Effects of infection of MRSA on the expression and activity of renal cytochrome P450s in mice

Abstract

Methicillin-resistant Staphylococcus aureus (MRSA) leads to serious infections, but it is not known whether it changes the expression of kidney drug metabolizing enzymes during infection. The mice were infected with different doses of MRSA and the oxidative stress and inflammation levels in the kidney were examined. The mRNA expression and activity of cytochrome P450 enzyme was analysed. Mice infected with high levels of MRSA showed a decrease in renal antioxidant capability and an elevated level of oxidative metabolites, which was accompanied by the release of inflammatory cytokines. The levels of interleukin 1β, tumour necrosis factor alpha, and macrophage inflammatory protein-1α were significantly increased along with the levels of nitric oxide and malondialdehyde. On day 7, mRNA expression of Cyp1a2, 2d22, and 3a11 were decreased by the high level of MRSA, but the low level of MRSA increased their expressions. Cyp2e1 mRNA expression was increased by MRSA in the kidney of mice. High dose of MRSA infection increased the oxidative stress and inflammatory response in mouse kidney, leading to the decrease in the expression of renal drug-metabolizing enzymes and no recovery within 7 days.

INTRODUCTION

Methicillin-resistant Staphylococcus aureus (MRSA), a major drug-resistant pathogen, is responsible for a wide variety of infections worldwide ranging from mild skin infections to life-threatening invasive diseases (Taylor, 2013). S. aureus exhibits the ability to adapt to different environments and is a primary cause of infections in both humans and animals (Fluit, 2012; Hasman et al., 2010). Most MRSA strains were initially reported to be hospital-associated MRSA (HA-MRSA). However, community-associated MRSA (CA-MRSA) strains have been increasingly detected since 1990 among groups of patients with no apparent connection to hospitals. Aside from HA-MRSA and CA-MRSA, livestock-associated MRSA (LA-MRSA) is persistent in colonising pigs and calves (Stefani et al., 2012). The emergence and spread of various MRSA types have led to a significant increase in the chance of human exposure, which greatly increases the threat to human beings.

Methicillin-resistant S. aureus is known to cause infections of almost all body parts and these infections are usually accompanied with the release of inflammatory cytokines and oxidative metabolites. MRSA infection was shown to induce interleukin (IL)-6 and IL-8 mRNA expression in human mesenchymal stem cells (Maiti and Jiranek, 2014). In addition, MRSA infection increased the production of IL-2, IL-4, IL-6, IL-10, tumour necrosis factor alpha (TNF-α), and interferon (IFN)-γ in diabetic mice as compared with methicillin-susceptible S. aureus (MSSA) infection. MRSA infection in diabetic mice accelerated the inflammation process (Tsao et al., 2006). Although MRSA and MSSA are S. aureus strains, they have different inflammatory induction capabilities. Inflammation and oxidative stress always occur at the same time during infection (Biswas, 2016). MRSA may induce the accumulation of malondialdehyde (MDA) in mice (Tsao et al., 2003, 2007). Infection and inflammation are the main factors involved in the regulation of drug-metabolising enzymes (Renton, 2001; Morgan, 2009).

The enzymes P450 are microsomal heme-containing mono-oxygenases involved in the metabolism of a variety of endogenous substrates such as steroids, fatty acids, and neurotransmitters as well as many xenobiotics, including most clinically used drugs (Meunier et al., 2004). Aside from their expression in the liver, cytochrome P450 are distributed in almost all tissues and organs and cytochrome P450 subtypes are different in different organs (Preissner et al., 2013). The kidney displays the expression of multiple cytochrome P450 subtypes, which are affected by several factors (Ronis et al., 1998). MRSA infection is usually associated with other diseases, and MRSA-infected patients are often prescribed multiple medications at the same time. The excretion of these drugs occurs through the kidneys, wherein these drugs may interact. Whether MRSA affects the expression of cytochrome P450 in the kidney is questionable.

