Expression profiles of purinergic P1 and P2 receptors in cultured bovine aortic endothelial cells, bovine aortic smooth muscle cells, and human vascular endothelial EA.hy926 cells

Abstract

Purinergic signaling plays an important role in vascular biology by vascular tone, inflammation, and remodeling through extracellular nucleotides that activate the P1 and P2 receptors. However, the expression patterns of these receptors in commonly used vascular cell models are not well characterized. In this study, we examined purinergic receptor expression in bovine aortic endothelial cells (BAECs), bovine aortic smooth muscle cells (BASMCs), and human vascular endothelial EA.hy926 cells. In BAECs, ADORA2A, ADORA2B, P2X4R, P2X7R, P2Y1R, P2Y2R, P2Y4R, P2Y6R, and P2Y11R were expressed, whereas the other purinergic receptors were not. BASMCs expressed ADORA2A, ADORA2B, P2X4R, P2X5R, P2Y1R, P2Y2R, P2Y6R, and P2Y11R. EA.hy926 cells expressed ADORA2A, ADORA2B, P2X4R, P2Y2R, P2Y6R, and P2Y11R. These results showed distinct expression profiles of purinergic receptors across different cell types. BAECs exhibited a purinergic receptor expression pattern similar to that of primary human vascular endothelial cells, suggesting that BAECs are a suitable model for studying purinergic signaling in vascular endothelial cells.

INTRODUCTION

Vascular function is controlled by the interactions between vascular endothelial cells and vascular smooth muscle cells, which constitute the structural and functional core of the vascular wall (Li et al., 2018). Vascular endothelial cells cover the luminal surface of blood vessels and regulate vascular tone, hemostasis, inflammation, and angiogenesis by releasing various autocrine and paracrine factors (Cines et al., 1998). Vascular smooth muscle cells, which are located within the medial layer, regulate vessel caliber and peripheral resistance through a contractile-relaxant response, while also contributing to vascular remodeling and pathological conditions (Owens et al., 2004).

Among the signaling pathways that coordinate vascular endothelial cell–vascular smooth muscle cell crosstalk, purinergic signaling is a pivotal modulator. Extracellular nucleotides like ATP, ADP and adenosine act on purinergic receptors, which are divided into two main families: P1 receptors are adenosine activated G-protein-coupled receptors, also known as adenosine receptors (ADOR), and P2 receptors include ionotropic P2X receptors (P2XR, ligand-gated cation channels) and G-protein-coupled P2Y receptors (P2YR) subfamilies that are widely expressed in vascular endothelial cells and vascular smooth muscle cells (Wang et al., 2002). Activation of endothelial P2Y2R and P2X4R promotes nitric oxide-dependent vasodilation, whereas the stimulation of P2X1R in vascular smooth muscle cells elicits vasoconstriction (Ralevic and Burnstock, 1998). In addition to tone regulation, purinergic receptors influence vascular permeability, proliferation, inflammation, and mechanotransduction (Burnstock and Verkhratsky, 2012; Erlinge and Burnstock, 2008).

Despite the recognized importance of purinergic signaling, a systematic comparison of purinergic receptor expression in widely used in vitro vascular models is lacking. Primary bovine aortic endothelial cells (BAECs) and bovine aortic smooth muscle cells (BASMCs) are popular owing to their phenotypic homogeneity and ease of cultivation (Schwartz, 1978; Absher et al., 1989). The immortalized human endothelial hybrid line EA.hy926, generated by the fusion of human umbilical vein endothelial cells (HUVECs) with A549 cells, retains key endothelial characteristics, including von Willebrand factor expression and tube-forming capacity (Edgell et al., 1983). However, the suitability of these cells as models for purinergic signaling, particularly with respect to receptor expression and function, has not been rigorously assessed.

In the present study, we investigated the expression profiles of purinergic receptors in cultured BAECs, BASMCs, and EA.hy926 cells. By identifying cell type-specific and species-specific expression patterns, the present study provides a rational basis for selecting appropriate in vitro models for mechanistic and toxicological research into purinergic regulation of vascular function.

