The Journal of Toxicological Sciences
Online ISSN : 1880-3989
Print ISSN : 0388-1350
ISSN-L : 0388-1350
Original Article
Nafamostat mesylate sensitizes ovarian cancer cells to carboplatin by promoting the ZNF24-mediated inhibition of WNT2B
Jiehuan XuJianlin ChenDao WangYaojun LiPing LianXiaozhu WuRong Yan
Author information
JOURNAL FREE ACCESS FULL-TEXT HTML

2024 Volume 49 Issue 11 Pages 467-479

Details
Abstract

Resistance to chemotherapeutic medicines complicates and eventually kills people with ovarian cancer. Nafamostat mesylate (NM) has been used as an adjuvant therapy to enhance chemotherapy sensitivity in several cancers. This study aimed to evaluate the effect of NM on ovarian cancer cells susceptible to carboplatin (CBP) and to determine the underlying mechanism involved. Herein, qRT-PCR, western blot, and IHC were used to analyze mRNA and protein expression. Cell viability and proliferation were measured using the MTT and colony formation assays. Cell migration and invasion were examined using the Transwell assay. Flow cytometry was employed to detect cell apoptosis. The interaction between zinc finger protein 24 (ZNF24) and wingless-type MMTV integration site family member 2b (WNT2B) was validated via the dual-luciferase reporter and Chromatin immunoprecipitation assays. A xenograft nude mouse model was used to assess the effect of NM on CBP sensitivity in vivo. Our results showed that NM intervention inhibited the viability, proliferation, migration, and invasion and facilitated the apoptosis of CBP-resistant ovarian cancer cells. Furthermore, NM sensitized ovarian cancer cells to CBP by upregulating ZNF24. ZNF24 inactivated Wnt/β-catenin signaling by inhibiting the transcription of WNT2B. Additionally, NM enhanced the inhibitory effect of CBP on tumor growth in vivo. Taken together, NM enhanced the CBP sensitivity of ovarian cancer cells by promoting the ZNF24-mediated inactivation of the WNT2B/Wnt/β-catenin axis. These findings suggest a viable treatment approach for improving CBP resistance in ovarian cancer.

INTRODUCTION

Ovarian cancer frequently affects perimenopausal women and is the world’s second leading cause of death from gynecological cancer (Friedrich et al., 2021). Around 230,000 women are likely to be diagnosed with ovarian cancer and 150,000 are expected to die each year (Lalremmawia and Tiwary, 2019). Patients with ovarian cancer lack typical symptoms and are difficult to diagnose in the early stages of the disease. Therefore, the investigation of novel drugs is required to increase the survival of these patients. Platinum chemotherapy, represented by carboplatin (CBP), is currently the standard treatment method for ovarian cancer and is effective at the beginning of the treatment. However, as treatment continues, most ovarian cancer patients develop resistance to chemotherapy (Marchetti et al., 2010). Therefore, the identification of innovative methods to improve CBP resistance in ovarian cancer and increase the survival rates of patients is vital.

Nafamostat mesylate (NM) is a strong broad-spectrum serine protease inhibitor commonly used to treat pancreatitis, hemorrhagic shock, and disseminated intravascular coagulation (Park et al., 2020; Kamijo et al., 2020). NM exhibits antitumor activities in some cancers, such as colorectal and pancreatic cancer (Lu et al., 2016; Uwagawa et al., 2021). Notably, NM treatment can enhance the sensitivity of cancer cells to platinum. Lu et al. demonstrated that NM treatment could sensitize colorectal cancer cells to oxaliplatin (Lu et al., 2016). In addition, clinical investigations have shown that gemcitabine, in conjunction with NM, is effective as an adjuvant treatment for pancreatic cancer patients (Uwagawa et al., 2021). These studies suggest that NM elevates the chemotherapy sensitivity of cancer cells and plays an antitumor role in cancer development. However, the role of NM in regulating CBP resistance in ovarian cancer is unclear.

Zinc finger protein 24 (ZNF24) belongs to the Kruppel-like zinc finger transcription factor family, that regulates cell proliferation and differentiation (Huang et al., 2020). More importantly, it is a key player in tumorigenesis. For example, ZNF24 was markedly downregulated in ovarian cancer samples, and its expression was significantly correlated with the stage of tumor (Chen et al., 2022). It’s suggested that ZNF24 is closely related to the progression of ovarian cancer; however, its role in regulating the sensitivity of ovarian cancer cells to CBP warrants further investigation.