MATERIALS AND METHODS

Materials

MRSA, American Type Culture Collection 43300. Phenacetin, dextromethorphan, chlorzoxazone, and testosterone came from Shanghai Aladdin Biochemical Technology Co. Ltd., Shanghai, China. Citral produced by Sigma (Sigma-Aldrich Co. LLC, St. Louis, MO, USA). The microsomal incubation system was bought from Wuhan Puleite Biomedical Technology Co. Ltd., Wuhan, China. Reagents for molecular biology were produced by Bio-Rad Laboratories Inc., Hercules, CA, USA. Analytical kits were produced by Nanjing Jiancheng Biology Engineering Institute, China. ProcartaPlex mouse multi factor kits came from eBioscience (Thermo Fisher Scientific Inc., Waltham, MA, USA.

Animals

Male KM mice (SPF grade, 6-week-old, 18-22 g) were supplied by Chengdu Dossy Biological Technology Co. Ltd (Chengdu, China). The animals were housed in SPF test animal room and the environment maintained at 25 ± 2°C and 70 ± 10% relative humidity with a 12 hr light/dark cycle. The mice could get water and food ad libitum. After animals were acclimatised to the environment, then the mice were divided into four groups (n = 10), one control group and four MRSA treated groups.

The mice received one intraperitoneal injection of MRSA at 4 × 10⁶ CFU/kg (high group), 2 × 10⁶ CFU/kg (middle group), and 1 × 10⁶ CFU/kg (low group), control group just injected equal volume of saline. Our previous research shown that the minimum lethal dose (MLD) was 8 × 10⁶ CFU/kg MRSA in mice; hence, the MLD times of 0.5, 0.25, and 0.125 were chosen in this study. The symptoms of animals were recorded. Animal experiments were permitted by the Animal Ethics Review Committee of Chengdu Medical College (No.20170802).

Sample collection

On day 7 of the experiment, mice from all groups were anesthetised using ether following an overnight fast of 8 hr and blood samples collected.

Kidney microsomes were prepared by differential centrifugation (Rasmussen et al., 2011). The kidney was excised, rinsed with 0.9% sodium chloride and homogenised in 0.05 mM Tris/potassium chloride (KCl) buffer (pH 7.4). The homogenate was centrifuged (10,000 × g at 4°C) for 30 min and the supernatant was further centrifuged (105,000 × g at 4°C) for 60 min. Then 0.05 mM Tris/KCl buffer (pH 7.4) was used to reconstitute the microsomes. The protein content in the kidney microsomes was determined by protein assay kit (Shanghai Beyyotime Biological Technology Co. Ltd., Shanghai, China). Kidney microsomes were used to analyse the activity of cytochrome P450 enzymes. A portion of the kidney tissue (0.5 g) was stored in refrigerator and be used for the analysis of oxidative stress and cytokine and mRNA expression.

Oxidative stress

The levels of superoxide dismutase (SOD), nitric oxide (NO), glutathione peroxidase (GSH-Px), and MDA were measured in the kidney of mice according to the manufacturer’s instructions of kits.

Cytokines analyses

The levels of IL-1β, IL-2, TNF-α, and MIP-1α were evaluated according to the manufacturer’s instructions using MAGPIX (Luminex Corporation, Northbrook, IL, USA).

Histology

The histopathological evaluation of the kidney was performed by fixation of the kidney tissue sections in 10% formalin solution for 1 week. The tissues were stained with hematoxylin and eosin for microscopic examination. All observations were made and recorded by using a light microscope with × 5, × 10, × 20, and × 40 objective lenses (OLYMPUS microscope, BX43).

RNA extraction and gene expression in the kidney by real-time polymerase chain reaction (PCR)

Kidney cytochrome P450 gene expression analysis was performed as previously described (Xu et al., 2016). The quality and quantity of mRNA were analysed by UV-Vis spectrophotometer (NanoDrop 2000 UV-Vis spectrophotometer, Thermo Scientific). The gene expression of Cyp1a2, 2d22, 2e1, and 3a11 was evaluated. The gene encoding glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used for data normalisation (Table 1).