MATERIALS AND METHODS

Materials

BAECs and BASMCs were purchased from Cell Applications (San Diego, CA, USA). EA.hy926 cells were purchased from the American Type Culture Collection (Manassas, VA, USA). Dulbecco’s modified Eagle’s medium (DMEM) and calcium- and magnesium-free phosphate-buffered saline (CMF-PBS) were purchased from Nissui Pharmaceutical (Tokyo, Japan). Fetal bovine serum, Opti-MEM Reduced Serum Medium, and High-Capacity complementary DNA (cDNA) Reverse Transcription Kit were purchased from Thermo Fisher Scientific (Waltham, MA, USA). Tissue culture dishes and plates were purchased from Nippon Genetics (Tokyo, Japan). GeneAce SYBR qPCR Mixα was purchased from Nippon Gene (Tokyo, Japan). Polyvinyl difluoride membrane (0.2 μm pore size) was purchased from Cytiva (Marlborough, MA, USA). Rabbit polyclonal anti-P2X4R antibody (APR-002), rabbit polyclonal anti-P2X7R antibody (APR-004), rabbit polyclonal anti-P2Y1R antibody (APR-009), and rabbit polyclonal anti-P2Y2R antibody (APR-010) were purchased from Alomone Labs (Jerusalem, Israel). The rabbit polyclonal anti-adenosine A2b receptor antibody (AB1589P) was purchased from Sigma-Aldrich (St. Louis, MO, USA). Horseradish peroxidase-conjugated anti-rabbit IgG antibody (#7074) was purchased from Cell Signaling Technology (Danvers, MA, USA). Chemi-Lumi One Super, Protein Assay BCA Kit, Coomassie brilliant blue R-250, and other reagents were purchased from Nacalai Tesque (Kyoto, Japan).

Cell culture and treatment

BAECs, BASMCs, and EA.hy926 cells were cultured in 5% carbon dioxide at 37°C in DMEM supplemented with 10% fetal bovine serum until confluence. The cells were then washed twice with serum-free DMEM and incubated in serum-free DMEM for 24 hr in 60-mm dishes or 12-well culture plates.

Real-time reverse transcription-polymerase chain reaction (RT-PCR)

Confluent BAECs, BASMCs, and EA.hy926 cells were cultured in 12-well plates and incubated in serum-free DMEM for 24 hr. Following incubation, the conditioned medium was discarded, and the cell layers were washed twice with CMF-PBS before being lysed with 200 µL of ISOGEN II. The lysate was combined with 80 µL of deionized distilled water and incubated for 10 min. Samples were centrifuged at 12,000 × g for 10 min at 15°C, and 200 µL of the supernatant was collected and mixed with an equal volume of 2-propanol. After centrifugation at 20,000 × g for 5 min at 15°C, the supernatant was discarded. The resulting precipitate was resuspended in 1 mL of 75% ethanol and centrifuged at 20,000 × g for 5 min at 15°C, and the supernatant was discarded; this washing step was repeated twice. After discarding the ethanol, the samples were dried and dissolved in 10 µL of deionized distilled water. The total RNA concentration was measured using a NanoDrop Spectrophotometer (Thermo Fisher Scientific). cDNA was synthesized using a High-Capacity CDNA Reverse Transcription Kit. Quantitative real-time PCR was performed using GeneAce SYBR qPCR Mixα with 4 ng of cDNA and gene-specific primers on a StepOnePlus Real-Time PCR System (Thermo Fisher Scientific). The thermal cycling protocol included an initial denaturation at 95°C for 10 min, followed by 40 cycles of 95°C for 30 sec and 60°C for 1 min. Genes with a threshold cycle (Ct) of > 35 were considered unexpressed. mRNA was quantified using the following formula: 2^(35-Ct). Sequences of the forward and reverse primers are provided in Tables 1 and 2. Primers specific to bovine genes and human P2Y8R were newly designed in the present study, while the other human primers were adopted from a previous report (Kashfi et al., 2017). Primer specificity was verified by melt curve analysis following real-time RT-PCR.

Table 1. Bovine gene-specific primers for quantitative real-time PCR.

