Dexmedetomidine protects against Ropivacaine-induced neuronal pyroptosis via the Nrf2/HO-1 pathway

Abstract

Dexmedetomidine (DEX) has been demonstrated to protect against ropivacaine (Ropi)-induced neuronal damages. This study was conducted to explore the protective role of DEX in Ropi-induced neuronal pyroptosis and provide a strategy to eliminate Ropi-induced neurotoxicity. The impacts of different concentrations of Ropi and DEX on neurotoxicity in SK-N-SH cells were evaluated by cell counting kit-8 assay and lactic dehydrogenase assay kits. Levels of nuclear factor erythroid 2-related factor 2 (Nrf2), heme oxygenase 1 (HO-1), NLR family pyrin domain containing 3 (NLRP3), cleaved Caspase-1, cleaved N-terminal gasdermin D, interleukin (IL)-1β, and IL-18 were measured by real-time quantitative PCR, Western blotting, and enzyme linked immunosorbent assay. The Nrf2 level after nuclear/cytoplasmic separation was quantified. SK-N-SH cells were treated with si-Nrf2, Nigericin (NLRP3 activator), and Zinc Protoporphyrin (HO-1 inhibitor) to validate the mechanism. Ropi reduced SK-N-SH cell viability in a concentration- and time-dependent manner. DEX treatment alleviated Ropi-induced toxicity and inhibited pyroptosis. Ropi increased the expression levels of Nrf2 and HO-1, and DEX further enhanced the increases and promoted Nrf2 nuclear translocation. Nrf2/HO-1 inhibition or NLRP3 activation both neutralized the inhibitory role of DEX in Ropi-induced pyroptosis of SK-N-SH cells. Overall, DEX promoted the Nrf2/HO-1 pathway to inhibit NLRP3 expression, thus alleviating Ropi-induced neuronal pyroptosis.

INTRODUCTION

Local anesthetics (LAs) are a subtype of anesthetics used to prevent pain by inhibiting transmission of nerve impulses (Wang et al., 2019a). LAs exerts pharmacological properties in peripheral nerve blockade, neuraxial anesthesia, and intravenous infusions (Barletta and Reed, 2019). However, owing to their chemical character, LAs imposes toxicity in various tissues (Sekimoto et al., 2017). Neurotoxicity is the most prominent one regarding the toxic effects of LAs, which leads to neuronal dysfunction and death (Iqbal et al., 2019; Koo et al., 2021). Ropivacaine (Ropi), in the catalog of amino-amide LAs, is used for profound sensory block but less motor block, providing effective surgical anesthesia and postoperative and labor analgesia (Li et al., 2014). Although Ropi is the least toxic LA, repeated or prolonged intrathecal administration of Ropi may induce at least minimal neurotoxicity accompanied by transient neurologic symptoms (Blanie et al., 2017). In this context, it is of urgent demand to find novel drugs that can effectively antagonize Ropi-induced neurotoxicity.

Dexmedetomidine (DEX) is introduced as a selective α-2 adrenoceptor agonist that boasts various effects in clinical settings, such as sedation, analgesia, and respiratory and renal protection (Lee, 2019). Beyond that, DEX confers neuroprotection in brain disorders and reduces neurotoxicity of anesthetics (Burlacu et al., 2022). Due to its role in sedation, analgesia, and neuroprotection, DEX is routinely used as an adjuvant of LAs, increasing the safety and pain alleviation during surgery (Li et al., 2021; Pan et al., 2020). Specifically, DEX has been known to play a protective role in Ropi-induced neuronal injury by reducing apoptosis and enhancing proliferation, migration, and invasion (Xue et al., 2020b). On the other hand, DEX has been known to reduce the neurotoxicity of lidocaine by preventing neuronal pyroptosis (Ding et al., 2021), hinting that pyroptosis is also a prominent mechanism by which DEX reduces neurotoxicity of LAs. However, it is elusive whether DEX can regulate pyroptosis to attenuate Ropi-induced neurotoxicity.

Nuclear factor erythroid 2-related factor 2 (Nrf2) is a critical transcription factor responsible for the regulation of genes related to oxidative stress response and drug detoxification (He et al., 2020). Upon oxidative stress, Nrf2 translocates into the nucleus and activates the transcription of cytoprotective genes, including heme oxygenase-1 (HO-1) (Wan et al., 2019). The NOD-like receptor family pyrin domain containing 3 (NLRP3) inflammasome, comprised of NLRP3, pro-Caspase-1, and apoptosis-associated speck-like protein containing a caspase-recruitment domain (ASC), is a vital factor to activate gasdermin D (GSDMD) and promote the release of mature interleukin (IL)-18 and IL-1β and pyroptosis (Wang et al., 2019c). The Nrf2/HO-1 pathway is well-documented to inhibit the NLRP3 inflammasome to quench pyroptosis (Liu et al., 2021). Ropi promotes nuclear translocation of Nrf2 and activity of HO-1 in a dose-dependent manner and HO-1 silencing suppresses Ropi-induced release of reactive oxygen species and lactate dehydrogenase (LDH), suggesting that Ropi-induced HO-1 is a compensatory survival response (Yan et al., 2018). Dex has been shown to protect against cerebral ischemic injury by activating Nrf2/HO-1 pathway to inhibit NLRP3 inflammasome (Wang et al., 2022). However, whether DEX can regulate Ropi-induced neuronal pyroptosis via the Nrf2/HO-1/NLRP3 inflammasome pathway demands further investigation.