Table 1. PCR primers used for gene expression analysis.

Target	Primer sequence (5′ to 3′)	Primer size (bp)
Cyp1a2	CAGGAGCACTACCAAGACTTCA	115
	TGGATCAACCTCTGCACGTT
Cyp2d22	CAGTGTCCAGATGGCAGA	135
	AGGACAGGTTGGTGATGAGG
Cyp2e1	TTCCCTAAGTATCCTCCGTGA	194
	CGTAATCGAAGCGTTTGTTG
Cyp3a11	ACAAACAAGCAGGGATGGAC	150
	GGTAGAGGAGCACCAAGGTG
GAPDH	GATGGAAGGTCGGTGTG	131
	ATGAAGGGGTCGTTGATGG

Activities of Cyp1a2, 2d22, 2e1, and 3a11 enzymes

Cyp1a2, 2d22, 2e1, and 3a11 enzyme activities were analysed as previously reported (Lau et al., 2017; Spaggiari et al., 2014). The microsomal incubations were performed for 60 min at 37°C. The concentration of microsomes was 1 mg/mL protein. NADPH regenerate system consisted with magnesium chloride (MgCl₂, 10 mM), glucose-6-phosphate (10 mM), NADP⁺ (1 mM), and pyruvate dehydrogenase (2 U/mL). Specific probe substrates were added to start the microsomal incubation. The final concentration of the acetonitrile used in the reaction was adjusted to 1% (v/v). The incubation was terminated by adding 500 μL ice-cold acetonitrile to pools, the acetonitrile contains 20 ng/mL tinidazole as an internal standard. The samples were mixed and centrifuged (10,000 g at 4°C for 10 min) to obtain supernatants. 10 μL of supernatant samples was subjected to high-performance liquid chromatography (HPLC) to get the concentrations of four probe substances. The enzyme activities were evaluated based on the concentration reduction of the four probe substrates. The activities of Cyp1a2, 2d22, 2e1, and 3a11 were shown by phenacetin (0.56 µM), dextromethorphan (0.4 µM), chlorzoxazone (0.59 µM), and testosterone (0.69 µM), respectively (Spaggiari et al., 2014). HPLC analyses were performed on Agilent 1260 series instrument at the wavelength of 230 nm. Agilent reversed-phase C18 column (ZORBAX SB-C18, 4.6 × 250 mm, 5 μm) with a C18 guard column was used. The mobile phase consisted with acetonitrile and water (0.01 M acetic acid) in the ratio of 40:60 and the flow rate was 1 mL/min.

Data analysis

Statistical analysis of the data was performed by SPSS 19.0 with one-way analysis of variance comparing the mean values with the control group (p < 0.01 or p < 0.05), and Tukey’s honestly significant difference (HSD) was used in post hoc test. The results are shown as mean ± SD.

RESULTS

Oxidative stress

The effect of MRSA on the oxidative stress is shown in Fig.1. The activities of SOD and GSH-Px were decreased; however, only the SOD activity decreased significantly in the high MRSA treated group. The levels of NO and MDA were increased significantly in a dose-dependent manner.

Fig. 1

Effect of MRSA on SOD, GSH-Px, NO, and MDA levels in kidney of mice. *p < 0.05, **p < 0.01 vs control group.

Cytokines

The effect of MRSA on the cytokine is shown in Fig. 2. The significant increase in levels of IL-1β and MIP-1α was observed in mice infected with MRSA. The level of IL-2 significantly increased in the low and middle groups. TNF-α level significantly decreased in the low and middle groups but increased in the high group of mice.

Fig. 2

Effect of MRSA on kidney IL-1β, MIP-α, IL-2, and TNF-α levels in mice. *p < 0.05, **p < 0.01vs control group.