Gene	Forward (5′→3′)	Reverse (5′→3′)	Amplicon size (bp)
ADORA1	AGCAGCTCAACAAGAAGGTG	TGCAGTTGAGGATGTGCAAG	141
ADORA2A	AACTGCCTTGCCTTCTGAAG	ATGGGACGAGCTTGAAACAC	92
ADORA2B	AATTGCCACCAACTGCACAG	ATGACCAGCATGATGAGCAG	156
ADORA3	ACGCCAACTCCATGATGAAC	AAGTCTGCTCAATGCTTGGG	135
P2X1R	AGGCACTTTGTGGAGAATGG	GATGTGGAGCAGAAGGAGGTC	186
P2X2R	TACATCGTGGAGCAGGCAGG	CGGAAGGAGTATTTGGGGTTG	131
P2X3R	ACAGCCGCCGATGTGAAG	TCCGAAACGCCGTCCAG	224
P2X4R	CGCCTCCTTCTGCCTGCC	ATGATGTCAAAGCGGATGCCA	168
P2X5R	GGTGTTCCTGGTGAAGAAGTGTTAC	GGTTGGTGATTACGAAGAAGACG	179
P2X6R	AACTTCAGGACAGCCACACATTG	GCAGCAGCAGGTCACAGAGG	196
P2X7R	CGCAGTCAATGAATACTACTACAAGAAGA	GGGTGAGTCGTGAAGAGACAGATG	220
P2Y1R	CTTCTACTACTTCAATAAGACCGACTG	TGCCCACCACCACGATG	224
P2Y2R	CTATGGCGTGGTGTGCGTG	GCAGTAAAGGTTGGTGTAGAAGAGG	241
P2Y4R	TTGTATGTCCTATCACTGCCCACTC	GCTACGACCAACCAAACTGCC	245
P2Y6R	GTCTACCGAGAGAACTTCAAGCACC	GGGAGCAGGCATACAGCAGG	181
P2Y8R	GACAACGCCACCATCCTGA	GCACGCCGAACACCCA	253
P2Y11R	CTGGTAGTTGAGTTTCTGGTGGC	GGCAGCGTCAGGGCGTA	146
P2Y12R	CGAGTGACAAGACTGTGAAGAAATG	CGGGCAAAATGGAATGGAA	268
P2Y13R	TGTTCTCCTCTCGCTGCC	GTTCTTGCTGTCCTTACTCT	231
P2Y14R	AACTCCTGTCGGTGCTGGTG	AGGTCACTCTTCAGGTCCATACA	121

Table 2. Human gene-specific primers for quantitative real-time PCR

Gene	Forward (5′→3′)	Reverse (5′→3′)	Amplicon size (bp)
ADORA1	CTTCTTTGTGTGGGTGCT	CTGCTTGCGGATTAGGTAG	79
ADORA2A	CCCAGAGGTGACATTTGAC	GCAGCCAGAGAGTGAAAG	87
ADORA2B	TCAGTAGTAGGCTCCAAG	ACCATAAACAAGGCAGAC	133
ADORA3	AAAGGCTGGGTATCGGCTGT	AAGGAGGCAAACGGGAGAAG	134
P2X1R	ATCTGTGCTCTCCGATGT	AGTTCAGCCGAGGAATTG	98
P2X2R	TGGGACTGTGACCTGGACCT	ACCTGAAGTTGTAGCCTGACGAG	106
P2X3R	CATCCTGCTCAACTTCCT	TTCAGCGTAGTCTCATTCA	78
P2X4R	CCTTCCCAACATCACCACTAC	GTCCTGCGTTCTCCACTATT	107
P2X5R	TGAATTGCCTCTGCTTACGTT	TCCGTCCTGATGACCCCA	197
P2X6R	CTTCTCTGGTGCTGTGAT	GGGATAGGGAGGTGGATTA	82
P2X7R	GCCACAACTACACCACGAGA	GCCCATTATTCCGCCCTGA	161
P2Y1R	GAATCTCCAAACACCTCTCTG	GAAAGCAAACCCAAACAAGC	175
P2Y2R	CTGGTAGCGAGAACACTAAGG	GCACAAGTCCTGGTCCTCTA	98
P2Y4R	GTGGAGCTGGACTGTTGGTT	ATAGGGTTGGGGCGTTAAGG	106
P2Y6R	AAACCATGCGGAGAATTAGAG	AGAAGGGGCTGAAGAAATAGTT	100
P2Y8R	CCTCTTCTCTCTGTGGGTGC	TTTGGAAAGGCAACACGCTG	116
P2Y11R	GACTGGAGACGCAAGAACA	CCTTGGCGACAGAAGACA	100
P2Y12R	GTAAGAACGAGGGGTGTAGG	GGTTTGGCTCAGGGTGTAAG	132
P2Y13R	GCCGACTTGATAATGACACT	TATGAGCCCTAACAGCACGAT	150
P2Y14R	TAGCCGCAACATATTCAGCATCG	GCAGCAGATAGTAGCAGAGTGA	165