Given the above evidence, we hypothesized that the alleviative role of DEX in Ropi-induced neuronal pyroptosis is associated with the action of the Nrf2/HO-1 pathway. The primary aim of our study is to decipher the molecular mechanism of DEX in Ropi-induced neurotoxicity and provide valuable data on the role of DEX in alleviating neurotoxicity after the use of LAs.

MATERIALS AND METHODS

Cell culture and treatment

Human neuroblastoma cell line SK-N-SH was procured from American Type Culture Collection (ATCC, Manassas, VA, USA) and cultured in a Dulbecco’s modified Eagle medium (DMEM, Gibco, Grand Island, NY, USA) together with 10% fetal bovine serum (FBS), 100 IU/mL penicillin G sodium, and 100 mg/mL streptomycin sulfate in an incubator at 37°C with 5% CO₂. All cells were identified by short tandem repeat. The mycoplasma assay kit (MP0035, St. Louis, MO, USA) was used to confirm that cells were negative for mycoplasma infection.

Dexmedetomidine (DEX, MedChemExpress Co., Ltd., Monmouth Junction, NJ, USA) and ropivacaine (Ropi, MedChemExpress Co., Ltd.) were used in this study. ddH₂O was used to prepare 0.9% normal saline to dilute DEX and Ropi. Then, SK-N-SH cells were treated with Ropi (0 mM, 0.1 mM, 0.5 mM, 1 mM, 2.5 mM, and 5 mM) and DEX (0 μM, 10 μM, 50 μM, 100 μM, and 200 μM) of different concentrations. At 24, 48, and 72 hr, cell viability was measured through cell counting kit-8 (CCK-8) assay. After the use concentration was determined, the subsequent experiments were all performed 48 cells after cell treatment. Cells were stimulated by 20 mM Nigericin (MedChemExpress Co., Ltd.) for 1 hr to activate NLRP3. Nigericin was prepared by adding ddH2O after being dissolved in a small amount of ethanol, with ddH2O containing the same amount of ethanol as the control. Meanwhile, 5 μM Zinc Protoporphyrin (ZnPP, MedChemExpress Co., Ltd.) were used to treat cells for 72 hr to inhibit the expression of HO-1, with dimethylsulfoxide (DMSO) as the control.

Small interfering RNAs targeted inhibiting Nrf2 (si-Nrf2-1 and si-Nrf2-2) and the negative control (si-NC) were provided by GenePharma Co., Ltd. (Shanghai, China). SK-N-SH cells were loaded into 24-well plates and cultured until 70% confluence. Then, 100 nM siRNA was transfected into cells using Lipofectamine 2000 transfection reagent (Invitrogen, Waltham, MA, USA). After 6 hr, the medium was replaced with DMEM/F-12 containing 10% FBS, and cells were cultured in a humidified air at 37°C with 5% CO₂. After 48 hr, cells were collected and the transfection efficiency was determined. After successful transfection, the medium was replaced with DMEM followed by other analyses.

CCK-8 assay

The CCK-8 proliferation assay kit was purchased from Beyotime Biotechnology Company (Haimen, China). SK-N-SH cells of different treatment groups were seeded into 96-well plates at density of 5000 cells/well. At 24, 48, and 72 hr, cells were cultured with the CCK-8 reagent (10 μL/well) at 37°C for 1 hr. The optical density (OD) value at a wavelength of 450 nm was examined using a microplate reader (Dojindo, Kumamoto, Japan).

Cytotoxicity assay

According to the provided instructions (Nanjing Jiancheng Bioengineering Institute, Nanjing, China), cytotoxicity was assessed using assay kits. SK-N-SH cells of different treatment groups were cultured with LDH releasing reagent for 1 hr. Subsequently, cell supernatant was mixed with LDH detection reagent and incubated at room temperature in the dark for 30 min. The LDH concentration was quantified by OD value at a wavelength of 490 nm, with the Blank group as the standard.

Quantitative real-time polymerase chain reaction (qRT-PCR)

The total RNA was extracted from SK-N-SH cells using the TRIzol reagent (Invitrogen). Then, 500 ng of RNA was reverse-transcribed into the complementary DNA using the Primer Script RT reagent (Takara Bio, Inc., Otsu, Japan). The mRNA level was determined using SYBR-Green qRT-PCR (Takara Bio, Inc.). PCR primers are shown in Table 1. With GAPDH as internal reference, the relative gene expression was measured with the help of the 2^-ΔΔCt method (Livak and Schmittgen, 2001).

Table 1. qPCR primers.