Histology of the kidney

MRSA-increased changes in histology of the kidneys are shown in Fig. 3. MRSA infection causes dose-dependent renal stenosis (Δ), glomerular enlargement (□), and renal interstitial congestion (○).

Fig. 3

The effect of mRSA infection on renal pathology.

mRNA expression of cytochrome P450

The difference in the expression of the four cytochrome P450 enzymes in the kidney is shown in Fig. 4. MRSA exhibited varying effects on cytochrome P450 mRNA expression at the different infected level. The mRNA expression of Cyp1a2 and 2d22 showed similar changes, the both increased significantly in the low and middle groups but decreased in the high group. Cyp2e1 mRNA expression increased significantly following MRSA infection and showed an inverse relationship with the dose level. MRSA infection significantly decreased the expression of Cyp3a11 mRNA in a dose-dependent manner.

Fig. 4

mRNA expression of CYP450 1a2, 2d22, 2e1, and 3a11 in the kidney. *p < 0.05, **p < 0.01 vs the control group.

Activities of cytochrome P450 subtypes

The activity pattern of cytochrome P450 enzymes was different than that of their mRNAs (Fig. 5). The activity of Cyp1a2 and 2d22 was decreased in middle and high groups. The activity of Cyp2e1 was slightly increased by MRSA. While Cyp3a11 was significantly decreased by MRSA in a dose-dependent manner, which was consistent with its mRNA expression.

Fig. 5

Activity of CYP450 1a2, 2d22, 2e1, and 3a11 in the kidney. *p < 0.05, **p < 0.01 as compared with the control group.

DISCUSSION

The intraperitoneal injection of MRSA in mice is a reliable method to replicate MRSA infection (Cheng et al., 2015; Iizawa et al., 2004). MRSA infection induces severe symptoms, including loss of appetite, constipation, increased eye secretions, weight loss, and trembling. These symptoms usually appear after the second day of injection in mice. The 0.5-times MLD dose caused more serious symptoms that continued till the end of the experiment. Bacterial infection would cause inflammation, which is accompanied by oxidative stress (Crimmins and Finch, 2006; Memon et al., 2000). SOD and GSH-Px are important antioxidant enzymes, which fight against free radicals and reduce oxidised lipids (Goc et al., 2017). The increase in the concentration of NO may be related to the increase in the level of free oxygen radicals, which result in lipid peroxidation. MDA is considered as a good biomarker of oxidative stress (Valado et al., 2007; Souza et al., 2006). Inflammatory cytokines are indicative of inflammation manifestation in response to the occurrence, development, and prognosis of infection (Mantovani, 2000). The decrease in SOD and increase in NO and MDA levels observed with MRSA infection resulted in an increase in the oxidative stress in mice. Studies have confirmed that NO can reduce P450 activity by reducing the expression of P450 (Liaudet et al., 2000), which can explain the phenomenon that NO content in the results is inversely related to the expression and activity of P450 mRNA. MRSA caused severe inflammation, which was accompanied with the release of IL-1β, MIP-1α, and TNF-α.