Preparation of membrane protein samples

The membrane proteins were isolated as described by Suzuki et al. (2005). Briefly, BAECs, BASMCs, and EA.hy926 cells were cultured in 60-mm culture dishes and incubated in serum-free DMEM for 24 hr. After incubation, the cells were washed twice with CMF-PBS and collected in 1 mL of ice-cold CMF-PBS. The cell suspensions were centrifuged at 5,000 × g for 5 min, and the supernatant was removed. The resulting pellets were resuspended in 20 mM HEPES buffer containing 250 mM sucrose and 1 mM EDTA, followed by sonication on ice using an Ultrasonic Homogenizer NR-50M (MICROTEC, Chiba, Japan) with three cycles of 5-sec pulses and 5-sec rests. The homogenates were centrifuged at 5,000 × g for 5 min and the supernatants were transferred to fresh tubes for further centrifugation at 20,000 × g for 30 min. After discarding the supernatant, the pellets were lysed in 50 mM HEPES buffer (pH 7.5) containing 150 mM sodium chloride, 0.5% NP-40, 0.1 mM EGTA, and 0.1 mM EDTA, and then the lysates were used for western blot analysis as described below.

Western blot analysis

The membrane protein concentrations were measured using a bicinchoninic acid protein assay kit. For analysis, 32.9 mM Tris-HCl (pH 6.8), 13.2% glycerol, 1% sodium dodecyl sulfate, 0.005% bromophenol blue, and 10 mM dithiothreitol were added to the samples (10 µg protein), which were then incubated at 95°C for 10 min. Proteins were separated using sodium dodecyl sulfate-polyacrylamide gel electrophoresis on 10% gels and transferred to polyvinyl difluoride membranes (0.2 μm pore size) at 2 mA/cm² for 1 hr. The membranes were blocked for 1 hr in 0.5% bovine serum albumin prepared in a buffer containing 20 mM Tris-HCl (pH 7.5), 150 mM sodium chloride, and 0.1% Tween 20. The membranes were then incubated overnight at 4°C with primary antibodies (1:1000 dilution). After washing with buffer (20 mM Tris-HCl, 150 mM sodium chloride, and 0.1% Tween 20; pH 7.5), the membranes were treated with horseradish peroxidase-conjugated secondary antibodies (1:5000 dilution) for 1 hr at room temperature. Immunoreactive bands were visualized using Chemi-Lumi One Super and scanned using an LAS 3000 Imager (Fujifilm Wako Pure Chemical, Osaka, Japan). The antibodies for ADORA2B, P2X4R, P2X7R, P2Y1R, and P2Y2R used in this study have previously been reported to cross-react with bovine cells (Ramirez and Kunze, 2002; Soto et al., 2005; Tan-Allen et al., 2005), and their specificity was further verified in this study by siRNA-mediated knockdown of the corresponding receptors in BAECs (Fig. S1). For additional protein visualization, the lysates were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and stained with Coomassie brilliant blue solution containing 0.25% Coomassie brilliant blue R-250, 5% methanol, and 7.5% acetic acid for 30 min. Gels were destained overnight in a solution of 25% methanol and 7.5% acetic acid. Densitometric analysis of the protein bands was performed using ImageJ software (Schneider et al., 2012). Band intensities were quantified and normalized to the total lane intensity of Coomassie Brilliant Blue staining. The normalized values were then expressed relative to the BAEC sample, which was set to 1.All experiments were performed in triplicate.

Statistical analysis

Statistical analyses were conducted using the Dunn-Bonferroni test, with the significance threshold set at p < 0.05. All analyses were performed using Statcel4 software (OMS, Tokyo, Japan).

RESULTS

The mRNA expression profiles of the purinergic P1 and P2 receptors were analyzed in BAECs, BASMCs, and EA.hy926 cells. In BAECs (Fig. 1A), ADORA2A and ADORA2B mRNAs were detected in P1 receptor subtypes, whereas ADORA1 and ADORA3 were not expressed (Ct > 35). Within the P2X receptor family, P2X4R, P2X5R, and P2X7R mRNAs were present, whereas P2X1R, P2X2R, P2X3R, and P2X6R were not detected. For the P2Y receptors, P2Y1R, P2Y2R, P2Y4R, P2Y6R, and P2Y11R mRNAs were expressed, whereas P2Y8R, P2Y12R, P2Y13R, and P2Y14R were undetectable. BASMCs (Fig. 1B) also expressed several purinergic receptors found in BAECs: ADORA2A, ADORA2B, P2X4R, P2X5R, P2Y1R, P2Y2R, P2Y6R, and P2Y11R (Fig. 1B). EA.hy926 cells (Fig. 1C) also expressed a subset of receptors detected in BAECs, namely ADORA2A, ADORA2B, P2X4R, P2Y2R, P2Y6R, and P2Y11R, but did not express P2X5R and P2Y1R.