Gene	Forward Primer (5’-3’)	Reverse Primer (5’-3’)
Nrf2	ATGGATTTGATTGACATACTT	GTTTCTGACTGGATGTGCTGG
GAPDH	CTCAACTACATGGTTTAC	CCAGGGGTCTTACTCCTT

Western blot assay

The protein sample was extracted from cells of different groups using radioimmunoprecipitation assay lysis buffer (P0013B, Beyotime, Shanghai, China) and the nuclear and cytoplasmic protein extraction assay kit (KGP1000, KeyGEN, Jiangsu, China), and the protein concentration was quantified applying the bicinchoninic acid protein analysis kit. Then, 20 μg of protein sample was separated by sodium dodecyl sulfate polyacrylamide gel electrophoresis and transferred onto nitrocellulose membranes, followed by incubation with specific primary antibodies and secondary antibody of IgG (1:5000, ab6721, Abcam, Cambridge, MA, USA). The Western blots were visualized using the enhanced chemiluminescence determination system, and the protein was quantified using a ChemiDoc XRS+ image analyzer (Bio-Rad, Hercules, CA, USA). β-actin was used as the internal reference of the total protein and cytoplasmic protein, and histone H3 was used as the control of the nuclear protein. The adopted primary antibodies included antibodies against Nrf2 (1:1000, ab62352, Abcam), HO-1 (1:2000, ab52947, Abcam), NLRP3 (1:1000, ab263899, Abcam), cleaved Caspase-1 (1:1000, 4199, Cell Signaling Technology, Danvers, MA, USA), GSDMD N-terminal (GSDMD-N, 1:1000, ab215203, Abcam), β-actin (1:2000, ab8227, Abcam), and histone H3 (1:5000, ab1791, Abcam)

Enzyme-linked immunosorbent assay (ELISA)

Following the producer’s instructions (R&D SYSTEMS, Inc., Minneapolis, MN, USA), levels of IL-1β (DLB50) and IL-18 (DY318-05) in SK-N-SH cells of different treatment groups were measured using ELISA kits. The concentration was expressed as pg/mL.

Statistical analysis

Data analysis was conducted with application of GraphPad Prism 8.0 software (GraphPad Software Inc., San Diego, CA, USA). Measurement data were expressed as mean ± standard deviation (SD). Pairwise comparisons were analyzed using the t test, and multi-group comparisons were analyzed using one-way or two-way analysis of variance (ANOVA), followed by Tukey’s post-hoc test. P < 0.05 indicated differences with statistical significance.

RESULTS

DEX treatment attenuates Ropi-induced neurotoxicity

First, SK-N-SH cells were treated with different concentrations of Ropi, and cell viability was evaluated by CCK-8 assay. The results revealed that Ropi decreased viability of SK-N-SH cells in a concentration- and time-dependent manner (P < 0.05, Fig. 1A). As a result, Ropi of 2.5 mM concentration was selected for the subsequent experiments. Likewise, SK-N-SH cells were treated with different concentrations of DEX. The results showed that SK-N-SH cell viability was augmented in accordance with the increases in DEX concentration and treatment time, but at 200 μM concentration, cell viability was reduced notably (P < 0.05, Fig. 1B). Therefore, DEX of 100 μM concentration was selected for the subsequent experiments.

Fig. 1

DEX treatment attenuates Ropi-induced neurotoxicity. A: Cell viability of SK-N-SH cells treated by different concentrations of Ropi was evaluated by CCK-8 assay; B: Cell viability of SK-N-SH cells treated by different concentrations of DEX was evaluated by CCK-8 assay; C: Cell viability of SK-N-SH cells treated by 100 μM DEX and 2.5 mM Ropi was evaluated by CCK-8 assay; D: Lactate dehydrogenase (LDH) level was determined by the assay kits. Cell experiments were replicated 3 times. Data in panels A–C were analyzed by two-way ANOVA and data in panel D were analyzed by one-way ANOVA, followed by Tukey’s post-hoc test, *P < 0.05.

Next, SK-N-SH cells were treated with a combination of 2.5 mM Ropi and 100 μM DEX. DEX markedly increased Ropi-induced cell viability (P < 0.05, Fig. 1C), and decreased LDH level in cells (P < 0.05, Fig. 1D). The above findings suggested that DEX treatment attenuated Ropi-induced neurotoxicity.

DEX treatment alleviates Ropi-induced neuronal pyroptosis

Local anesthetic toxicity is attributed to neuronal death and activation of inflammatory attack, and pyroptosis can generate plenty of inflammatory factors to enhance inflammatory responses. We determined pyroptosis level of SK-N-SH cells after Ropi induction and found that NLRP3, cleaved Caspase-1, and GSDMD-N levels were increased (P < 0.05, Fig. 2A), and IL-1β and IL-18 levels were elevated in cells as well (P < 0.05, Fig. 2B), whereas DEX treatment decreased levels of NLRP3, cleaved Caspase-1, and GSDMD-N (P < 0.05, Fig. 2A) and IL-1β and IL-18 levels (P < 0.05, Fig. 2B). The above findings suggested that DEX treatment alleviated Ropi-induced neuronal pyroptosis.