The infection of S. aureus would induce obvious kidney injury (Salgado-Pabón et al., 2013; Mino et al., 2013); hence, we detected some changes in the level of oxidative stress and inflammation. The kidney is rich in drug-metabolising enzymes and it partly contributes to the drug metabolism (Zhao and Imig, 2003). MRSA-increased damage of the kidney would affect its function of drug excretion (Vilay et al., 2008). We observed that severe inflammation and oxidative stress decreased the mRNA expression and activities of Cyp1a2, 2d22, and 3a11 in the kidney following treatment of mice with high-dose MRSA. The expression of P450 enzyme was increased in the low and middle groups at day 7 after MRSA challenge. In addition, the mRNA expression and activity of Cyp2e1 were increased by MRSA at day 7, which was not observed in the liver enzymes of mice infected with MRSA (Tang et al., 2018). This is due to the fact that P450s in extrahepatic tissues can be regulated differentially by different inflammatory stimuli (Tindberg et al., 1996; Renton and Nicholson, 2000). Different cytochrome P450 enzymes were regulated by different mechanisms (Fradette et al., 2002), which may explain the differences in their expression patterns. The activity of P450 enzymes in the kidneys of mice were different with mRNA expression in low and middle groups. The mRNA expression of Cyp1a2 and 2d22 was increased by low and middle doses of MRSA, but the activities were decreased significantly in mice of the middle group. As far as we know, inflammation and oxidative stress affect cytochrome P450 gene expression at transcriptional and post-transcriptional level by active nuclear receptors, for example PXR and CAR (Hakkola et al., 2016), but the mechanism of post-transcriptional still needs further research. It is well known that cytokines decrease the expression or activity of cytochrome P450 isoforms (Davey, 2002). The decrease of P450 activity and expression in the liver is the result of transcriptional inhibition and protein modification by inflammatory mediators (i.e. IL-1β, TNF-α, IFN-γ) (Harvey and Morgan, 2014). In addition, the toxin produced by Staphylococcus aureus also decreased the expression of cytochrome P450 (Morgan, 1997).

In conclusion, severe infection with MRSA increased oxidative stress and inflammatory responses in mice kidney, leading to the inhibition of the cytochrome P450 enzymes in the kidney.

ACKNOWLEDGMENTS

We thank Min Xu for excellent technical support.

This study was financially supported by grant from the Fund of Department of Science and Technology of Sichuan Province (No. 2016JY0014); the Scientific research and innovation team of Sichuan Province (No.16TD0027); the Scientific Research Fund of Chengdu Medical College (No. CYZ15-02); the Open-Study Funds of State Key Laboratory Breeding Base of Systematic Research, Development and Utilization of Chinese Medicine, Chengdu University of Traditional Chinese Medicine; the Chunhui Plan of Ministry of Education of China (No. Z2016120); the Bidding Project of the Pension and Elderly Health Cooperative Innovation Center of Sichuan province (No. YLZBZ1806).

Conflict of interest

The authors declare that there is no conflict of interest.