The Wnt/β-catenin pathway plays important functions in embryonic development, and dysregulation of Wnt/β-catenin signaling deregulation frequently leads to several severe disorders, including cancer (Liu et al., 2022a). Wnt/β-catenin signaling is closely related to chemotherapy resistance in cancers, as shown in a recent study where inactivation of Wnt/β-catenin signaling re-sensitized CBP-resistant triple-negative breast cancer cells to CBP (Abreu de Oliveira et al., 2021). Additionally, overactivation of Wnt/β-catenin signaling in ovarian cancer was reported to promote olaparib resistance and cancer cell proliferation (Hu et al., 2021a). Wingless-type MMTV integration site family member 2b (WNT2B) is a member of the Wnt family and is a key player in the development of cancers (Zhang et al., 2021). The silencing of WNT2B can inhibit the malignant behaviors of ovarian cancer cells by inactivating the Wnt/β-catenin signaling pathway (Niu et al., 2019; Yu et al., 2022). However, the interaction between WNT2B and Wnt/β-catenin signaling and their role in regulating CBP resistance during the development of ovarian cancer remain largely unknown.

Using bioinformatical analysis, we found that ZNF24 could interact with the WNT2B promoter region; however, their interaction has not been reported in ovarian cancer. This study aimed to evaluate the role of NM in regulating the sensitivity of ovarian cancer cells to CBP and the mechanisms involved. We hypothesized that NM enhanced ZNF24 expression to transcriptionally inhibit WNT2B expression, thus inactivating the Wnt/β-catenin signaling and sensitizing ovarian cancer cells to CBP.

MATERIALS AND METHODS

Cell culture

The human ovarian cancer cell line (SKOV3 cells) were purchased from American Type Culture Collection (ATCC; VA, USA). SKOV3 cells were cultured in McCoy’s 5A medium (Sigma–Aldrich, MO, USA) containing 10% fetal bovine serum (FBS; Invitrogen, CA, USA) and 10% penicillin-streptomycin (Solarbio, Beijing, China).

The establishment of CBP-resistant ovarian cancer cell lines

The CBP-resistant ovarian cancer cell lines were established as previously reported (Ma et al., 2020). In brief, when the cells reached 70%–80% confluence, CBP (10 μg/mL) was added to the culture for 1 hr and replaced with normal medium; half of the cells died after culture for 24 hr. CBP stimulation was performed again when the remaining cells reached 70%–80% confluence. The treatment was repeated for 3 to 6 times, during which the CBP concentration was increased by 50% until no cell death occurred. The CBP-resistant cell line (SKOV3/CBP) was stable when cultured in the medium containing CBP. NM, obtained from Torii Pharmaceutical Co., Ltd. (Tokyo, Japan), was dissolved in water and stored at −20°C, and a dose of 80 μg/mL was used for intervention on the SKOV3/CBP cells, as described previously (Shirai et al., 2016). All cells were grown at 37°C containing 5% CO2.

Plasmid construction and transfection

Short hairpin RNAs (sh-ZNF24 and sh-WNT2B) and the negative controls (sh-NC) were purchased from Genepharma Co., Ltd. (Shanghai, China). The ZNF24 sequence (accession number: NM_001308123.2) was amplified by PCR. The amplified fragments were inserted into pcDNA3.1 vector (Invitrogen) to generate oe-ZNF24, and the empty pcDNA3.1 vector was used as the negative control (oe-NC). The above plasmids and shRNAs were transfected into cells using lipofectamine 3000 reagent (Invitrogen), as reported previously (Dai et al., 2021). In brief, the cells were seeded (density, 1 × 105 per well) into a 6-well plate for transfection. After 24 hr, the cells reached 70%–90% confluence, and the medium was replaced with an antibiotic- and serum-free medium. A total of 300 µL of a mixture of the plasmid DNA or shRNA and lipofectamine 3000 reagent (Invitrogen) were added to each well, and the cells were incubated for 6 hr at 37°C in a 5% CO2 incubator. The medium was then replaced with McCoy’s 5A medium containing 10% FBS. After 48 hr, the success of the transfection was determined by quantitative real-time polymerase chain reaction (qRT-PCR), as described previously (Gong et al., 2023). The knockdown sequences of ZNF24 and WNT2B were listed in Table 1.

