Activator protein-1 mediates blue light-induced phototoxicity in retinal pigment epithelial cells

Abstract

Age-related macular degeneration is a leading cause of vision loss and is characterized by the accumulation of drusen in the retinal pigment epithelium. N-retinylidene-N-retinylethanolamine (A2E), a major component of drusen, induces phototoxicity upon exposure to blue light. Given that blue light activates the MAPK pathway and triggers apoptosis, the present study aimed to determine the role of signaling via the activator protein-1 (AP-1) transcription factor in A2E-laden ARPE-19 cells. RNA-sequencing identified significant upregulation of the UV response and p53 pathways. In silico analysis predicted that JUN was a key upstream transcriptional regulator, and experimental validation confirmed increased JUN phosphorylation and AP-1 target gene expression upon blue light exposure. Furthermore, blue light treatment decreased BCL2 and increased BAX protein levels, thereby promoting apoptosis via caspase activation and PARP cleavage, as also confirmed by flow cytometry. These findings suggest that blue light induces apoptosis via JUN, which activates AP-1 in A2E-laden ARPE-19 cells. The present study provides new insights into the molecular mechanisms underlying blue light-induced retinal damage and its potential contribution to the progression of age-related macular degeneration.

INTRODUCTION

Stress-activated protein kinases respond to various stress signals, including UV radiation, oxidative stress, and inflammation (Black et al., 2011). These kinases regulate and affect various physiological processes, such as cell survival, differentiation, cell cycle, and apoptosis (Liang et al., 2014; Shu et al., 1996). Stress-activated protein kinases can be divided into subgroups, exemplified by JUN N-terminal kinase (JNK) and p38 mitogen-activated protein kinase (MAPK) (Tanos et al., 2005). Each of these kinases amplifies intracellular signals in response to a stimulus, helping the cell adapt to stress or repair existing damage (Hayakawa et al., 2003; Lee et al., 2011). Accordingly, stress-activated protein kinases have been implicated in various physiological and pathological processes, including skin aging, inflammation, and tumorigenesis (Nishina et al., 2004; Liu et al., 2008; Choudhury et al., 2015).

Genes that are rapidly activated upon UV exposure include members of the activator protein-1 (AP-1) transcription factor family (Silvers et al., 2003). AP-1 is formed by dimers of proteins encoded by FOS (c-Fos, FosB, Fra-1, and Fra-2) and JUN (c-Jun, JunD, and JunB) subfamily members, and this complex binds to specific DNA sequences to regulate gene expression (Karin et al., 1997). AP-1 proteins are often the final targets of signal transduction kinases; when phosphorylated, they become activated, bind to the AP-1 promoter on the corresponding target genes, and drive their expression (Cavigelli et al., 1995). The best-studied example is the phosphorylation of JUN by UV-activated JNK, which, in turn, acts on AP-1 sequences present on its promoter (Zhang and Bowden, 2012). AP-1 is associated with a wide range of intracellular events including cell transformation, proliferation, differentiation, and apoptosis.

Age-related macular degeneration (AMD) is a disease, whereby the macula of the retina becomes damaged with age. In its early stage, it is characterized by the accumulation of waste products known as drusen (Lee and Jeong, 2023; Jeong et al., 2019). Late AMD is divided into dry-type, which develops into geographic atrophy accompanied by extensive retinal damage, and wet-type, which is characterized by abnormal neovascularization and blood exudates in the retina (Mitchell et al., 2018). N-retinylidene-N-retinylethanolamine (A2E), an endogenous fluorescent pigment, is a drusen component that accumulates in the lysosomes of aging retinal pigment epithelial cells (Sparrow et al., 1999; Wu et al., 2010; Lei et al., 2017). When A2E is exposed to blue light, it induces the death of retinal pigment epithelial cells due to photooxidation (Moon et al., 2017; Sparrow et al., 2002, Bian et al., 2012). Even though blue light is in the visible light range, there are growing concerns about its phototoxicity owing to its high-energy wavelengths, which are close to those of UV radiation (Jeong et al., 2019; Lee and Jeong, 2022). The widespread use of smart devices has dramatically increased our exposure to blue light, thereby calling for more research on its short-term and long-term impact. Akin to UV, blue light can activate MAPKs, such as JNK and p38 (Westlund et al., 2009). However, the role of blue light in AP-1 activation and consequent death of human retinal pigment epithelial cells remains unknown.