Fig. 2

DEX treatment alleviates Ropi-induced neuronal pyroptosis. A: NLRP3, cleaved Caspase-1, and GSDMD-N levels were determined by Western blot assay; B: IL-1β and IL-18 levels were determined by ELISA. Cell experiments were replicated 3 times. Data in panels A-B were analyzed by two-way ANOVA, followed by Tukey’s post-hoc test, *P < 0.05.

DEX promotes Ropi-induced Nrf2 nuclear translocation and HO-1 expression

It has been reported that DEX can activate the Nrf2/HO-1 pathway to inhibit NLRP3, thus protecting against cerebral ischemic injury (Wang et al., 2022). We conjectured that the role of DEX in Ropi-induced neuronal pyroptosis is also associated with the Nrf2/HO-1 pathway. We determined the expression patterns of Nrf2 and HO-1 before and after DEX treatment and found that Ropi treatment increased the expression levels of Nrf2 and HO-1, while DEX treatment further elevated the expression levels of Nrf2 and HO-1 (P < 0.05, Fig. 3A). Besides, DEX treatment promoted nuclear translocation of Nrf2 and the nuclear expression of Nrf2 (P < 0.05, Fig. 3B). The above findings suggested that DEX promoted Ropi-induced Nrf2 nuclear translocation and HO-1 expression.

Fig. 3

DEX promotes Ropi-induced Nrf2 nuclear translocation and HO-1 expression. A: Nrf2 and HO-1 expression levels in SK-N-SH cells were determined by Western blot assay; B: After nuclear and cytoplasmic separation, Nrf2 expression levels were determined by Western blot assay, with Histone H3 as the internal reference of nuclear protein and β-actin as the internal reference of cytoplasmic protein. Cell experiments were replicated 3 times. Data in panels A–B were analyzed by two-way ANOVA, followed by Tukey’s post-hoc test, *P < 0.05.

Nrf2 inhibition partly reverses the inhibitory role of DEX in Ropi-induced neuronal pyroptosis

To validate the above mechanism, SK-N-SH cells were transfected with two siRNAs targeted inhibiting Nrf2 (si-Nrf2-1, and si-Nrf2-2) to downregulate Nrf2 expression (P < 0.05, Fig. 4A). si-Nrf2-1 was found to have the best knockdown efficiency and as a result selected for combined treatment with DEX. si-Nrf2-1 decreased the expression levels of Nrf2 and HO-1 after DEX treatment (P < 0.05, Fig. 4B), lowered the nuclear expression of Nrf2 (P < 0.05, Fig. 4C), intensified pyroptosis of SK-N-SH cells (P < 0.05, Fig. 4B, D), and increased LDH level (P < 0.05, Fig. 4E). Above all, Nrf2 inhibition partly reversed the inhibitory role of DEX in Ropi-induced neuronal pyroptosis.

Fig. 4

Nrf2 inhibition partly reverses the inhibitory role of DEX in Ropi-induced neuronal pyroptosis. SK-N-SH cells were transfected with si-Nrf2-1 and si-Nrf2-2, with si-NC as the control. A: Transfection efficiency of Nrf2 siRNAs was determined by qRT-PCR, and si-Nrf2-1 with the best knockdown effectiveness was selected for combined treatment with DEX; B: Levels of Nrf2, HO-1, NLRP3, cleaved Caspase-1, and GSDMD-N were determined by Western blot assay; C: After nuclear and cytoplasmic separation, Nrf2 expression levels were determined by Western blot assay, with Histone H3 as the internal reference of nuclear protein and β-actin as the internal reference of cytoplasmic protein; D Levels of IL-1β and IL-18 were determined by ELISA; E: Lactate dehydrogenase (LDH) level was determined by the assay kits. Cell experiments were replicated 3 times. Data in panels A and E were analyzed by one-way ANOVA, and data in panels B, C, and D were analyzed by two-way ANOVA, followed by Tukey’s post-hoc test, *P < 0.05.

HO-1 inhibition partly reverses the inhibitory role of DEX in Ropi-induced neuronal pyroptosis

We added the HO-1 inhibitor ZnPP into the culture medium and combined it with DEX treatment. Our results showed that ZnPP treatment elevated pyroptosis (P < 0.05, Fig. 5A-B) and increased LDH levels (P < 0.05, Fig. 5C). The above findings suggested that DEX promoted Ropi-induced Nrf2/HO-1 signaling to mitigate neuronal pyroptosis.

Fig. 5

NLRP3 activation partly reverses the inhibitory role of DEX in Ropi-induced neuronal pyroptosis. SK-N-SH cells were treated with 5 μM ZnPP for 72 hr and combined with DEX, with DMSO as the control. A: Levels of HO-1, NLRP3, cleaved Caspase-1, and GSDMD-N were determined by Western blot assay; B: Levels of IL-1β and IL-18 were determined by ELISA; C: Lactate dehydrogenase (LDH) level was determined by the assay kits. Cell experiments were replicated 3 times. Data in panel C were analyzed by one-way ANOVA, and data in panels A and B were analyzed by two-way ANOVA, followed by Tukey’s post-hoc test, *P < 0.05.

