion sites assumed to be present in ‘Beniharuka’ and ‘Kyushu No. 121’ or ‘Beniharuka’ and ‘Harukogane’ were selected. Similarly, for ‘Fukumurasaki’, the insertion sites assumed to be present in ‘Fukumurasaki’ and ‘Kyukei 255’ or ‘Fukumurasaki’ and ‘Purple Sweet Lord’ were selected. We designed PCR primers based on the sequences of the selected insertion sites (Supplemental Fig. 1, Table 2, Supplemental Table 4) and investigated DNA markers derived from the selected insertion sites for their ability to identify ‘Beniharuka’ and ‘Fukumurasaki’ from among 55 cultivars (Table 1).
For ‘Beniharuka’, the Cl1136 insertion site was amplified only in ‘Beniharuka’ and its seed parent ‘Harukogane’ (Fig. 1). The Pattern2379 insertion site was also amplified in ‘Beniharuka’, ‘Harukogane’, ‘Beniotome’ and ‘Aikomachi’. Pattern3615 was amplified in ‘Beniharuka’, ‘Kyushu No. 121’, ‘Purple Sweet Load’, and ‘Yamagawamurasaki’. Pattern4133 was amplified in ‘Beniharuka’, ‘Kyushu No. 121’, ‘Fukumurasaki’ and ‘Kyukei255’. Pattern5354, Pattern1680, and Pattern2626 were amplified in ‘Fukumurasaki’ and its parent, ‘Purple Sweet Load’.
Therefore, an unknown cultivar can be identified as ‘Beniharuka’ if two markers, such as either Cl1136 or Pattern2379 (derived from ‘Harukogane’) and either Pattern3615 or Pattern4133 (derived from ‘Kyushu No. 121’), are amplified (Table 4). Similarly, an unknown cultivar can be identified as ‘Fukumurasaki’ if two markers, for example Pattern4133 (derived from ‘Kyukei255’) and either Pattern5354, Pattern1680, or Pattern2626 (derived from ‘Purple Sweet Load’) are amplified (Table 4). Therefore, ‘Beniharuka’ and ‘Fukumurasaki’ could be accurately distinguished from among 55 cultivars using a minimum of two marker sets.
| Name of insertion site | Sweetpotato cultivars* | |||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | 10 | 11 | 12 | 13 | 14 | 15 | 16 | 17 | 18 | 19 | 20 | 21 | 22 | 23 | 24 | 25 | 26 | 27 | 28 | |
| Cl1136 | 1 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| Pattern2379 | 1 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| Pattern3615 | 1 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| Pattern4133 | 1 | 1 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| Pattern1680 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| Pattern2626 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| Pattern5354 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| Name of insertion site | Sweetpotato cultivars* | |||||||||||||||||||||||||||
| 29 | 30 | 31 | 32 | 33 | 34 | 35 | 36 | 37 | 38 | 39 | 40 | 41 | 42 | 43 | 44 | 45 | 46 | 47 | 48 | 49 | 50 | 51 | 52 | 53 | 54 | 55 | ||
| Cl1136 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | |
| Pattern2379 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | |
| Pattern3615 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | |
| Pattern4133 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | |
| Pattern1680 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | |
| Pattern2626 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | |
| Pattern5354 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | |
* Lane numbers correspond to the cultivar numbers listed in Table 1.
The characters (0 and 1) represent absence and presence of the DNA band, respectively.