In this study, we aimed to determine the role and regulatory mechanism of AP-1 in apoptotic signaling following blue light exposure to A2E-laden retinal pigment epithelial cells. The results of this study provide information on how blue light induces AP-1 activation in human retinal pigment epithelial cells.

MATERIALS AND METHODS

Cell culture and reagents

Human ARPE-19 cells were obtained from the American Type Culture Collection (Manassas, VA, USA) and maintained in Dulbecco's Modified Eagle's medium/F-12 medium containing 10% fetal bovine serum at 37°C under a 5% CO₂ atmosphere. A2E was obtained from Key Synthesis LLC (Philadelphia, PA, USA).

A2E- and blue light-induced retinal pigment epithelium damage model

An in vitro retinal pigment epithelium damage model induced by A2E and blue light was established as previously reported (Jin et al., 2017). Briefly, ARPE-19 cells were seeded into a 6-well plate at a density of 2 × 10⁴ cells per well and treated with 25 μM A2E at 48-hr intervals for a total of three treatments. Twenty-four hours after the final A2E treatment, the cells were exposed to blue light (430 nm, 8,000 lux) for 30 min. Following an additional 24-hr incubation, total RNA and cell lysates were collected as described previously (Shin et al., 2022).

RNA-sequencing

Total RNA was isolated and purified using an RNeasy Mini Kit (QIAGEN, Hilden, Germany). RNA-sequencing (RNA-seq) was performed as detailed previously (Jin et al., 2017). An mRNA sequencing library was constructed using the TruSeq Stranded mRNA Kit (Illumina, San Diego, CA, USA) and sequenced on a NextSeq500 platform (Agilent Technologies). Genes with an absolute fold change (FC) ≥ 2.0 and a Q-value < 0.05 between groups were identified as differentially expressed. Differentially expressed gene (DEG) datasets were analyzed for pathway enrichment using MSigDB hallmark annotations via EnrichR (Xie et al., 2021; Kuleshov et al., 2016).

Quantitative reverse-transcriptase polymerase chain reaction

Total RNA was extracted from ARPE-19 cells using TRIzol reagent (Invitrogen, Carlsbad, CA, USA). The mRNA was reverse-transcribed using the iScript cDNA Synthesis Kit (Bio-Rad Laboratories, Hercules, CA, USA). Quantitative reverse-transcriptase polymerase chain reaction (RT-qPCR) was conducted in a Roche LightCycler® 480 II system with SYBR Green I Master Mix (Roche, Basel, Switzerland). The primer sequences used for RT-qPCR are listed in Table 1. All mRNA expression levels were normalized to those of 18S rRNA.

Table 1. Primer sequences for real-time RT-qPCR.

Name	Forward	Reverse
18S	GAGGATGAGGTGGAACGTGT	TCTTCAGTCGCTCCAGGTCT
FOS	GGGGCAAGGTGGAACAGTTAT	CCGCTTGGAGTGTATCAGTCA
JUN	TCCAAGTGCCGAAAAAGGAGG	CGAGTTCTGAGCTTTCAAGGT
ATF3	GCTGTCACCACGTGCAGTATCTCA	CTGTTCCTCCTCTTGCTGACAAGC
DUSP5	GTCCTCACCTCGCTACTC	GGGCTCTCTCACTCTCAAT
TRIB1	TTCAAGCAGATTGTCTCCGC	AGTGGTGTTGAGGATCTCAG
TRIB3	GAGGAGGGAGACAGAGAAG	TGGAAGGCACTGAAGGTT
GEM	GGCCTACCAGAAAAGGAAGG	GTTGTTTTTGGCCACGATCT
MT2A	AAAGGGGCGTCGGACAAGT	TAGCAAACGGTCACGGTCAG

Western immunoblotting

Western blot analysis was conducted using anti-phospho-JUN (Ser63), anti-phospho-ERK1/2 (Thr202/Tyr204), anti-phospho-AKT (Ser473), anti-BCL2, anti-BAX, anti-PARP (Cell Signaling Technology, Danvers, MA, USA), anti-phospho-JNK (Thr183/Tyr185), anti-β-actin (Santa Cruz Biotechnology, Inc., Huston, TX, USA), and anti-caspase-3 (Abcam, Cambridge, UK) antibodies. Protein expression levels were measured using the ChemiDoc XRS+ imaging system (Bio-Rad Laboratories). Images were quantified using ImageJ software (version 1.8.0; National Institutes of Health, Bethesda, MD, USA).