Table 1. The knockdown sequences and primer sequences.

sequences
WNT2B promoter F:5’-TAGCCCAGCCCTGGCTGC-3’
R:5’-TATCACTTTTTGAAGGCTTATGTC-3’
ZNF24 shRNA 5’-GGAAGAAGATTCAATACTTAT-3’
WNT2B shRNA 5’-CTGATCTTGTCTACTTTGACA-3’

qRT-PCR

Total RNA was extracted using Trizol reagent (Invitrogen), and the NanoDrop 2000 (Thermo Fisher, MA, USA) was used to assess the concentration and quality. Total RNA (1 μg) was reversely transcribed into cDNA using the PrimeScript™ RT reagent Kit (Takara, Shiga, Japan), according to the manufacturer’s protocol. The reaction conditions were as follows: 37°C for 15 min, followed by 85°C for 5 sec. The cDNA product was immediately used as a template for qRT-PCR using SYBR Green Master Mix (Takara) and the Light Cycler 480 II system (Roche, Basel, Switzerland). β-actin was used as an endogenous reference, and the relative quantification for target genes was calculated using the 2−∆∆CT method. The primers used for qRT-PCR as shown in Table 2.

Table 2. Primer sequences used in qRT-PCR.

Gene Forward primer (5’-3’) Reverse primer (5’-3’)
ZNF24 CTGATGGCGAAGAGGGATCAA CCAGCACTACCAGCTCCAAG
WNT2B GGGGCACGAGTGATCTGTG GCATGATGTCTGGGTAACGCT
β-actin ACTCTTCCAGCCTTCCTTCC CGTCATACTCCTGCTTGCTG

Western blot

Western blot was performed as reported previously (Ding et al., 2023). In brief, proteins were isolated with RIPA (Beyotime, Shanghai, China) containing protease inhibitors (Beyotime). The lysates were centrifuged at 12,000 rpm for 10 min at 4°C, and the supernatants were collected. The protein concentration was quantified using a BCA Kit (Beyotime). Subsequently, the total protein (20 μg) was isolated by 10% SDS-PAGE and transferred to a PVDF membrane (Millipore, MA, USA). The membranes were blocked with 5% non-fat milk for 1 hr and incubated overnight with the following primary antibodies: anti-Bax (1:2000, ab182733, Abcam, Cambridge, UK), anti-cleaved caspase3 (1:500, ab32042, Abcam), anti-Bcl-2 (1:1000, ab32124, Abcam), anti-ZNF24 (1:1000, PA5-106472, Invitrogen), anti-WNT2B (1:500, ab203225, Abcam), anti-β-catenin (1:1500, ab68183, Abcam), and anti-GAPDH (1:2500, ab9485, Abcam) at 4°C. The membranes were incubated with HRP-conjugated goat anti-rabbit IgG (1:3000, ab205718, Abcam) at room temperature for 2 hr. The blots were detected by enhanced chemiluminescence reagent (ECL), and the immunoreactivity signals were analyzed using the Chemidoc-XRS Gel System with Quantity One software (Bio-Rad, CA, USA). The individual band intensities were evaluated using Image J software.

MTT assay

MTT assay was performed as described previously (Sun et al., 2023). In brief, SKOV3 or SKOV3/CBP cells were seeded in 96-well plates at a density of 5 × 103 cells/well and treated with 0, 20, 40, 80, and 160 μg/mL NM for 24 hr to observe the half-maximal inhibitory concentration (IC50) value. The cells were incubated with 5 mg/mL MTT solution (Sigma-Aldrich) for 4 hr in the dark, followed by culture of 100 µL followed by the precipitate dissolving in dimethyl sulfoxide (DMSO, Sigma-Aldrich), to determine the cell viability. After shaken for 10 min, a spectrophotometric microplate reader (BioTex, TX, USA) was used to detect cell proliferation at a wavelength of 570 nm.

Colony formation assay

The colony formation assay was performed as described previously (Huang et al., 2023). In brief, SKOV3/CBP cells were collected and seeded in a 6-well plate at a density of 1 × 103 cells/well to form cell colonies. All the transfection cells were treated with NM and/or CBP for 21 days. Subsequently, the cells were fixed in 4% paraformaldehyde for 2 hr and stained with 0.5% crystal violet (Solarbio) for 15 min. The cell colonies (>50) were counted under a light microscope.