Fig. 1

mRNA expression of purinergic receptors in vascular endothelial and smooth muscle cells. [A] Bovine aortic endothelial cells (BAECs), [B] bovine aortic smooth muscle cells (BASMCs), and [C] human vascular endothelial EA.hy926 cells were incubated under serum-free conditions for 24 hr. mRNA levels of ADORA2A, ADORA2B, P2X4R, P2X5R, P2X7R, P2Y1R, P2Y2R, P2Y4R, P2Y6R, and P2Y11R were measured by real-time reverse transcription-polymerase chain reaction (RT-PCR). Data are presented as means ± standard error (SE) from three independent samples. N.D.: Not detected.

Of the ten purinergic receptors analyzed at the mRNA level by real-time RT-PCR (Fig. 1), five receptors that could be reliably detected at the protein level were further examined by Western blot analysis, which confirmed the differences in protein expression among the three cell types (Fig. 2). ADORA2B protein was more abundant in BASMCs and EA.hy926 cells than in BAECs. P2X4R protein expression was highest in BASMCs. In contrast, P2X7R protein was expressed in BAECs but was barely detectable in BASMCs and EA.hy926 cells. The P2Y1R protein was also highly expressed in BAECs, whereas the P2Y2R protein was the most abundant protein in BASMCs and was moderately expressed in BAECs and EA.hy926 cells.

Fig. 2

Protein expression of purinergic receptor in vascular endothelial and smooth muscle cells. BAECs, BASMCs, and EA.hy926 cells were incubated under serum-free conditions for 24 hr. Membrane protein levels of ADORA2B, P2X4R, P2X7R, P2Y1R, and P2Y2R were determined by western blot analysis. Band intensities were quantified and normalized to corresponding Coomassie brilliant blue (CBB) staining. Data are shown as means ± SE from three independent experiments. *p < 0.05; **p < 0.01 vs. BAEC.

DISCUSSION

In the present study, the expression patterns of purinergic P1 and P2 receptors in three commonly used vascular cell models, BAECs, BASMCs, and EA.hy926 cells were investigated and cell type- and species-specific characteristics relevant to purinergic signaling were identified. While comprehensive datasets on purinergic receptor expression in cultured human vascular endothelial cells remain limited, previous studies have reported the presence of ADORA2A, ADORA2B, P2X4R, P2X7R, and P2Y2R in human aortic endothelial cells and human coronary artery endothelial cells and ADORA2A, ADORA2B, P2X4R, P2X7R, P2Y1R, and P2Y2R in HUVECs (Ding et al., 2011; Feoktistov et al., 2002; Iwamoto et al., 1994; Olanrewaju et al., 2000; Schwiebert et al., 2002; Wang et al., 2002; Xiao et al., 2011; Yamamoto et al., 2006). In contrast, the present study suggests that BAECs express ADORA2B, P2X4R, P2Y1R, and P2Y2R at both mRNA and protein levels, closely reflecting the profiles of primary human vascular endothelial cells. Conversely, ADORA2A and P2X7R expression were low, suggesting that BAECs are not ideal for functional studies focusing on these receptors. Nonetheless, ADORA2B, P2X4R, P2Y1R, and P2Y2R expression support their use as models for studying the vascular endothelial purinergic pathways.

EA.hy926 cells are a hybrid cell line derived from HUVECs and A549 cells, a human lung carcinoma cell line. HUVECs are known to express purinergic receptors, such as ADORA2A, ADORA2B, P2Y1R, and P2Y2R (Feoktistov et al., 2002; Wang et al., 2002), whereas A549 cells express high levels of ADORA2B but lack P2Y1R expression (Communi et al., 1999; Sui et al., 2021). In the present study, EA.hy926 cells were found to express ADORA2A, ADORA2B, and P2Y2R but not P2Y1R, suggesting that their purinergic receptor profile reflects partial inheritance from both parental lines. The absence of P2Y1R expression, which is typically present in HUVECs, human pulmonary artery endothelial cells, and BAECs (Hennigs et al., 2019; Wang et al., 2002), indicated that EA.hy926 cells deviated from the standard vascular endothelial phenotype. Therefore, although EA.hy926 cells retain some key endothelial characteristics, their use in studying P2Y1R-mediated pathways may be limited. In contrast, BAECs consistently express P2Y1R, making BAECs an appropriate model for investigating P2Y1R-dependent endothelial functions. While EA.hy926 cells may be useful for investigating ADORA2B- and P2Y2R-mediated signaling, their limitations in modeling the complete endothelial purinergic receptor function should be considered.