Reporter gene assay

The AP-1 reporter gene assay was performed as described previously (Jeong et al., 2009). Briefly, ARPE-19 cells seeded in 6-well plates were transfected with the AP-1 luciferase reporter plasmid (200 ng) and grown for 24 hr. Relative luminescence intensity was measured using a Wallac 1420 Victor2 microplate reader (PerkinElmer, Waltham, MA, USA).

Apoptosis assay

This assay was carried out using the Cell Meter™ Annexin V Binding Apoptosis Assay Kit (AAT Bioquest^®, Sunnyvale, CA, USA) following the manufacturer’s instructions. Annexin V-iFluor ™ 647 binding was quantified using a BD FACSCalibur flow cytometer (BD Biosciences, Franklin Lakes, NJ, USA).

Statistical analysis

Statistical analysis was performed using GraphPad Prism 8.0.2 (GraphPad, San Diego, CA, USA), and results are presented as mean ± standard deviation (SD). Significant differences between groups were assessed using one-way analysis of variance followed by Dunnett’s post-hoc test, with statistical significance set at P < 0.05.

RESULTS

A2E and blue light activate the UV response and p53 pathway in ARPE-19 cells

In the present study, we used a model of blue light-induced ARPE-19 cytotoxicity. To create conditions that mimicked the accumulation of intracellular drusen with age, ARPE-19 cells were treated with A2E (25 µM) three times at 2-day intervals to induce sufficient accumulation of A2E (Shin et al., 2023). Blue light or A2E alone had no effect on ARPE-19 cells; however, blue light treatment significantly increased cell death in A2E-laden cells (Fig. 1A). RNA was isolated from cells treated with the above conditions and used for RNA-seq. DEGs with an absolute FC value ≥ 1.5 and a false discovery rate ≤ 0.05 were identified. Compared to the untreated control group, only one DEG was identified in the group treated with A2E alone. In contrast, 148 genes (101 upregulated and 47 downregulated) were differentially expressed in the group treated with A2E and with blue light (Fig. 1B). MSigDB analysis was performed to identify the biological pathways affected by A2E and blue light in ARPE-19 cells. The NF-κB signaling pathway, which was the most significantly affected by A2E and blue light, has been extensively reported previously (Shin and Jeong, 2022; Jin and Jeong, 2022; Shin et al., 2022). We observed that the UV response and p53 pathway genes were significantly increased upon A2E and blue light treatments (Fig. 1C). Individual DEGs belonging to the p53 pathway (adjusted P = 3.16E-06), UV response (adjusted P = 2.36E-05), and apoptosis (adjusted P = 1.45E-04) were significantly altered by A2E and blue light (Fig. 1D). These results suggest that blue light specifically and significantly activates the UV response and p53 pathway in A2E-rich ARPE-19 cells.

Fig. 1

A2E and blue light activate the UV response and p53 pathway in A2E-laden human retinal pigment epithelial (ARPE-19) cells. (A) Cell death of ARPE-19 cells treated with A2E and blue light. (B) Differentially expressed gene (DEGs) (101 upregulated and 47 downregulated) were identified by RNA-seq of ARPE-19 cells treated with A2E or A2E + blue light. |FC| ≥ 1.5.0, Q < 0.05. (C) Bar charts of potential signaling pathways generated using DEGs identified in ARPE-19 cells treated with A2E + blue light. Pathway analysis was performed using MSigDB. (D) Heat map of genes involved in the p53 pathway, UV response, and apoptosis of ARPE-19 cells treated with A2E + blue light.