NLRP3 activation partly reverses the inhibitory role of DEX in Ropi-induced neuronal pyroptosis

At last, SK-N-SH cells were treated with a combination of NLRP3 activator Nigericin and DEX. After Nigericin treatment, pyroptosis of SK-N-SH cells was enhanced (P < 0.05, Fig. 6A–B), and LDH level was increased (P < 0.05, Fig. 6C). The above findings suggested that DEX promoted Ropi-induced Nrf2/HO-1 signaling and inhibited NLRP3 expression, thus mitigating neuronal pyroptosis.

Fig. 6

NLRP3 activation partly reverses the inhibitory role of DEX in Ropi-induced neuronal pyroptosis. SK-N-SH cells was stimulated by 20 mM Nigericin for 1 hr to activate NLRP3 and combined with DEX treatment. Nigericin was prepared by adding ddH2O after being dissolved in a small amount of ethanol, with ddH2O containing the same amount of ethanol as the control. A: Levels of NLRP3, cleaved Caspase-1, and GSDMD-N were determined by Western blot assay; B: Levels of IL-1β and IL-18 were determined by ELISA; C: Lactate dehydrogenase (LDH) level was determined by the assay kits. Cell experiments were replicated 3 times. Data in panels A and B were analyzed by two-way ANOVA, and data in panel C were analyzed by one-way ANOVA, followed by Tukey’s post-hoc test, *P < 0.05.

DISCUSSION

Ropivacaine (Ropi), a kind of amino-amide LAs, is widely used for anesthesia during surgery and postoperative pain control (Li et al., 2014). However, Ropi overdose can induce neurotoxicity, which remains a challenge to be overcome in clinical settings (Chen et al., 2019; Wen et al., 2018). Dexmedetomidine (DEX), a type of α-2 adrenoceptor agonist, can act as a neuroprotectant agent for anesthetic neurotoxicity (Andropoulos, 2018). Up to now, the mechanism by which Dex alleviates Ropi-induced neurotoxicity remains unclear. In the current study, our findings uncovered that DEX suppresses Ropi-induced neuronal pyroptosis via the Nrf2/HO-1/NLRP3 pathway.

As an anesthetic adjuvant, DEX is an optimal choice to prolong duration of anesthesia by Ropi and reduce the incidence of side effects, such as shivering (Zhao et al., 2021). In addition, DEX can act as a neuroprotectant to alleviate Ropi-induced damages to neurons (Xue et al., 2020a, 2020b). Generally, previous studies have unveiled that Ropi-induced neurotoxicity is associated with neuron death, oxidative stress, mitochondrial dysfunction, and LDH production (Chen et al., 2019; Wang et al., 2019b). In this study, our experiments showed that Ropi reduced SK-N-SH cell viability in a concentration- and time-dependent manner and increased LDH level, whereas DEX improved SK-N-SH cell viability in a concentration- and time-dependent manner and the safe concentration range of DEX for SK-N-SH cells was 0–100 μM. Besides, the combination of 2.5 mM Ropi and 100 μM DEX effectively increased cell viability and LDH level. Consistently, DEX is able to inhibit hippocampal neuron apoptosis in the context of Alzheimer’s disease (Sun et al., 2020), and DEX activates the brain derived neurotrophic factor signaling to protect neurons against kainic acid-induced excitotoxicity (Chiu et al., 2019). Collectively, our data supported that DEX treatment alleviates Ropi-induced neurotoxicity by increasing cell viability and decreasing LDH release.

Pyroptosis is a unique type of inflammatory cell death that is provoked by NLRP3 inflammasome assembly and activation, Caspase-1 cleavage, and GSDMD-N activation (Yu et al., 2021). Meanwhile, pyroptosis can promote the secretion of pro-inflammatory cytokines, such as IL-1β, and IL-18, to elevate cell inflammation (He et al., 2016). Accumulating evidence has unveiled the association between neurotoxicity and anesthesia-induced neuronal pyroptosis (Dai et al., 2021; Sun et al., 2019). For instance, pyroptosis is a core mechanism underlying isoflurane-induced neuronal damage (Fan et al., 2018). As indicated by our results, DEX decreased the levels of NLRP3, cleaved Caspase-1, GSDMD-N, IL-1β, and IL-18 in SK-N-SH cells. In agreement with our results, DEX inhibits lipopolysaccharide (LPS)-induced release of nuclear factor-kappaB and pro-inflammatory factors from BV2 microglia, thus ameliorating neuroinflammation (Bao et al., 2019), and DEX pretreatment ameliorates GSDMD-induced microglia pyroptosis via the PI3K/AKT/GSK3β pathway in subarachnoid hemorrhage (Wei et al., 2022). Altogether, our findings initially demonstrated that DEX attenuates Ropi-induced neuronal pyroptosis to alleviate neurotoxicity.