Cell migration detection

After specific transfection and treatment, SKOV3/CBP cells were collected and resuspended in serum-free medium. Cells were plated in a chamber of 24-well transwell plate with 8.0 μm pore size membranes (Corning Life Sciences, NY, USA) at a density of 5 × 104 cells/well. The lower chamber was added with 500 µL medium containing 10% FBS. The plate was maintained in 37°C and 5% CO2 for 24 hr. A wet cotton swab was used to remove cells in the upper surface of polycarbonate films, and cells in the lower surface of the upper chamber were put in 4% paraformaldehyde for 10 min for fixing. Then, the cells were stained with 0.5% crystal violet (Solarbio) for 5 min. After washing 3 times with PBS, cell migration was observed under a microscope (Olympus, Tokyo, Japan). The stained cells were counted in at least 5 random fields from each sample.

Cell invasion detection

After specific transfection and treatment, SKOV3/CBP cells were collected and resuspended in serum-free medium. Cells were plated in a Matrigel-coated chamber of 24-well transwell plate with 8.0 μm pore size membranes (Corning Life Sciences) at a density of 5 × 104 cells/well. The lower chamber was added with 500 µL medium containing 10% FBS. The plate was maintained in 37°C and 5% CO2 for 24 hr. A wet cotton swab was used to remove cells in the upper surface of polycarbonate films, and cells in the lower surface of the upper chamber were put in 4% paraformaldehyde for 10 min for fixing. Then, the cells were stained with 0.5% crystal violet (Solarbio) for 5 min. After washing 3 times with PBS, cell invasion was observed under a microscope (Olympus). The stained cells were counted in at least 5 random fields from each sample.

Cell apoptosis detection

Cell apoptosis was detected using the ANNEXIN V-FITC/PI Apoptosis Detection Kit (CA1020, Solarbio). In brief, after specific transfection and treatment, cells were collected and resuspended in 500 µL of binding buffer (Solarbio) and then stained with 3 µL Annexin V-FITC and 2.5 µL PI (Solarbio) for 20 min at 37°C in the dark. Cell apoptosis was analyzed using the FACSCalibur flow cytometer (342973, BD Biosciences, NJ, USA) and FlowJo v10 software (FlowJo LLC, NJ, USA).

Chromatin immunoprecipitation (ChIP) assay

The ChIP assay was conducted using the EZ ChIP Chromatin Immunoprecipitation Kit (Millipore) according to the instruction manual. The collected SKOV3/CBP cells were fixed with 1% formaldehyde for 5 min to induce DNA–protein cross-linking. The cell lysate was ultrasonically treated to produce chromatin fragments and incubated with anti-ZNF24 (1:1000, PA5-106472, Invitrogen) or anti-IgG (1:30, ab313801, Abcam) at 4°C overnight. DNA bound to ZNF24 was immunoprecipitated using Pierce protein A/G beads (Thermo Fisher Scientific) for 4 hr at 4°C, and the cross-linking was eliminated.

Dual-luciferase reporter assay

Dual-luciferase reporter assay was performed as described previously (Xu et al., 2018). Briefly, cells were seeded in a 96-well plate and cultured overnight. The fragment of WNT2B promoter (chr1: 112464541-112466540) was amplified by PCR. Site-directed mutagenesis of the ZNF24 binding site in the fragment of WNT2B promoter was performed using a site-directed mutagenesis kit (Stratagene, CA, USA). The binding sequence and mutation sequence of the transcription factor ZNF24 and WNT2B promoter region was shown in Fig. 3A. Wild-type (WT) and mutant (MUT) reporter plasmids of WNT2B sequences were cloned into the pGL3 vector (Promega, WI, USA) to generate the pGL3-WNT2B-WT or pGL3-WNT2B-MUT vectors, respectively. The cells were co-transfected with oe-ZNF24 or oe-NC and luciferase reporter vectors containing pGL3-WNT2B-WT or pGL3-WNT2B-MUT sequences. After 48 hr of transfection, the cells were harvested, and the relative luciferase activity was determined. The Renilla luciferase activity was normalized to that of Firefly luciferase and utilized as the control. The primer sequence for WNT2B promoter amplification was listed in Table 1.

Xenograft tumor establishment

Eighteen 4–5-week-old female BALB/c nude mice, weighing 18-20 g were purchased from Shanghai SLAC Laboratory Animal Co., Ltd. (Shanghai, China). After one week of acclimatization, the mice were randomly allocated into three groups (six per group): control, CBP, and CBP+NM. The mice were subcutaneously injected to construct a subcutaneous tumor model, as described previously (Zhang et al., 2023). SKOV3/CBP cells (1 × 106 cells/mouse, 100 µL) were subcutaneously injected into the right armpit. NM (30 mg/kg) and/or CBP (50 mg/kg) were injected through the caudal vein when the tumor volume reached 70–80 mm3. The tumor width and length were measured by a vernier caliper every 3 days from day 7 to day 34 to calculate the tumor volume using the formula: volume = (width 2 × length) / 2. After 34 days, the mice were sacrificed, the weight of tumor was recorded, and images of the tumor were taken.