Activation of JUN-mediated transcription by blue light in ARPE-19 cells

Based on the above results, we aimed to identify the upstream transcription factors responsible for the activation of the UV response and p53 signaling pathways. We predicted the regulatory factors of these DEGs using in-silico analysis. ATF3 (adjusted P = 6.90E-13), JUN (adjusted P = 1.04E-11), RELA (adjusted P =3.54E-11), and NFKB1 (adjusted P = 6.08E-10) were identified as upstream regulators (Fig. 2A). Here, we focused on JUN. Depending on their combination with other transcription factors, JUN proteins mediate various downstream cascades. AP-1, a heterodimer of JUN and FOS (Karin et al., 1997), is regulated by the MAPK pathway; while the JNK pathway controls cell survival and apoptosis through JUN phosphorylation in response to tumor necrosis factor-α, UV light, and stress (Minden and Karin, 1997; Reinhard et al., 1997; Dérijard et al., 1994). Next, to validate in-silico results, we evaluated the effect of A2E+blue light treatment on representative AP-1 target genes using RT-qPCR in ARPE-19 cells. FOS, JUN, ATF3, MT2A, DUSP5, TRIB1, TRIB3, and GEM showed no change in expression after A2E or blue light treatment alone; however, their expression was significantly increased upon combined treatment (Fig. 2B). These results suggest that blue light promotes AP-1-mediated transcriptional processes in A2E-laden ARPE-19 cells.

Fig. 2

Activation of JUN-mediated transcription by blue light in ARPE-19 cells. (A) In silico analysis of upstream transcription factors regulating the expression of DEGs affected by A2E + blue light treatment in ARPE-19 cells. (B) Validation of RNA-seq results. RT-qPCR was performed to measure the mRNA expression of JUN target genes in ARPE-19 cells treated with A2E, blue light or A2E + blue light, compared to the untreated control. The mRNA levels were normalized against 18S rRNA. Results are presented as the mean ± SD (n = 3), ** P < 0.01, *** P < 0.001 vs no-treatment control. FOS, Fos proto-oncogene; JUN, Jun proto-oncogene; ATF3, activating transcription factor 3; MT2A, metallothionein 2A; DUSP5, dual specificity phosphatase 5; TRIB1, tribbles pseudokinase 1; TRIB3, tribbles pseudokinase 3; GEM, GTP binding protein overexpressed in skeletal muscle.

Blue light activates AP-1 signaling via JNK in A2E-laden ARPE-19 cells

Proteins known to be upstream regulators of the AP-1 transcriptional pathway include ERK1/2, JUN, and p38, which are activated by growth factors, cytokines, and oxidative stressors. When A2E-laden ARPE-19 cells were exposed to blue light, an increase in phosphorylated JUN and JNK, the upstream regulator of JUN, was observed (Fig. 3A). Instead, ERK1/2 phosphorylation remained unchanged. Reactive oxygen species and UV light induce cell cycle arrest via AKT inhibition (Strozyk and Kulms, 2013). Here, combined A2E and blue light treatment did not affect AKT phosphorylation. These results suggest that AP-1 signaling triggered by A2E+blue light proceeds via the JUN pathway. To confirm the activation of AP-1 signaling by A2E and blue light exposure, the expression of a reporter gene containing an AP-1 binding element in the promoter region was verified. Combined treatment significantly increased luciferase expression in ARPE-19 cells (Fig. 3B). In addition, treatment with the JNK inhibitor SP600125 rescues the reduced cell viability caused by blue light exposure in A2E-laden ARPE-19 cells (Fig. 3C). These results suggest that blue light induces AP-1 signaling via JNK in A2E-laden ARPE-19 cells.