The Nrf2/HO-1 pathway is a vital neuroprotective pathway (Wang et al., 2021). Activation of the Nrf2/HO-1 pathway is effective to protect against oxidative stress-mediated neuronal apoptosis, neuroinflammation, and cognitive impairment (Huang et al., 2018; Wan et al., 2019). The Nrf2/HO-1 pathway induced by Ropi is a compensatory survival response to alleviate Ropi-induced neurotoxicity (Yan et al., 2018). DEX can activate the Nrf2/HO-1 pathway to inhibit NLRP3 inflammasome in cerebral ischemic/reperfusion injury (Wang et al., 2022), hinting that the Nrf2/HO-1 pathway may be a possible mechanism by which DEX attenuates neuronal pyroptosis. In this study, both Ropi and DEX increased the expression levels of Nrf2 and HO-1, and DEX promoted nuclear translocation of Nrf2. Thereafter, we downregulated Nrf2 expression SK-N-SH cells and observed that nuclear Nrf2 expression levels were reduced while pyroptosis and LDH level were enhanced in response to Nrf2 downregulation. Likewise, NLRP3 activation also averted the inhibition of neuronal pyroptosis and neurotoxicity caused by DEX. Nrf2 activation has been demonstrated to suppress NLRP3 inflammasome-mediated pyroptosis in lipopolysaccharide-induced acute lung injury (Liu et al., 2021). Besides, the Nrf2/HO-1 pathway has been shown to inhibit oxidative stress-induced pyroptosis in renal ischemia/reperfusion injury (Diao et al., 2019). Overall, our findings and shreds of evidence make it plausible that DEX promoted Ropi-induced Nrf2/HO-1 signaling to inhibit NLRP3 expression, thus attenuating neuronal pyroptosis.

In summary, our study for the first time uncovered that DEX alleviated Ropi-induced neuronal pyroptosis by activating the Nrf2/HO-1 pathway and inhibiting NLRP3. Our findings strengthen the existing pharmacological profile of DEX and provide a possible strategy for the remission of neurotoxicity after the use of Ropi. However, our study is limited to the cellular level and lacks validation through animal experiments. Besides, our study did not consider the protective role of the Nrf2/HO-1 pathway against oxidative stress but just validated whether it can inhibit NLRP3 expression. Moreover, our study analyzed the role of DEX in neurons under the condition of Ropi treatment and did not confirm whether DEX itself activates the Nrf2/HO-1 pathway. In the future, more studies are essential to validate our conclusion through animal experiments and explore how our conclusions can be transformed into clinical practice and analyze the regulatory role of DEX in the Nrf2/HO-1 pathway in SK-N-SH cells.

Conflict of interest

The authors declare that there is no conflict of interest.