Immunohistochemical (IHC) staining

IHC staining was performed as described previously (Li et al., 2023). In brief, paraffin sections of the tumor tissue (4-μm thick) were prepared. The tissue sections were deparaffinized in an oven for 25 min at 60°C and incubated in xylene solution for an additional 20 min. Next, a series of decreasing concentrations of ethanol solutions (100%, 95%, 80%, and 60%) were used to rehydrate the sections. The slides were covered with target retrieval solution and heated in a microwave oven at medium power for 15 min. The slides were incubated with a solution of 3% H2O2 for 15 min at room temperature to quench endogenous peroxidase activity in the sections. Then, the sections were incubated with primary antibody anti-Ki67 (1:100, ab197547, Abcam) at 4°C overnight. Thereafter, the sections were rinsed and incubated with goat anti-rabbit (1:1000, ab6721, Abcam) for 2 hr at room temperature. Finally, the sections were reacted with 3,3’-diaminobenzidine (DAB; Sigma-Aldrich) solution, stained with hematoxylin, dried, and sealed with neutral gum. All the tissue sections were evaluated under a light microscope. Cells with brownish-yellow nuclei demonstrated positive staining. The tissue sections were assessed based on the intensity of the staining (0–3 for the absence of staining, faint yellow, light brown, and dark brown staining, respectively) and the proportion of positive staining (0%–3% for 0%–25%, 26%–50%, 51%–75%, and 76%–100%, respectively). The IHC results were evaluated separately by two experienced pathologists blinded to the groupings.

Statistical analysis

All experimental data were analyzed using GraphPad Prism8 statistical software (GraphPad Software, CA, USA) and presented as the mean ± standard deviation. Data between two groups were compared by student’s t-test, and those among multiple groups were analyzed by one-way ANOVA with Tukey’s multiple comparisons test. A P-value of <0.05 was considered statistically significant. All experiments were repeated at least for 3 times.

RESULTS

NM treatment inhibited the malignant behaviors of CBP-resistant ovarian cancer cells

The CBP-resistant SKOV3 cells (SKOV3/CBP) were established and exposed to various NM doses (20, 40, 60, 80 and 160 μg/mL). The results of the MTT assay showed that the IC50 of the CBP-resistant ovarian cancer cells (86.89 μg/mL) was significantly higher than that of the parent cells (62.65 μg/mL) (Fig. 1A). NM treatment reduced the viability, proliferation, migration, and invasion of the SKOV3/CBP cells in a dose-dependent manner (Fig. 1B-D); in addition, SKOV3/CBP cell apoptosis was elevated by NM in a dose-dependent manner (Fig. 1E). NM treatment elevated the protein levels of Bax and cleaved caspase3 and reduced that of Bcl-2 in the SKOV3/CBP cells in a dose-dependent manner (Fig. 1F). These findings indicated that NM treatment sensitized the ovarian cancer cells to CBP.

Fig. 1

NM treatment inhibited the malignant behaviors of CBP-resistant ovarian cancer cells. (A) SKOV3 and SKOV3/CBP cells were treated with 0, 20, 40, 60, 80, and 160 μg/mL of NM, and the IC50 of SKOV3 and SKOV3/CBP cells were obtained by MTT assay. SKOV3/CBP cells were treated with different concentrations of NM (20, 40, 60 and 80 μg/mL). (B) Cell viability was examined by MTT assay. (C) Colony formation assay was employed to determine cell proliferation. (D) Cell migration and invasion were assessed by Transwell assay. (E) Flow cytometry was employed to detect apoptosis. (F) The protein levels of Bax, cleaved caspase3 and Bcl-2 were evaluated by western blot. The measurement data were presented as mean ± SD. N=3. *p < 0.05, **p < 0.01, ***p < 0.001.