REFERENCES

• Biswas, S.K. (2016): Does the Interdependence between Oxidative Stress and Inflammation Explain the Antioxidant Paradox? Oxid. Med. Cell. Longev., 2016, 5698931.
• Cheng, J., Chin, W., Dong, H., Xu, L., Zhong, G., Huang, Y., Li, L., Xu, K., Wu, M., Hedrick, J.L., Yang, Y.Y. and Fan, W. (2015): Biodegradable antimicrobial polycarbonates with in vivo efficacy against multidrug-resistant MRSA systemic infection. Adv. Healthc. Mater., 4, 2128-2136.
• Crimmins, E.M. and Finch, C.E. (2006): Infection, inflammation, height, and longevity. Proc. Natl. Acad. Sci. USA, 103, 498-503.
• Davey, A.K. (2002): Clinical Relevance of Cytokine - Induced Changes in Drug Metabolism. J. Pharm. Pract., 32, 147-152.
• Fluit, A.C. (2012): Livestock-associated Staphylococcus aureus. Clin. Microbiol. Infect., 18, 735-744.
• Fradette, C., Bleau, A.M., Pichette, V., Chauret, N. and Du Souich, P. (2002): Hypoxia-induced down-regulation of CYP1A1/1A2 and up-regulation of CYP3A6 involves serum mediators. Br. J. Pharmacol., 137, 881-891.
• Goc, Z., Szaroma, W., Kapusta, E. and Dziubek, K. (2017): Protective effects of melatonin on the activity of SOD, CAT, GSH-Px and GSH content in organs of mice after administration of SNP. Chin. J. Physiol., 60, 1-10.
• Hakkola, J., Rysä, J. and Hukkanen, J. (2016): Regulation of hepatic energy metabolism by the nuclear receptor PXR. Biochim. Biophys. Acta, 1859, 1072-1082.
• Harvey, R.D. and Morgan, E.T. (2014): In general, CYP expression and activity are impaired in the setting of high concentrations of proinflammatory cytokines. Clin. Pharmacol. Ther., 96, 449-457.
• Hasman, H., Moodley, A., Guardabassi, L., Stegger, M., Skov, R.L. and Aarestrup, F.M. (2010): Spa type distribution in Staphylococcus aureus originating from pigs, cattle and poultry. Vet. Microbiol., 141, 326-331.
• Iizawa, Y., Nagai, J., Ishikawa, T., Hashiguchi, S., Nakao, M., Miyake, A. and Okonogi, K. (2004): In vitro antimicrobial activity of T-91825, a novel anti-MRSA cephalosporin, and in vivo anti-MRSA activity of its prodrug, TAK-599. J. Infect. Chemother., 10, 146-156.
• Lau, P.S., Leong, K.V., Ong, C.E., Dong, A.N. and Pan, Y. (2017): In vitro functional characterisation of cytochrome P450 (CYP) 2C19 allelic variants CYP2C19* 23 and CYP2C19* 24. Biochem. Genet., 55, 48-62.
• Liaudet, L., Soriano, F.G., Szabó, C. and Szabó, C. (2000): Biology of nitric oxide signaling. Crit. Care Med., 28 (Suppl), N37-N52.
• Mantovani, A. (2000): [Inflammatory cytokines]. Recenti Prog. Med., 91, 422-424.
• Maiti, A. and Jiranek, W.A. (2014): Inhibition of Methicillin-resistant Staphylococcus aureus-induced cytokines mRNA production in human bone marrow derived mesenchymal stem cells by 1,25-dihydroxyvitamin D3. BMC Cell Biol., 15, 11.
• Memon, R.A., Staprans, I., Noor, M., Holleran, W.M., Uchida, Y., Moser, A.H., Feingold, K.R. and Grunfeld, C. (2000): Infection and inflammation induce LDL oxidation in vivo. Arterioscler. Thromb. Vasc. Biol., 20, 1536-1542.
• Meunier, B., de Visser, S.P. and Shaik, S. (2004): Mechanism of oxidation reactions catalyzed by cytochrome p450 enzymes. Chem. Rev., 104, 3947-3980.
• Mino, M.J., Ortiz, R.T., Randad, P., Moffatt, L.T., Jordan, M.H. and Shupp, J.W. (2013): Localization of superantigen virulence factors in kidney tissue of animals with Staphylococcus aureus-infected burn wounds. J. Burn Care Res., 34, 142-150.
• Morgan, E.T. (1997): Regulation of cytochromes P450 during inflammation and infection. Drug Metab. Rev., 29, 1129-1188.
• Morgan, E.T. (2009): Impact of infectious and inflammatory disease on cytochrome P450-mediated drug metabolism and pharmacokinetics. Clin. Pharmacol. Ther., 85, 434-438.
• Preissner, S.C., Hoffmann, M.F., Preissner, R., Dunkel, M., Gewiess, A. and Preissner, S. (2013): Polymorphic cytochrome P450 enzymes (CYPs) and their role in personalized therapy. PLoS One, 8, e82562.