ADORA2B expression has been reported in human aortic smooth muscle cells where it plays a role in regulating cell proliferation (Dubey et al., 2000; Peyot et al., 2000). P2X4R is also expressed in vascular smooth muscle cells (Nichols et al., 2014). In addition, cultured muscle cells express higher P2Y2R levels than native aortic media tissues do, and their expression is elevated in neointimal muscle cells (Seye et al., 1997). P2Y2R not only contributes to the maintenance of cytoskeletal proteins in contractile vascular smooth muscle cells, but also promotes proliferation and migration, likely through phenotypic switching, which is a key process involved in vascular remodeling and disease (Erlinge et al., 1993; Erlinge, 2004; Seye et al., 2003). Along with P2X4R and P2Y2R expression in BASMCs, ADORA2B expression aligns with the known features of vascular smooth muscle cells and supports the use of BASMCs as a relevant model for studying purinergic signaling under both physiological and pathological conditions.

In conclusion, this study highlights the distinct purinergic receptor profiles of BAECs, BASMCs, and EA.hy926 cells and their respective utilities and limitations as in vitro models for vascular research. BAECs are particularly well suited for studying ADORA2B-, P2X4R-, P2Y1R-, and P2Y2R-related endothelial functions. BASMCs are appropriate for investigating P2X4R and P2Y2R signaling in vascular smooth muscle, whereas EA.hy926 cells may be useful for exploring selected pathways involving ADORA2B and P2Y2R. Considering both the relative abundance of receptors within each cell type, the differences among human vascular endothelial subtypes, and the variations across species such as human and bovine cells is essential for selecting appropriate in vitro models and for accurately interpreting purinergic signaling.

ACKNOWLEDGMENTS

We would like to thank Editage (www.editage.com) for the English language editing.

Funding

This work was supported by JSPS KAKENHI Grant Numbers JP23K16312 and JP25K15460 (to T. F.).

Conflict of interest

The authors declare that there is no conflict of interest.

Data availability

The data in this study are included in the article/supplementary materials. Contact the corresponding author(s) directly to request the underlying data.

Author contributions

Conceptualization: M.T. and T.K.; Funding acquisition: M.T., T.F., and T.K.; Investigation: L.I., and K.K.; Supervision: F.U. and C.Y.; Visualization: L.I. K.K. and T.H.; Writing - original draft: L.I. and T.F.; Writing - review and editing: F.U, C.Y., M.T., and T.K.

Ethical approval and consento to participate

Not applicable.

Patient consent for publication

Not applicable.