NM enhanced CBP-resistant ovarian cancer cell apoptosis by upregulating ZNF24

As shown in Fig. 2A, ZNF24 expression in SKOV3/CBP cells was significantly lower in SKOV3 cells. ZNF24 silencing was induced in SKOV3/CBP cells to determine the effect of NM on CBP sensitivity in ovarian cancer cells via ZNF24. Based on the qRT-PCR results, sh-ZNF24 transfection significantly reduced ZNF24 expression in the SKOV3/CBP cells (Fig. 2B). NM or CBP intervention alone decreased the viability, proliferation, migration, and invasion of the cells, which were further inhibited by the combined intervention of NM and CBP; ZNF24 knockdown reversed the inhibitory effect of this combined therapy on the cells (Fig. 2C-E). NM or CBP intervention alone enhanced SKOV3/CBP cell apoptosis, and the combined intervention of NM and CBP further increased the apoptosis; however, the pro-apoptotic effect of the combined therapy was attenuated by ZNF24 silencing (Fig. 2F). NM or CBP intervention elevated Bax and cleaved caspase3 protein levels and reduced the Bcl-2 level in SKOV3/CBP cells; these changes were exacerbated after the combined intervention of NM and CBP and abrogated following ZNF24 knockdown (Fig. 2G). Taken together, these data indicated that NM enhanced the sensitivity of CBP-resistant ovarian cancer cells to CBP by elevating the expression of ZNF24.

Fig. 2

NM enhanced CBP-resistant ovarian cancer cell apoptosis by upregulating ZNF24. (A) ZNF24 expression in SKOV3 and SKOV3/CBP cells was detected using qRT-PCR. (B) SKOV3/CBP cells were transfected with sh-ZNF24 or sh-NC, and ZNF24 expression in SKOV3/CBP cells was detected by qRT-PCR. SKOV3/CBP cells were transfected with sh-ZNF24 or sh-NC followed by stimulation with NM or CBP, and combined stimulation with NM and CBP. (C) Cell viability was examined by MTT assay. (D) Colony formation assay was employed to determine cell proliferation. (E) Cell migration and invasion were assessed by Transwell assay. (F) Flow cytometry was employed to detect apoptosis. (G) The protein levels of Bax, cleaved caspase3 and Bcl-2 were evaluated by western blot. The measurement data were presented as mean ± SD. N=3. *p < 0.05, **p < 0.01, ***p < 0.001.

ZNF24 inhibited WNT2B transcription and inactivated the Wnt/β-catenin signaling

The JASPAR database was used to predict the potential target of ZNF24 in order to determine the mechanism by which it regulated the CBP resistance in ovarian cancer cells. ZNF24 had potential binding sites to the WNT2B promoter (Fig. 3A). The results of the dual-luciferase reporter assay showed that ZNF24 overexpression markedly inhibited the luciferase activity of WNT2B-WT but did not significantly affect the luciferase activity of WNT2B-MUT (Fig. 3B). The results of the ChIP assay showed that WNT2B was enriched in anti-ZNF24 immunoprecipitates (Fig. 3C), indicating that ZNF24 directly bound with the WNT2B promoter. Subsequently, ZNF24 overexpression elevated the ZNF24 expression level while decreasing the expression levels of WNT2B and β-catenin in the SKOV3/CBP cells (Fig. 3D, E). These results revealed that ZNF24 inactivated Wnt/β-catenin signaling in CBP-resistant ovarian cancer cells by inhibiting WNT2B transcription.

Fig. 3

ZNF24 inhibited WNT2B transcription and inactivated the Wnt/β-catenin signaling. (A) JASPAR database was employed to predict the potential binding sites between ZNF24 and WNT2B promoter, and the binding sequence and mutation sequence of the transcription factor ZNF24 and WNT2B promoter region was presented. (B-C) Dual-luciferase reporter and ChIP assays were performed to analyze the binding relationship between ZNF24 and WNT2B promoter (the WNT2B promoter was located in chr1: 112464541-112466540). SKOV3/CBP cells were transfected with oe-ZNF24 or oe-NC. (D) ZNF24 and WNT2B mRNA levels were determined using qRT-PCR. (E) ZNF24, WNT2B and β-catenin protein levels were measured by western blot. The measurement data were presented as mean ± SD. N=3. *p < 0.05, **p < 0.01, ***p < 0.001.