REFERENCES

•  Andropoulos,  D.B. (2018): Effect of Anesthesia on the Developing Brain: infant and Fetus. Fetal Diagn. Ther., 43, 1-11.
•  Bao,  Y.,  Zhu,  Y.,  He,  G.,  Ni,  H.,  Liu,  C.,  Ma,  L.,  Zhang,  L. and  Shi,  D. (2019): Dexmedetomidine Attenuates Neuroinflammation In LPS-Stimulated BV2 Microglia Cells Through Upregulation Of miR-340. Drug Des. Devel. Ther., 13, 3465-3475.
•  Barletta,  M. and  Reed,  R. (2019): Local Anesthetics: Pharmacology and Special Preparations. Vet. Clin. North Am. Small Anim. Pract., 49, 1109-1125.
•  Blanie,  A.,  Figueiredo,  S.,  Lorre,  G. and  Benhamou,  D. (2017): Transient neurologic symptoms (TNS) after intrathecal injection of ropivacaine through a dural tap during an attempted epidural for labour pain relief. Anaesth. Crit. Care Pain Med., 36, 325-326.
•  Burlacu,  C.C.,  Neag,  M.A.,  Mitre,  A.O.,  Sirbu,  A.C.,  Badulescu,  A.V. and  Buzoianu,  A.D. (2022): The Role of miRNAs in Dexmedetomidine’s Neuroprotective Effects against Brain Disorders. Int. J. Mol. Sci., 23, 5452.
•  Chen,  Y.,  Yan,  L.,  Zhang,  Y. and  Yang,  X. (2019): the role of DRP1 in ropivacaine-induced mitochondrial dysfunction and neurotoxicity. Artif. Cells Nanomed. Biotechnol., 47, 1788-1796.
•  Chiu,  K.M.,  Lin,  T.Y.,  Lee,  M.Y.,  Lu,  C.W.,  Wang,  M.J. and  Wang,  S.J. (2019): Dexmedetomidine protects neurons from kainic acid-induced excitotoxicity by activating BDNF signaling. Neurochem. Int., 129, 104493.
•  Dai,  J.,  Li,  X.,  Wang,  C.,  Gu,  S.,  Dai,  L.,  Zhang,  J.,  Fan,  Y. and  Wu,  J. (2021): Repeated neonatal sevoflurane induced neurocognitive impairment through NF-κB-mediated pyroptosis. J. Neuroinflammation, 18, 180.
•  Diao,  C.,  Chen,  Z.,  Qiu,  T.,  Liu,  H.,  Yang,  Y.,  Liu,  X.,  Wu,  J. and  Wang,  L. (2019): Inhibition of PRMT5 Attenuates Oxidative Stress-Induced Pyroptosis via Activation of the Nrf2/HO-1 Signal Pathway in a Mouse Model of Renal Ischemia-Reperfusion Injury. Oxid. Med. Cell. Longev., 2019, 2345658.
•  Ding,  X.D.,  Cao,  Y.Y.,  Li,  L. and  Zhao,  G.Y. (2021): Dexmedetomidine Reduces the Lidocaine-Induced Neurotoxicity by Inhibiting Inflammasome Activation and Reducing Pyroptosis in Rats. Biol. Pharm. Bull., 44, 902-909.
•  Fan,  Y.,  Du,  L.,  Fu,  Q.,  Zhou,  Z.,  Zhang,  J.,  Li,  G. and  Wu,  J. (2018): Inhibiting the NLRP3 Inflammasome With MCC950 Ameliorates Isoflurane-Induced Pyroptosis and Cognitive Impairment in Aged Mice. Front. Cell. Neurosci., 12, 426.
•  He,  F.,  Ru,  X. and  Wen,  T. (2020): NRF2, a Transcription Factor for Stress Response and Beyond. Int. J. Mol. Sci., 21, 4777.
•  He,  Y.,  Hara,  H. and  Núñez,  G. (2016): Mechanism and Regulation of NLRP3 Inflammasome Activation. Trends Biochem. Sci., 41, 1012-1021.
•  Huang,  B.,  He,  D.,  Chen,  G.,  Ran,  X.,  Guo,  W.,  Kan,  X.,  Wang,  W.,  Liu,  D.,  Fu,  S. and  Liu,  J. (2018): α-Cyperone inhibits LPS-induced inflammation in BV-2 cells through activation of Akt/Nrf2/HO-1 and suppression of the NF-κB pathway. Food Funct., 9, 2735-2743.
•  Iqbal,  F.,  Thompson,  A.J.,  Riaz,  S.,  Pehar,  M.,  Rice,  T. and  Syed,  N.I. (2019): Anesthetics: from modes of action to unconsciousness and neurotoxicity. J. Neurophysiol., 122, 760-787.
•  Koo,  C.H.,  Baik,  J.,  Shin,  H.J.,  Kim,  J.H.,  Ryu,  J.H. and  Han,  S.H. (2021): Neurotoxic Effects of Local Anesthetics on Developing Motor Neurons in a Rat Model. J. Clin. Med., 10, 901.
•  Lee,  S. (2019): Dexmedetomidine: present and future directions. Korean J. Anesthesiol., 72, 323-330.
•  Li,  M.,  Wan,  L.,  Mei,  W. and  Tian,  Y. (2014): Update on the clinical utility and practical use of ropivacaine in Chinese patients. Drug Des. Devel. Ther., 8, 1269-1276.
•  Li,  N.,  Hu,  L.,  Li,  C.,  Pan,  X. and  Tang,  Y. (2021): Effect of Epidural Dexmedetomidine as an Adjuvant to Local Anesthetics for Labor Analgesia: A Meta-Analysis of Randomized Controlled Trials. Evid. Based Complement. Alternat. Med., 2021, 4886970.
•  Liu,  Y.,  Zhou,  J.,  Luo,  Y.,  Li,  J.,  Shang,  L.,  Zhou,  F. and  Yang,  S. (2021): Honokiol alleviates LPS-induced acute lung injury by inhibiting NLRP3 inflammasome-mediated pyroptosis via Nrf2 activation in vitro and in vivo. Chin. Med., 16, 127.