Fig. 3

Blue light activates AP-1 signaling and apoptosis in A2E-laden ARPE-19 cells. (A) ARPE-19 cells were treated with A2E alone or A2E + blue light, and the level of p-JNK, p-JUN, p-ERK1/2, and p-AKT proteins was measured by Western immunoblotting. β-Actin was used as an internal control. Representative image shown from three independent experiments (B) Untreated control cells or A2E-laden ARPE-19 cells were transfected with an AP-1 luciferase reporter plasmid. Cells were grown for 24 hr and then exposed to blue light. The luciferase activity of transfected cell extracts was determined by a luminometer. (C) Recovery of blue light-induced reduction in cell viability in A2E-laden ARPE-19 cells by treatment with the JNK inhibitor SP600125. Results are presented as the mean ± SD (n = 3), ** P < 0.01 vs no-treatment control (CTR) assessed using one-way ANOVA followed by Dunnett’s post-hoc test. (D) ARPE-19 cells were treated with A2E alone or A2E + blue light, and the levels of BCL2 and BAX proteins were measured. β-Actin was used as an internal control. (E) ARPE-19 cells were treated with A2E alone or A2E + blue light, and the levels of pro-caspase 3 (pro-CASP3), pro-PARP, and cleaved-PARP (cl-PARP) proteins were measured. β-Actin was used as an internal control. (F) Annexin V assay results following A2E + blue light treatment.

Induction of apoptosis by A2E and blue light in ARPE-19 cells

AP-1 activation via JUN by external stimuli regulates the expression of anti-apoptotic proteins such as the BCL2 family, thereby determining cell death and survival (Zhang et al., 2009; Kang et al., 1998). Therefore, we investigated the effect of A2E+blue light treatment on BCL2 protein expression. A2E treatment alone did not yield any change; however, when co-treated with blue light, the level of BCL2 decreased, whereas the intracellular BAX, an apoptotic protein, increased (Fig. 3D). Exposure of A2E-laden ARPE-19 cells to blue light induced the activation of caspase-3 (decreasing the level of pro-caspase-3) and promoted the cleavage of PARP (Fig. 3E). The increase in apoptosis in ARPE-19 cells following A2E+blue light treatment was confirmed by flow cytometry using the Annexin V assay (Fig. 3F). Taken together, our results suggest that blue light exposure to A2E-laden ARPE-19 cells triggers AP-1 signaling through JNK activation, ultimately leading to apoptosis.

DISCUSSION

Our results provide novel insights into the cellular stress response and apoptotic mechanism triggered by blue light exposure in A2E-laden ARPE-19 cells, thereby enhancing our understanding of the pathophysiology of age-related retinal diseases, particularly AMD. Based on the premise of age-related changes, such as A2E accumulation, this study suggests a molecular mechanism whereby cell damage caused by blue light goes beyond simple phototoxicity and activates existing intracellular stress response pathways (e.g., UV response and p53 pathways). In addition, this study elucidated the complex interplay between stress signals and cell survival/death by linking enhanced expression of apoptosis-related proteins, such as BCL2, BAX, and PARP, with cell death upon the blue light and A2E treatment. These insights provide important clues for the identification of molecular targets involved in the prevention, diagnosis, and treatment of retinal damage and AMD. In addition, given the growing exposure to blue light from smart devices, this study can guide the development of preventive and management strategies to alleviate damage from the ensuing retinal diseases. It is noteworthy that the intensity of blue light used in our experiments was 8,000 lux, which is significantly higher than that of LED lighting (125–350 lux). However, it is known that blue light from direct sunlight on a clear day can exceed 25,000 lux (de Gálvez et al., 2022). In particular, it provides a warning about retinal damage that may occur when combining chronic exposure to blue light with aging.

This study revealed the main molecular mechanisms of AMD and similar diseases using an in vitro rather than in vivo model. Nevertheless, the findings provide the basis for future research, guiding expansion towards in vivo and clinical studies. Indeed, further verification using various retinal damage models and actual patient data could lead to broader clinical applications and breakthroughs in treatment. In addition, although this study focused primarily on the roles of JUN and JNK in relation to AP-1 signaling, other stress response pathways, such as NF-κB and hypoxia, appear to be activated simultaneously following blue light exposure. Therefore, additional in-depth studies are required to elucidate the interactions and synergies between these pathways.

ACKNOWLEDGMENTS

This work was supported by the Basic Science Research Program of the National Research Foundation of Korea (NRF), funded by the Ministry of Education, under Grants NRF-2020R1A6A1A03043708, and RS-2023-00248378.

Conflict of interest

The authors declare that there is no conflict of interest.