REFERENCES

•  Absher,  M.,  Woodcock-Mitchell,  J.,  Mitchell,  J.,  Baldor,  L.,  Low,  R. and  Warshaw,  D. (1989): Characterization of vascular smooth muscle cell phenotype in long-term culture. In Vitro Cell. Dev. Biol., 25, 183-192.
•  Burnstock,  G. and  Verkhratsky,  A. (2012): Purinergic signaling. Wiley Interdiscip. Rev. Membr. Transp. Signal., 1, 116-125.
•  Cines,  D.B.,  Pollak,  E.S.,  Buck,  C.A.,  Loscalzo,  J.,  Zimmerman,  G.A.,  McEver,  R.P.,  Pober,  J.S.,  Wick,  T.M.,  Konkle,  B.A.,  Schwartz,  B.S.,  Barnathan,  E.S.,  McCrae,  K.R.,  Hug,  B.A.,  Schmidt,  A.M. and  Stern,  D.M. (1998): Endothelial cells in physiology and in the pathophysiology of vascular disorders. Blood, 91, 3527-3561.
•  Communi,  D.,  Paindavoine,  P.,  Place,  G.A.,  Parmentier,  M. and  Boeynaems,  J.M. (1999): Expression of P2Y receptors in cell lines derived from the human lung. Br. J. Pharmacol., 127, 562-568.
•  Ding,  L.,  Ma,  W.,  Littmann,  T.,  Camp,  R. and  Shen,  J. (2011): The P2Y(2) nucleotide receptor mediates tissue factor expression in human coronary artery endothelial cells. J. Biol. Chem., 286, 27027-27038.
•  Dubey,  R.K.,  Gillespie,  D.G.,  Shue,  H. and  Jackson,  E.K. (2000): A(2B) receptors mediate antimitogenesis in vascular smooth muscle cells. Hypertension, 35, 267-272.
•  Edgell,  C.J.,  McDonald,  C.C. and  Graham,  J.B. (1983): Permanent cell line expressing human factor VIII-related antigen established by hybridization. Proc. Natl. Acad. Sci. USA, 80, 3734-3737.
•  Erlinge,  D.,  Yoo,  H.,  Edvinsson,  L.,  Reis,  D.J. and  Wahlestedt,  C. (1993): Mitogenic effects of ATP on vascular smooth muscle cells vs. other growth factors and sympathetic cotransmitters. Am. J. Physiol., 265, H1089-H1097.
•  Erlinge,  D. (2004): Extracellular ATP: a central player in the regulation of vascular smooth muscle phenotype. Focus on “Dual role of PKA in phenotype modulation of vascular smooth muscle cells by extracellular ATP”. Am. J. Physiol. Cell Physiol., 287, C260-C262.
•  Erlinge,  D. and  Burnstock,  G. (2008): P2 receptors in cardiovascular regulation and disease. Purinergic Signal., 4, 1-20.
•  Feoktistov,  I.,  Goldstein,  A.E.,  Ryzhov,  S.,  Zeng,  D.,  Belardinelli,  L.,  Voyno-Yasenetskaya,  T. and  Biaggioni,  I. (2002): Differential expression of adenosine receptors in human endothelial cells: role of A2B receptors in angiogenic factor regulation. Circ. Res., 90, 531-538.
•  Hennigs,  J.K.,  Lüneburg,  N.,  Stage,  A.,  Schmitz,  M.,  Körbelin,  J.,  Harbaum,  L.,  Matuszcak,  C.,  Mienert,  J.,  Bokemeyer,  C.,  Böger,  R.H.,  Kiefmann,  R. and  Klose,  H. (2019): The P2-receptor-mediated Ca²⁺ signalosome of the human pulmonary endothelium - implications for pulmonary arterial hypertension. Purinergic Signal., 15, 299-311.
•  Iwamoto,  T.,  Umemura,  S.,  Toya,  Y.,  Uchibori,  T.,  Kogi,  K.,  Takagi,  N. and  Ishii,  M. (1994): Identification of adenosine A2 receptor-cAMP system in human aortic endothelial cells. Biochem. Biophys. Res. Commun., 199, 905-910.
•  Kashfi,  S.,  Peymani,  M.,  Ghaedi,  K.,  Baharvand,  H.,  Nasr-Esfahani,  M.H. and  Javan,  M. (2017): Purinergic Receptor Expression and Potential Association with Human Embryonic Stem Cell-Derived Oligodendrocyte Progenitor Cell Development. Cell J., 19, 386-402.
•  Li,  M.,  Qian,  M.,  Kyler,  K. and  Xu,  J. (2018): Endothelial-vascular smooth muscle cells interactions in atherosclerosis. Front. Cardiovasc. Med., 5, 151.
•  Nichols,  C.M.,  Povstyan,  O.V.,  Albert,  A.P.,  Gordienko,  D.V.,  Khan,  O.,  Vasilikostas,  G.,  Khong,  T.K.,  Wan,  A.,  Reddy,  M. and  Harhun,  M.I. (2014): Vascular smooth muscle cells from small human omental arteries express P2X1 and P2X4 receptor subunits. Purinergic Signal., 10, 565-572.