We used the selected markers to identify ‘Beniharuka’ and ‘Fukumurasaki’ via a multiplex method to detect multiple DNA markers in a single PCR. All the possible marker combinations were tested for identifying ‘Beniharuka’ and ‘Fukumurasaki’ in multiplex PCR. Since Pattern5354 and Pattern2379 markers worked well in multiplex PCR, Pattern5354 was selected over Pattern1680 and Pattern2626, and Pattern2379 was selected over Cl1136 and Pattern3615. In multiplex PCR, the SSII (Soluble starch synthase II) gene were used as a positive control. In addition to those for SSII, PCR primers to amplify the three insertion sites of Pattern4133, Pattern5354, and Pattern2379 were mixed. Based on the method of Monden et al. (2014b), we confirmed the amplified products of multiplex PCR by the C-PAS method. As shown in Fig. 2, multiple signals were detected. The detection sites of the SSII gene and Pattern4133, Pattern5354, and Pattern2379 markers were arranged in order from the top of the chromatographic paper strip. Therefore, bands for ‘Beniharuka’ are expected to be detected at the first, second, and fourth positions from the top of the chromatographic paper. Bands for ‘Fukumurasaki’ are expected to be detected at the first, second, and third positions from the top of the chromatographic paper. As shown in Fig. 2, we detected the first, second, and fourth bands from the top of the chromatographic paper only in ‘Beniharuka’. Likewise, we only observed the first, second, and third bands from the top of the chromatographic paper in ‘Fukumurasaki’ (Fig. 2). Therefore, this method clearly distinguished ‘Beniharuka’ and ‘Fukumurasaki’ from the other sweetpotato cultivars.
C-PAS assay showing the DNA signals for the identification of ‘Beniharuka’ and ‘Fukumurasaki’. Lane numbers correspond to the cultivar numbers listed in Table 1. NC, no DNA control.
In this study, we comprehensively analyzed the insertion sites of the novel Cl8 retrotransposon family in sweetpotato using high-throughput sequencing and developed DNA markers to identify the cultivars ‘Beniharuka’ and ‘Fukumurasaki’. We constructed a sequencing library by amplifying the insertion sites of Cl8 and identified approximately 3,000 insertion sites across 64 sweetpotato cultivars. By performing comparative analysis of the identified insertion sites among cultivars, marker sets that can distinguish ‘Beniharuka’ and ‘Fukumurasaki’ from other cultivars were obtained. These two cultivars could be distinguished from other cultivars using a minimum of two marker sets. We also employed the C-PAS method for rapid cultivar identification, which successfully identified ‘Beniharuka’ and ‘Fukumurasaki’ using a single strip of chromatographic paper. Since this method can detect DNA signals in approximately 15 minutes, we expect that this method could enable quick and reliable cultivar discrimination during inspections at customs facilities.
Although numerous retrotransposon families exist in plant genomes, most retrotransposon families with high copy numbers are currently transpositionally inactive (Feschotte et al. 2002, Kumar and Bennetzen 1999, Lisch 2009, Slotkin and Martienssen 2007). However, a few retrotransposon families with transpositional activity are present in plant genomes, and such families show high insertion polymorphisms among crop cultivars (Monden and Tahara 2015). Moreover, since new insertions should randomly integrate into only one homologous chromosome in a genome, newly inserted copies are thought to exist primarily as simplex alleles in polyploid species (Monden et al. 2015, Monden and Tahara 2015). Therefore, DNA markers based on retrotransposon insertion polymorphisms can be distinguished based on the amplification of a single DNA fragment containing the inserted retrotransposon copy (Monden et al. 2014c). In polyploid crop species with highly heterozygous genomic structures such as sweetpotato and strawberry, co-dominant markers such as single sequence repeat (SSR) markers tend to show multiple unclear DNA bands (unpublished data). However, dominant markers based on the presence or absence of retrotransposon insertion are useful for genotyping, especially in polyploid crop species, due to the production of a single, reproducible, clear DNA band (Hirata et al. 2020, Monden et al. 2014c). Some retrotransposon families show high levels of insertion polymorphisms even among closely related cultivars, pointing to their high utility and effectiveness as cultivar discrimination markers.
When a new copy of the retrotransposon is inserted into the genome, it is extremely unlikely that different insertions will occur by chance at the same chromosomal positions. Once inserted, the integrated copy is genetically inherited. Therefore, cultivars/lines having the same insertion site are considered to be derived from the same ancestral cultivar/line. For example, Patten2379 marker, which is derived from ‘Harukogane’, one of the parents of ‘Beniharuka’, was also amplified in ‘Aikomachi’ (Fig. 1, Table 4). By investigating the genetic relationships of those cultivars/lines, we found that one parent of ‘Aikomachi’ is ‘Kankei107’ which is derived from ‘Harukogane’ (Supplemental Fig. 2). Therefore, it is quite natural that the Patten2379 marker was amplified in ‘Aikomachi’. In addition, Pattern2379 marker was amplified in ‘Beniotome’. Although the direct genetic relationship between ‘Beniotome’ and ‘Harukogane’ was unclear, domestic breeding materials are limited, and most of the domestic cultivars/lines are derived from a limited number of common ancestral lines. Therefore, those insertions might be derived from any of the common ancestral lines. However, it is difficult to clarify the genetic origin and history of all insertion sites because several cultivars/lines have been used as crossing parent multiple times during breeding process, and modern cultivars are genetically related to each other. Hence, the combination of maternal and paternal cultivar-specific markers would be supposed a reasonable cultivar-specific identification.