REFERENCES

•  Bian,  Q.,  Gao,  S.,  Zhou,  J.,  Qin,  J.,  Taylor,  A.,  Johnson,  E.J.,  Tang,  G.,  Sparrow,  J.R.,  Gierhart,  D. and  Shang,  F. (2012): Lutein and zeaxanthin supplementation reduces photooxidative damage and modulates the expression of inflammation-related genes in retinal pigment epithelial cells. Free Radic. Biol. Med., 53, 1298-1307.
•  Black,  A.T.,  Gordon,  M.K.,  Heck,  D.E.,  Gallo,  M.A.,  Laskin,  D.L. and  Laskin,  J.D. (2011): UVB light regulates expression of antioxidants and inflammatory mediators in human corneal epithelial cells. Biochem. Pharmacol., 81, 873-880.
•  Cavigelli,  M.,  Dolfi,  F.,  Claret,  F.X. and  Karin,  M. (1995): Induction of c-fos expression through JNK-mediated TCF/Elk-1 phosphorylation. EMBO J., 14, 5957-5964.
•  Choudhury,  S.,  Ghosh,  S.,  Gupta,  P.,  Mukherjee,  S. and  Chattopadhyay,  S. (2015): Inflammation-induced ROS generation causes pancreatic cell death through modulation of Nrf2/NF-κB and SAPK/JNK pathway. Free Radic. Res., 49, 1371-1383.
•  de Gálvez,  E.N.,  Aguilera,  J.,  Solis,  A.,  de Gálvez,  M.V.,  de Andrés,  J.R.,  Herrera-Ceballos,  E. and  Gago-Calderon,  A. (2022): The potential role of UV and blue light from the sun, artificial lighting, and electronic devices in melanogenesis and oxidative stress. J. Photochem. Photobiol. B, 228, 112405.
•  Dérijard,  B.,  Hibi,  M.,  Wu,  I.H.,  Barrett,  T.,  Su,  B.,  Deng,  T.,  Karin,  M. and  Davis,  R.J. (1994): JNK1: a protein kinase stimulated by UV light and Ha-Ras that binds and phosphorylates the c-Jun activation domain. Cell, 76, 1025-1037.
•  Hayakawa,  J.,  Depatie,  C.,  Ohmichi,  M. and  Mercola,  D. (2003): The activation of c-Jun NH2-terminal kinase (JNK) by DNA-damaging agents serves to promote drug resistance via activating transcription factor 2 (ATF2)-dependent enhanced DNA repair. J. Biol. Chem., 278, 20582-20592.
•  Jeong,  K.W.,  Lee,  Y.H. and  Stallcup,  M.R. (2009): Recruitment of the SWI/SNF chromatin remodeling complex to steroid hormone-regulated promoters by nuclear receptor coactivator flightless-I. J. Biol. Chem., 284, 29298-29309.
•  Jeong,  S.Y.,  Gu,  X. and  Jeong,  K.W. (2019): Photoactivation of N-retinylidene-N-retinylethanolamine compromises autophagy in retinal pigmented epithelial cells. Food Chem. Toxicol., 131, 110555.
•  Jin,  H.L.,  Choung,  S.Y. and  Jeong,  K.W. (2017): Protective mechanisms of polyphenol-enriched fraction of Vaccinium uliginosum L. Against blue light-induced cell death of human retinal pigmented epithelial cells. J. Funct. Foods, 39, 28-36.
•  Jin,  H.L. and  Jeong,  K.W. (2022): Transcriptome Analysis of Long-Term Exposure to Blue Light in Retinal Pigment Epithelial Cells. Biomol. Ther. (Seoul), 30, 291-297.
•  Kang,  C.D.,  Jang,  J.H.,  Kim,  K.W.,  Lee,  H.J.,  Jeong,  C.S.,  Kim,  C.M.,  Kim,  S.H. and  Chung,  B.S. (1998): Activation of c-jun N-terminal kinase/stress-activated protein kinase and the decreased ratio of Bcl-2 to Bax are associated with the auto-oxidized dopamine-induced apoptosis in PC12 cells. Neurosci. Lett., 256, 37-40.