• Rasmussen, M.K., Ekstrand, B. and Zamaratskaia, G. (2011): Comparison of cytochrome P450 concentrations and metabolic activities in porcine hepatic microsomes prepared with two different methods. Toxicol. In Vitro, 25, 343-346.
• Renton, K.W. (2001): Alteration of drug biotransformation and elimination during infection and inflammation. Pharmacol. Ther., 92, 147-163.
• Renton, K.W. (2004): Cytochrome P450 regulation and drug biotransformation during inflammation and infection. Curr. Drug Metab., 5, 235-243.
• Renton, K.W. and Nicholson, T.E. (2000): Hepatic and central nervous system cytochrome P450 are down-regulated during lipopolysaccharide-evoked localized inflammation in brain. J. Pharmacol. Exp. Ther., 294, 524-530.
• Ronis, M.J., Huang, J., Longo, V., Tindberg, N., Ingelman-Sundberg, M. and Badger, T.M. (1998): Expression and distribution of cytochrome P450 enzymes in male rat kidney: effects of ethanol, acetone and dietary conditions. Biochem. Pharmacol., 55, 123-129.
• Salgado-Pabón, W., Breshears, L., Spaulding, A.R., Merriman, J.A., Stach, C.S., Horswill, A.R., Peterson, M.L. and Schlievert, P.M. (2013): Superantigens are critical for Staphylococcus aureus Infective endocarditis, sepsis, and acute kidney injury. MBio, 4, e00494-e13.
• Souza, C.F., Fernandes, L. and Cyrino, E.S. (2006): Production of reactive oxygen species during the aerobic and anaerobic exercise. Rev. Bras. Cineantropom. Desempenho Hum., 8, 102-109.
• Spaggiari, D., Geiser, L., Daali, Y. and Rudaz, S. (2014): A cocktail approach for assessing the in vitro activity of human cytochrome P450s: an overview of current methodologies. J. Pharm. Biomed. Anal., 101, 221-237.
• Stefani, S., Chung, D.R., Lindsay, J.A., Friedrich, A.W., Kearns, A.M., Westh, H. and Mackenzie, F.M. (2012): Meticillin-resistant Staphylococcus aureus (MRSA): global epidemiology and harmonisation of typing methods. Int. J. Antimicrob. Agents, 39, 273-282.
• Tang, H., Long, N., Lin, L., Liu, Y., Li, J., Sun, F., Guo, L., Zhang, F. and Dai, M. (2018): Effect of MRSA on CYP450: dynamic changes of cytokines, oxidative stress, and drug-metabolizing enzymes in mice infected with MRSA. Infect. Drug Resist., 11, 229-238.
• Taylor, A.R. (2013): Methicillin-resistant Staphylococcus aureus infections. Prim. Care, 40, 637-654.
• Tindberg, N., Baldwin, H.A., Cross, A.J. and Ingelman-Sundberg, M. (1996): Induction of cytochrome P450 2E1 expression in rat and gerbil astrocytes by inflammatory factors and ischemic injury. Mol. Pharmacol., 50, 1065-1072.
• Tsao, S.M., Hsu, C.C. and Yin, M.C. (2006): Meticillin-resistant Staphylococcus aureus infection in diabetic mice enhanced inflammation and coagulation. J. Med. Microbiol., 55, 379-385.
• Tsao, S.M., Hsu, C.C. and Yin, M.C. (2003): Garlic extract and two diallyl sulphides inhibit methicillin-resistant Staphylococcus aureus infection in BALB/cA mice. J. Antimicrob. Chemother., 52, 974-980.
• Tsao, S.M., Liu, W.H. and Yin, M.C. (2007): Two diallyl sulphides derived from garlic inhibit meticillin-resistant Staphylococcus aureus infection in diabetic mice. J. Med. Microbiol., 56, 803-808.
• Valado, A., Pereira, L., Tavares, C.P. and Ribeiro, C.F. (2007): Effect of the intense anaerobic exercise on nitric oxide and malondialdehyde in studies of oxidative stress. Int. J. Biol. Biomed. Eng., 1, 32-36.
• Vilay, A.M., Churchwell, M.D. and Mueller, B.A. (2008): Clinical review: drug metabolism and nonrenal clearance in acute kidney injury. Crit. Care, 12, 235.
• Xu, S.F., Wu, Q., Zhang, B.B., Li, H., Xu, Y.S., Du, Y.Z., Wei, L.X. and Liu, J. (2016): Comparison of mercury sulfides with mercury chloride and methylmercury on hepatic P450, phase-2 and transporter gene expression in mice. J. Trace Elem. Med. Biol., 37, 37-43.
• Zhao, X. and Imig, J.D. (2003): Kidney CYP450 enzymes: biological actions beyond drug metabolism. Curr. Drug Metab., 4, 73-84.