•  Olanrewaju,  H.A.,  Qin,  W.,  Feoktistov,  I.,  Scemama,  J.L. and  Mustafa,  S.J. (2000): Adenosine A(2A) and A(2B) receptors in cultured human and porcine coronary artery endothelial cells. Am. J. Physiol. Heart Circ. Physiol., 279, H650-H656.
•  Owens,  G.K.,  Kumar,  M.S. and  Wamhoff,  B.R. (2004): Molecular regulation of vascular smooth muscle cell differentiation in development and disease. Physiol. Rev., 84, 767-801.
•  Peyot,  M.L.,  Gadeau,  A.P.,  Dandré,  F.,  Belloc,  I.,  Dupuch,  F. and  Desgranges,  C. (2000): Extracellular adenosine induces apoptosis of human arterial smooth muscle cells via A(2b)-purinoceptor. Circ. Res., 86, 76-85.
•  Ralevic,  V. and  Burnstock,  G. (1998): Receptors for purines and pyrimidines. Pharmacol. Rev., 50, 413-492.
•  Ramirez,  A.N. and  Kunze,  D.L. (2002): P2X purinergic receptor channel expression and function in bovine aortic endothelium. Am. J. Physiol. Heart Circ. Physiol., 282, H2106-H2116.
•  Schneider,  C.A.,  Rasband,  W.S. and  Eliceiri,  K.W. (2012): NIH Image to ImageJ: 25 years of image analysis. Nat. Methods, 9, 671-675.
•  Schwartz,  S.M. (1978): Selection and characterization of bovine aortic endothelial cells. In Vitro, 14, 966-980.
•  Schwiebert,  L.M.,  Rice,  W.C.,  Kudlow,  B.A.,  Taylor,  A.L. and  Schwiebert,  E.M. (2002): Extracellular ATP signaling and P2X nucleotide receptors in monolayers of primary human vascular endothelial cells. Am. J. Physiol. Cell Physiol., 282, C289-C301.
•  Seye,  C.I.,  Gadeau,  A.P.,  Daret,  D.,  Dupuch,  F.,  Alzieu,  P.,  Capron,  L. and  Desgranges,  C. (1997): Overexpression of P2Y2 purinoceptor in intimal lesions of the rat aorta. Arterioscler. Thromb. Vasc. Biol., 17, 3602-3610.
•  Seye,  C.I.,  Yu,  N.,  Jain,  R.,  Kong,  Q.,  Minor,  T.,  Newton,  J.,  Erb,  L.,  González,  F.A. and  Weisman,  G.A. (2003): The P2Y2 nucleotide receptor mediates UTP-induced vascular cell adhesion molecule-1 expression in coronary artery endothelial cells. J. Biol. Chem., 278, 24960-24965.
•  Soto,  D.,  Pintor,  J.,  Peral,  A.,  Gual,  A. and  Gasull,  X. (2005): Effects of dinucleoside polyphosphates on trabecular meshwork cells and aqueous humor outflow facility. J. Pharmacol. Exp. Ther., 314, 1042-1051.
•  Sui,  Y.,  Liu,  J.,  Zhang,  J.,  Zheng,  Z.,  Wang,  Z.,  Jia,  Z. and  Meng,  Z. (2021): Expression and gene regulation network of adenosine receptor A2B in lung adenocarcinoma: a potential diagnostic and prognostic biomarker. Front. Mol. Biosci., 8, 663011.
•  Suzuki,  T.,  Ishihara,  K.,  Migaki,  H.,  Matsuura,  W.,  Kohda,  A.,  Okumura,  K.,  Nagao,  M.,  Yamaguchi-Iwai,  Y. and  Kambe,  T. (2005): Zinc transporters, ZnT5 and ZnT7, are required for the activation of alkaline phosphatases, zinc-requiring enzymes that are glycosylphosphatidylinositol-anchored to the cytoplasmic membrane. J. Biol. Chem., 280, 637-643.
•  Tan-Allen,  K.Y.,  Sun,  X.C. and  Bonanno,  J.A. (2005): Characterization of adenosine receptors in bovine corneal endothelium. Exp. Eye Res., 80, 687-696.
•  Wang,  L.,  Karlsson,  L.,  Moses,  S.,  Hultgårdh-Nilsson,  A.,  Andersson,  M.,  Borna,  C.,  Gudbjartsson,  T.,  Jern,  S. and  Erlinge,  D. (2002): P2 receptor expression profiles in human vascular smooth muscle and endothelial cells. J. Cardiovasc. Pharmacol., 40, 841-853.
•  Xiao,  Z.,  Yang,  M.,  Lv,  Q.,  Wang,  W.,  Deng,  M.,  Liu,  X.,  He,  Q.,  Chen,  X.,  Chen,  M.,  Fang,  L.,  Xie,  X. and  Hu,  J. (2011): P2Y11 impairs cell proliferation by induction of cell cycle arrest and sensitizes endothelial cells to cisplatin-induced cell death. J. Cell. Biochem., 112, 2257-2265.
•  Yamamoto,  K.,  Sokabe,  T.,  Matsumoto,  T.,  Yoshimura,  K.,  Shibata,  M.,  Ohura,  N.,  Fukuda,  T.,  Sato,  T.,  Sekine,  K.,  Kato,  S.,  Isshiki,  M.,  Fujita,  T.,  Kobayashi,  M.,  Kawamura,  K.,  Masuda,  H.,  Kamiya,  A. and  Ando,  J. (2006): Impaired flow-dependent control of vascular tone and remodeling in P2X4-deficient mice. Nat. Med., 12, 133-137.