NM sensitized ovarian cancer cells to CBP by inactivating the WNT2B-Wnt/β-catenin axis through upregulating ZNF24

Both ZNF24 and WNT2B were knocked down in the SKOV3/CBP cells, followed by a combined treatment with NM and CBP in order to investigate the involvement of the ZNF24/WNT2B/Wnt/β-catenin axis in regulating the CBP resistance in cells under NM treatment. As shown in Fig. 4A, sh-WNT2B transfection significantly reduced WNT2B expression in the cells, suggesting that the transfection was successful. NM treatment repressed the viability, proliferation, migration, and invasion of the CBP-treated SKOV3/CBP cells and promoted cell apoptosis; ZNF24 knockdown reversed the regulatory effects of NM on these biological behaviors, and sh-WNT2B co-transfection eliminated the effects of ZNF24 knockdown alone (Fig. 4B-E). NM elevated the protein levels of Bax and cleaved caspase3 and reduced that of Bcl-2 in the CBP-treated SKOV3/CBP cells, which were reversed by ZNF24 silencing; alternatively, the changes in protein expression induced by sh-ZNF24 were restored by sh-WNT2B co-transfection (Fig. 4F). Collectively, these data suggested that NM elevated ZNF24 expression to inhibit WNT2B-Wnt/β-catenin signaling, thereby enhancing the sensitivity of ovarian cancer cells to CBP.

Fig. 4

NM increased the sensitivity of ovarian cancer cells to CBP by inactivating the WNT2B-Wnt/β-catenin axis through upregulating ZNF24. (A) SKOV3/CBP cells were transfected with sh-WNT2B or sh-NC, and WNT2B expression was detected by qRT-PCR. Both ZNF24 knockdown and WNT2B knockdown were induced in SKOV3/CBP cells combined with NM and CBP treatments. (B) Cell viability was examined by MTT assay. (C) Colony formation assay was employed to determine cell proliferation. (D) Cell migration and invasion were assessed by Transwell assay. (E) Flow cytometry was employed to detect apoptosis. (F) The protein levels of Bax, cleaved caspase3 and Bcl-2 were evaluated by western blot. The measurement data were presented as mean ± SD. N=3. *p < 0.05, **p < 0.01, ***p < 0.001.

NM enhanced the inhibitory effect of CBP on tumor growth in vivo

As depicted in Fig. 5A-C, CBP treatment decreased the tumor volume and weight in the xenograft model, and the combined intervention of CBP and NM remarkably restrained tumor growth. According to IHC data, CBP treatment markedly reduced the protein level of Ki-67 (a cell proliferation mark) in tumor tissues, and this effect was further enhanced by NM treatment (Fig. 5D). CBP treatment increased the expression level of ZNF24 and reduced those of WNT2B and β-catenin in the tumor tissues; the synergistic use of CBP and NM further promoted the mRNA and protein levels of ZNF24 and decreased those of WNT2B and β-catenin (Fig. 5E, F). These findings suggested that NM collaborated with CBP to inhibit the tumor growth in mice.

Fig. 5

NM enhanced the inhibitory effect of CBP on tumor growth in vivo. Nude mice were injected with SKOV3/CBP cells and co-treated with NM and CBP meanwhile. (A) Tumor representative images. (B) Tumor volume. (C) Tumor weight. (D) The expression of Ki-67 was determined by IHC. (E, F) qRT-PCR and western blot were performed to examine the expression of ZNF24, WNT2B and β-catenin both mRNA and protein levels. The measurement data were presented as mean ± SD. N=6/per group. *p < 0.05, **p < 0.01, ***p < 0.001.

DISCUSSION

Ovarian cancer is the leading cause of gynecological cancer death in most developed countries (Reid et al., 2017). CBP is the most widely used basal drug for perioperative and palliative chemotherapy because it can improve the prognosis of ovarian cancer patients (Chen et al., 2020). However, nearly 80% of patients experience chemotherapy resistance and relapse after these treatments (Ortiz et al., 2022). Therefore, it is important to explore new strategies to address the chemotherapy resistance and improve the survival rates of cancer patients. The primary novel finding in the current research was that NM can sensitize ovarian cancer cells to CBP by inactivating the WNT2B-Wnt/β-catenin signaling through the upregulation of ZNF24.

NM is a serine protease inhibitor clinically used to treat various diseases (Aoyama et al., 1984; Duan et al., 2018). Recent studies have demonstrated that NM treatment can enhanced antitumor effects of anticancer agents or radiation therapy in cancers (Sugano et al., 2018; Lin et al., 2022). The positive effects of NM in combination with gemcitabine have been reported in a phase 2 clinical study comprising unresectable pancreatic cancer patients (Uwagawa et al., 2013). However, the role of NM in regulating ovarian cancer progression and the sensitivity of ovarian cancer cells to CBP remains unknown. The current study showed that NM could remarkably inhibit the malignant behaviors of CBP-resistant ovarian cancer cells and enhance the sensitivity of drug-resistant ovarian cancer cells to CBP. In addition, NM enhanced the inhibitory effect of CBP on ovarian cancer tumor growth in mice. To our knowledge, this is the first study to investigate the influence of NM on CBP sensitivity in ovarian cancer.