•  Karin,  M.,  Liu,  Zg. and  Zandi,  E. (1997): AP-1 function and regulation. Curr. Opin. Cell Biol., 9, 240-246.
•  Kuleshov,  M.V.,  Jones,  M.R.,  Rouillard,  A.D.,  Fernandez,  N.F.,  Duan,  Q.,  Wang,  Z.,  Koplev,  S.,  Jenkins,  S.L.,  Jagodnik,  K.M.,  Lachmann,  A.,  McDermott,  M.G.,  Monteiro,  C.D.,  Gundersen,  G.W. and  Ma’ayan,  A. (2016): Enrichr: a comprehensive gene set enrichment analysis web server 2016 update. Nucleic Acids Res., 44 (W1), W90-W97.
•  Lee,  J.R. and  Jeong,  K.W. (2022): NMDA Receptor Antagonists Degrade Lipofuscin via Autophagy in Human Retinal Pigment Epithelial Cells. Medicina (Kaunas), 58, 1129.
•  Lee,  J.R. and  Jeong,  K.W. (2023): N-retinylidene-N-retinylethanolamine degradation in human retinal pigment epithelial cells via memantine- and ifenprodil-mediated autophagy. Korean J. Physiol. Pharmacol., 27, 449-456.
•  Lee,  K.W.,  Lee,  D.J.,  Lee,  J.Y.,  Kang,  D.H.,  Kwon,  J. and  Kang,  S.W. (2011): Peroxiredoxin II restrains DNA damage-induced death in cancer cells by positively regulating JNK-dependent DNA repair. J. Biol. Chem., 286, 8394-8404.
•  Lei,  L.,  Tzekov,  R.,  Li,  H.,  McDowell,  J.H.,  Gao,  G.,  Smith,  W.C.,  Tang,  S. and  Kaushal,  S. (2017): Inhibition or Stimulation of Autophagy Affects Early Formation of Lipofuscin-Like Autofluorescence in the Retinal Pigment Epithelium Cell. Int. J. Mol. Sci., 18, 728.
•  Liang,  Y.Y.,  Zheng,  L.S.,  Wu,  Y.Z.,  Peng,  L.X.,  Cao,  Y.,  Cao,  X.,  Xie,  P.,  Huang,  B.J. and  Qian,  C.N. (2014): RASSF6 promotes p21(Cip1/Waf1)-dependent cell cycle arrest and apoptosis through activation of the JNK/SAPK pathway in clear cell renal cell carcinoma. Cell Cycle, 13, 1440-1449.
•  Liu,  B.,  Yu,  H.M.,  Huang,  J. and  Hsu,  W. (2008): Co-opted JNK/SAPK signaling in Wnt/beta-catenin-induced tumorigenesis. Neoplasia, 10, 1004-1013.
•  Minden,  A. and  Karin,  M. (1997): Regulation and function of the JNK subgroup of MAP kinases. Biochim. Biophys. Acta, 1333, F85-F104.
•  Mitchell,  P.,  Liew,  G.,  Gopinath,  B. and  Wong,  T.Y. (2018): Age-related macular degeneration. Lancet, 392, 1147-1159.
•  Moon,  J.,  Yun,  J.,  Yoon,  Y.D.,  Park,  S.I.,  Seo,  Y.J.,  Park,  W.S.,  Chu,  H.Y.,  Park,  K.H.,  Lee,  M.Y.,  Lee,  C.W.,  Oh,  S.J.,  Kwak,  Y.S.,  Jang,  Y.P. and  Kang,  J.S. (2017): Blue light effect on retinal pigment epithelial cells by display devices. Integr. Biol. (Camb.), 9, 436-443.
•  Nishina,  H.,  Wada,  T. and  Katada,  T. (2004): Physiological roles of SAPK/JNK signaling pathway. J. Biochem., 136, 123-126.
•  Reinhard,  C.,  Shamoon,  B.,  Shyamala,  V. and  Williams,  L.T. (1997): Tumor necrosis factor alpha-induced activation of c-jun N-terminal kinase is mediated by TRAF2. EMBO J., 16, 1080-1092.
•  Shin,  C.Y. and  Jeong,  K.W. (2022): Photooxidation of A2E by Blue Light Regulates Heme Oxygenase 1 Expression via NF-κB and Lysine Methyltransferase 2A in ARPE-19 Cells. Life (Basel), 12, 1698.