In this study, we utilized the novel method C-PAS for DNA signal detection of PCR amplicons for cultivar discrimination. We successfully identified the cultivars ‘Beniharuka’ and ‘Fukumurasaki’ based on the multiplex DNA signals derived from amplicons of the Cl8 family and visualized the DNA signals using C-PAS (Fig. 2). This method made it possible to discriminate two cultivars, ‘Beniharuka’ and ‘Fukumurasaki’, using a single C-PAS membrane stick. Since the Pattern4133 insertion site is present in ‘Beniharuka’ and its parent ‘Kyushu No. 121’, and ‘Fukumurasaki’ and its parent ‘Kyukei255’, we discriminated the two cultivars (‘Beniharuka’ and ‘Fukumurasaki’) using a single membrane stick by combining other markers (Pattern5354 and Pattern2379) derived from another parent. In our previous study, we compared the sensitivity of signal detection between C-PAS and agarose gel electrophoresis, which indicated that the minimum amount of the PCR product detectable by agarose gel electrophoresis was 2.5 nM, whereas that detected by C-PAS was 0.25 nM (Monden et al. 2014c). However, it should be noted that DNA extraction with standard kits and amplification of cultivar-specific fragments by PCR are required even when detecting DNA signals with C-PAS method. Our current method takes 3–4 hours from DNA extraction to signal detection. Therefore, system up of the experimental methods by shortening the elapse time for DNA extraction and amplification of cultivar specific fragments is needed in future. Although our method still needs improvement, the ability to detect a DNA signal in about 15 minutes should be an important step towards achieving rapid, efficient and reliable cultivar identification for on-site inspection of plant materials and agricultural products.
In general, it is difficult to identify the genotypes of heat- and pressure-treated processed products in which the genomic DNA has been fragmented or degraded. We previously demonstrated that retrotransposon-based markers were effective for detecting signals from DNA extracted from processed products such as jams, whereas SSR markers were ineffective (Hirata et al. 2020). One advantage of retrotransposon-based markers is that they provide low-molecular-weight PCR products (approximately 100 bp), and the use of small marker fragments is effective for detecting DNA that has been degraded or fragmented during the manufacturing process of heat- and pressure-treated products, such as jams. In addition, retrotransposon-based markers are dominant and do not need to be separated by size via electrophoresis. Therefore, perhaps the retrotransposon-based markers developed in this study could be used for processed products; we plan to evaluate this use in the near future. We expect that retrotransposon-based markers, in combination with the C-PAS method, will facilitate rapid, efficient, and highly reliable cultivar discrimination, even for processed products.
YM, MT, KT designed the study. YM and MK constructed the Cl8 library, performed data analysis and selected the insertion sites for marker development. EH and MT sampled the plant materials and verified the marker polymorphism. TT and KT developed the methods of multiplex PCR and the C-PAS detection. YM wrote the manuscript.
We would like to thank Ai Tokiwa and Masayo Nishidome for their assistance. We are also grateful to Kaneko Seeds Co., Ltd. for providing the cultivar ‘Silk Sweet’ (registration name ‘HE306’) and to Okinawa Prefecture for providing the cultivars ‘Okiyumemurasaki’ and ‘Churakoibeni’. This work was supported by a grant from the Ministry of Agriculture, Forestry, and Fisheries of Japan Commissioned project study on “Development of Cultivar Identification Technology” (Next Generation Breeding & Health Promotion Project) (e-Rad Funding Program Code: J008724).