•  Livak,  K.J. and  Schmittgen,  T.D. (2001): Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)). Method. Methods, 25, 402-408.
•  Pan,  L.,  Wu,  H.,  Liu,  H.,  Yang,  X.,  Meng,  Z. and  Cao,  Y. (2020): Dexmedetomidine as an adjunct to local anesthetics in nerve block relieved pain more effectively after TKA: a meta-analysis of randomized controlled trials. J. Orthop. Surg. Res., 15, 577.
•  Sekimoto,  K.,  Tobe,  M. and  Saito,  S. (2017): Local anesthetic toxicity: acute and chronic management. Acute Med. Surg., 4, 152-160.
•  Sun,  L.,  Ma,  W.,  Gao,  W.,  Xing,  Y.,  Chen,  L.,  Xia,  Z.,  Zhang,  Z. and  Dai,  Z. (2019): Propofol directly induces caspase-1-dependent macrophage pyroptosis through the NLRP3-ASC inflammasome. Cell Death Dis., 10, 542.
•  Sun,  W.,  Zhao,  J. and  Li,  C. (2020): Dexmedetomidine Provides Protection Against Hippocampal Neuron Apoptosis and Cognitive Impairment in Mice with Alzheimer’s Disease by Mediating the miR-129/YAP1/JAG1 Axis. Mol. Neurobiol., 57, 5044-5055.
•  Wan,  T.,  Wang,  Z.,  Luo,  Y.,  Zhang,  Y.,  He,  W.,  Mei,  Y.,  Xue,  J.,  Li,  M.,  Pan,  H.,  Li,  W.,  Wang,  Q. and  Huang,  Y. (2019): FA-97, a New Synthetic Caffeic Acid Phenethyl Ester Derivative, Protects against Oxidative Stress-Mediated Neuronal Cell Apoptosis and Scopolamine-Induced Cognitive Impairment by Activating Nrf2/HO-1 Signaling. Oxid. Med. Cell. Longev., 2019, 8239642.
•  Wang,  B.,  Wang,  S.,  Zhang,  Q.,  Deng,  Y.,  Li,  X.,  Peng,  L.,  Zuo,  X.,  Piao,  M.,  Kuang,  X.,  Sheng,  S. and  Yu,  Y. (2019a): Recent advances in polymer-based drug delivery systems for local anesthetics. Acta Biomater., 96, 55-67.
•  Wang,  N.,  Nie,  H.,  Zhang,  Y.,  Han,  H.,  Wang,  S.,  Liu,  W. and  Tian,  K. (2022): Dexmedetomidine exerts cerebral protective effects against cerebral ischemic injury by promoting the polarization of M2 microglia via the Nrf2/HO-1/NLRP3 pathway. Inflamm. Res., 71, 93-106.
•  Wang,  S.,  Lin,  Q.,  Wang,  Z. and  Pan,  X. (2019b): Ropivacaine induces neurotoxicity by activating MAPK/p38 signal to upregulate Fas expression in neurogliocyte. Neurosci. Lett., 706, 7-11.
•  Wang,  S.,  Yuan,  Y.H.,  Chen,  N.H. and  Wang,  H.B. (2019c): The mechanisms of NLRP3 inflammasome/pyroptosis activation and their role in Parkinson’s disease. Int. Immunopharmacol., 67, 458-464.
•  Wang,  Y.,  Gao,  L.,  Chen,  J.,  Li,  Q.,  Huo,  L.,  Wang,  Y.,  Wang,  H. and  Du,  J. (2021): Pharmacological Modulation of Nrf2/HO-1 Signaling Pathway as a Therapeutic Target of Parkinson’s Disease. Front. Pharmacol., 12, 757161.
•  Wei,  B.,  Liu,  W.,  Jin,  L.,  Guo,  S.,  Fan,  H.,  Jin,  F.,  Wei,  C.,  Fang,  D.,  Zhang,  X.,  Su,  S.,  Duan,  C. and  Li,  X. (2022): Dexmedetomidine Inhibits Gasdermin D-Induced Pyroptosis via the PI3K/AKT/GSK3β Pathway to Attenuate Neuroinflammation in Early Brain Injury After Subarachnoid Hemorrhage in Rats. Front. Cell. Neurosci., 16, 899484.
•  Wen,  X.,  Liang,  H.,  Li,  H.,  Ou,  W.,  Wang,  H.B.,  Liu,  H. and  Li,  S. (2018): In vitro neurotoxicity by ropivacaine is reduced by silencing Cav3.3 T-type calcium subunits in neonatal rat sensory neurons. Artif. Cells Nanomed. Biotechnol., 46, 1617-1624.
•  Xue,  X.,  Fan,  J.,  Ma,  X.,  Liu,  Y.,  Han,  X.,  Leng,  Y. and  Yu,  J. (2020a): Effects of local dexmedetomidine administration on the neurotoxicity of ropivacaine for sciatic nerve block in rats. Mol. Med. Rep., 22, 4360-4366.
•  Xue,  Y.,  Xu,  T. and  Jiang,  W. (2020b): Dexmedetomidine protects PC12 cells from ropivacaine injury through miR-381/LRRC4 /SDF-1/CXCR4 signaling pathway. Regen. Ther., 14, 322-329.
•  Yan,  X.,  Li,  Y.,  Han,  X.,  Dong,  X.,  Zhang,  Y. and  Xing,  Q. (2018): Ropivacaine regulates the expression and function of heme oxygenase-1. Biomed. Pharmacother., 103, 284-289.
•  Yu,  P.,  Zhang,  X.,  Liu,  N.,  Tang,  L.,  Peng,  C. and  Chen,  X. (2021): Pyroptosis: mechanisms and diseases. Signal Transduct. Target. Ther., 6, 128.
•  Zhao,  J.,  Liao,  C.,  Wu,  Q.,  Wang,  L.,  Deng,  F. and  Zhang,  W. (2021): Evaluation of ropivacaine combined with dexmedetomidine versus ropivacaine alone for epidural anesthesia: A meta-analysis. Medicine (Baltimore), 100, e25272.