ZNF24 is a zinc finger protein containing four motifs encoding putative DNA binding domains. ZNF24 gene may play a role in controlling tumor development due to its position on chromosome 18q12.1, a region commonly deleted in cancer (Vogelstein et al., 1988; Rousseau-Merck et al., 1991; Liu et al., 2022b). One study reported a marked upregulation of ZNF24 in prostate cancer, which facilitated the migration and invasion of the tumor cells (Huang et al., 2020). Conversely, ZNF24 was reported to be downregulated in various human malignant tumors, including ovarian cancer (Chen et al., 2022; Hou et al., 2016). According to another study, it acts as an independent prognostic indicator for the overall survival of patients with ovarian cancer, and its low expression is associated with poorer clinical prognosis (Chen et al., 2022). Notably, a previous study showed that ZNF24 upregulation sensitized colorectal cancer cells to 5-fluorouracil by inhibiting the Wnt pathway and activating the p53 signaling (Meng et al., 2023). However, the function of ZNF24 in regulating CBP sensitivity of ovarian cancer cells is unknown. In the current study, ZNF24 silencing reversed the inhibitory effect of NM on CBP resistance in ovarian cancer cells, indicating that NM intervention can enhance the sensitivity of ovarian cancer cells by upregulating ZNF24.

Investigations on the mechanistic actions of ZNF24 in ovarian cancer cells revealed that ZNF24 transcriptionally inhibited WNT2B expression. Previous studies demonstrated that WNT2B expression was upregulated in various cancers, including cervical (Li et al., 2019), non-small cell lung (Sumitomo et al., 2022) and gastric (Zhang et al., 2021) cancer, playing an encouraging role in tumor progression. More importantly, Niu et al. reported that WNT2B downregulation increased the sensitivity of ovarian cancer cells to CBP (Niu et al., 2019). The regulatory effect of WNT2B on chemotherapy resistance in cancers has been studied. As evidence, WNT2B silencing reduced the CBP resistance in head and neck squamous cell carcinoma (Li et al., 2014). In addition, WNT2B upregulation contributed to the drug resistance of prostate cancer and proliferation (Chen et al., 2023). Moreover, WNT2B silencing inhibited metastasis and enhanced chemotherapy sensitivity in ovarian cancer (Wang et al., 2012). Consistent with these findings, the current study showed that WNT2B knockdown blocked the elimination effect of ZNF24 knockdown on the NM-mediated inhibition of CBP resistance in ovarian cancer cells. In addition, WNT2B knockdown inhibited the malignant behaviors of ovarian cancer cells by inactivating Wnt/β-catenin signaling (Yu et al., 2022). The Wnt/β-catenin signaling pathway involves abundant key cellular functions and is frequently dysregulated in cancers, including ovarian cancer (Wu et al., 2022; Yu et al., 2021). Wnt/β-catenin signaling is associated with the drug resistance in ovarian cancer (Hu et al., 2021b). In the study by Belur Nagaraj et al., activation of Wnt signaling played a vital role in the platinum resistance in ovarian cancer (Belur Nagaraj et al., 2021). In another study, Wnt/β-catenin signaling activation in gemcitabine-resistant cells enhanced drug resistance in ovarian cancer (Alrashed et al., 2022). In the current study, NM sensitized ovarian cancer cells to CBP by inactivating the WNT2B-Wnt/β-catenin axis via the upregulation of ZNF24. However, the detailed mechanism by which NM induced the increased expression of ZNF24 remains poorly understood. Thus, additional studies exploring the underlying pathways involved in this phenomenon are warranted.

In summary, our results indicated that NM intervention enhanced the sensitivity of ovarian cancer cells to CBP. Mechanistic investigations revealed that NM reduced CBP resistance by upregulating ZNF24. Furthermore, ZNF24 inactivated the Wnt signaling by transcriptionally inhibiting WNT2B expression. This study suggests that combining NM with chemotherapy drugs is a potential strategy to improve survival in ovarian cancer patients, thus providing a novel method and potential therapeutic drug for ovarian cancer patients with chemotherapy resistance.

ACKNOWLEDGMENTS

This work was supported by Science and Education Joint Project of Hunan Natural Science Foundation (2022JJ60110) and General Project of Hunan Natural Science Foundation (2024JJ5469).

Conflict of interest

The authors declare that there is no conflict of interest.

REFERENCES
 
2024 The Japanese Society of Toxicology
feedback
Top