•  Shin,  C.Y.,  Lee,  M.H.,  Kim,  H.M.,  Chung,  H.C.,  Kim,  D.U.,  Lee,  J.H. and  Jeong,  K.W. (2022): Protective Effect of Ribes nigrum Extract against Blue Light-Induced Retinal Degeneration In Vitro and In Vivo. Antioxidants, 11, 832.
•  Shin,  C.Y.,  Lee,  S.,  Jin,  H.L.,  Fei,  X.,  Kang,  S.W.,  Seo,  S.Y. and  Jeong,  K.W. (2023): A small molecule compound that inhibits blue light-induced retinal damage via activation of autophagy. Biochem. Pharmacol., 211, 115534.
•  Shu,  J.,  Hitomi,  M. and  Stacey,  D. (1996): Activation of JNK/SAPK pathway is not directly inhibitory for cell cycle progression in NIH3T3 cells. Oncogene, 13, 2421-2430.
•  Silvers,  A.L.,  Bachelor,  M.A. and  Bowden,  G.T. (2003): The role of JNK and p38 MAPK activities in UVA-induced signaling pathways leading to AP-1 activation and c-Fos expression. Neoplasia, 5, 319-329.
•  Sparrow,  J.R.,  Parish,  C.A.,  Hashimoto,  M. and  Nakanishi,  K. (1999): A2E, a lipofuscin fluorophore, in human retinal pigmented epithelial cells in culture. Invest. Ophthalmol. Vis. Sci., 40, 2988-2995.
•  Sparrow,  J.R.,  Zhou,  J.,  Ben-Shabat,  S.,  Vollmer,  H.,  Itagaki,  Y. and  Nakanishi,  K. (2002): Involvement of oxidative mechanisms in blue-light-induced damage to A2E-laden RPE. Invest. Ophthalmol. Vis. Sci., 43, 1222-1227.
•  Strozyk,  E. and  Kulms,  D. (2013): The role of AKT/mTOR pathway in stress response to UV-irradiation: implication in skin carcinogenesis by regulation of apoptosis, autophagy and senescence. Int. J. Mol. Sci., 14, 15260-15285.
•  Tanos,  T.,  Marinissen,  M.J.,  Leskow,  F.C.,  Hochbaum,  D.,  Martinetto,  H.,  Gutkind,  J.S. and  Coso,  O.A. (2005): Phosphorylation of c-Fos by members of the p38 MAPK family. Role in the AP-1 response to UV light. J. Biol. Chem., 280, 18842-18852.
•  Westlund,  B.S.,  Cai,  B.,  Zhou,  J. and  Sparrow,  J.R. (2009): Involvement of c-Abl, p53 and the MAP kinase JNK in the cell death program initiated in A2E-laden ARPE-19 cells by exposure to blue light. Apoptosis, 14, 31-41.
•  Wu,  Y.,  Yanase,  E.,  Feng,  X.,  Siegel,  M.M. and  Sparrow,  J.R. (2010): Structural characterization of bisretinoid A2E photocleavage products and implications for age-related macular degeneration. Proc. Natl. Acad. Sci. USA, 107, 7275-7280.
•  Xie,  Z.,  Bailey,  A.,  Kuleshov,  M.V.,  Clarke,  D.J.,  Evangelista,  J.E.,  Jenkins,  S.L.,  Lachmann,  A.,  Wojciechowicz,  M.L.,  Kropiwnicki,  E.,  Jagodnik,  K.M.,  Jeon,  M. and  Ma’ayan,  A. (2021): Gene Set Knowledge Discovery with Enrichr. Curr. Protoc., 1, e90.
•  Zhang,  J. and  Bowden,  G.T. (2012): Activation of p38 MAP kinase and JNK pathways by UVA irradiation. Photochem. Photobiol. Sci., 11, 54-61.
•  Zhang,  Y.X.,  Kong,  C.Z.,  Wang,  H.Q.,  Wang,  L.H.,  Xu,  C.L. and  Sun,  Y.H. (2009): Phosphorylation of Bcl-2 and activation of caspase-3 via the c-Jun N-terminal kinase pathway in ursolic acid-induced DU145 cells apoptosis. Biochimie, 91, 1173-1179.