The Journal of Toxicological Sciences
Online ISSN : 1880-3989
Print ISSN : 0388-1350
ISSN-L : 0388-1350
Original Article
Toxicological effects of Sb(III), Sb(V), and NMG-Sb(V) in human lung, kidney, and liver cells: cytotoxicity and fibrotic factor induction
Nicole RoldánMarcelo VerdugoNoriyuki SuzukiNatali ZamoraWaldo QuirozAlexis GonzalezJavier TognarelliYasumitsu Ogra
Author information
JOURNAL FREE ACCESS FULL-TEXT HTML

2025 Volume 50 Issue 6 Pages 283-292

Details
Abstract

Antimony ecotoxicity studies are often hindered by the incorrect selection of Sb(III) standards and the application of concentrations that do not reflect real environmental exposure. In this study, we used environmentally relevant concentrations of inorganic Sb in its pentavalent [Sb(V)] and trivalent [Sb(III)] oxidation states, as well as the organic species NMG-Sb(V), which is present in Meglumine Antimoniate, to evaluate the effects of Sb on cell viability in human lung (A549), kidney (HEK293), and liver (HepG2) cell lines. Cell viability was assessed in these cells following treatment with 0.001 to 1 µg/L of Sb(V), 1 to 500 µg/L of Sb(III), and 0 to 1000 mg/L of MA. We also measured ROS production and the expression of the profibrotic markers CTGF, α-SMA, and PAI-1, which are associated with fibrosis activation. No significant changes in cell viability were observed in HepG2 and A549 cells. However, in HEK293 cells, viability decreased by 20-40% at Sb(III) concentrations between 1 µg/L and 1 mg/L. CTGF expression was significantly increased at 17 µg/L of Sb(III), while α-SMA and PAI-1 expression increased at 21 µg/L of Sb(V). These findings suggest that different species of Sb can induce increased expression of mRNA for fibrotic genes in human liver and kidney cell lines at concentrations found in the environment.

INTRODUCTION

Antimony (Sb) and arsenic (As) are two metalloids that share physicochemical similarities influencing their toxicity and bioaccumulation in living organisms. Antimony exists primarily in two oxidation states: pentavalent [Sb(V)] and trivalent [Sb(III)]. Antimony III is known to be more toxic due to its ability to interact with cellular proteins and induce oxidative stress (Lösler et al., 2009). These elements can utilize similar cellular pathways for transport and accumulation, such as entry through aquaglyceroporin channels; however, their toxic behavior exhibits significant differences that must be considered in ecotoxicological studies (Verdugo et al., 2016).

Sb(III) tends to accumulate in protein-rich tissues, such as the liver and kidneys, due to its high affinity for thiol groups in proteins, forming stable covalent bonds with cysteine residues (Mann et al., 2006). This characteristic contributes to the prolonged toxicity of Sb(III) in these organs. Although Sb(V) is generally less toxic, it can be reduced to Sb(III) under certain cellular conditions, thus increasing its harmful potential (Lösler et al., 2009). Furthermore, Sb(III) has been associated with the induction of renal and hepatic fibrosis, as demonstrated by its promotion of profibrotic mediators such as PAI-1 and CTGF (Ogra et al., 2023; Verdugo et al., 2016, 2017).

As(III), particularly in its trioxide form (As2O3), has been widely studied for its carcinogenic effects and bioaccumulation in tissues similar to Sb. However, unlike Sb, As(III) possesses a higher capacity for inducing direct genetic damage, making it a more potent carcinogen (Zhang et al., 2023). As(III) interferes with various cellular pathways, including glutathione metabolism and ROS production, leading to the activation of signaling pathways associated with carcinogenesis (Maciaszczyk-Dziubinska et al., 2012).

Despite the similarities between Sb and As in terms of bioaccumulation pathways, their long-term health impacts differ. As(III) is more aggressive in genotoxicity and carcinogenicity, while Sb(III) appears more adept at inducing fibrotic changes and cellular damage without necessarily triggering malignant transformations (Roldán et al., 2020; Verdugo et al., 2016). These distinctions underscore the necessity of detailed mechanistic studies to understand the individual and combined effects of Sb and As in environmental toxicology.

Although As has been extensively studied for its genotoxic and carcinogenic effects (Jomova et al., 2011), Sb has received less attention despite its environmental presence and potential to induce fibrotic changes and cellular damage (Roldán et al., 2020). Sb is also present in therapeutic compounds such as Meglumine Antimoniate (MA), an organic Sb(V) complex widely used for the treatment of leishmaniasis (Roldán et al., 2019). However, its potential cytotoxic effects on human cells remain poorly understood, particularly in the kidney and liver, which are primary sites of Sb metabolism and elimination. This study focuses on Sb to address this knowledge gap, exploring its toxic effects and specific mechanisms in human cells, with an emphasis on cell viability and the activation of profibrotic markers.

The aim of this study was to evaluate the effect of inorganic Sb(V) and Sb(III) along with the organic species of MA on cell viability, ROS generation and expression of profibrotic markers α-SMA, CTGF and PAI-1 in human immortalized cell lines from lung, kidney and liver.

MATERIALS AND METHODS

Reagents and solutions

All solutions were made in high purity water (18 MΩ·cm) from a nano-pure system (Barnstead, Dubuque, IA, USA). For analysis molecular analysis and RNA extractions nuclease free water from Corning brand was used (Corning Incorporated, Corning, NY, USA). The plastic material was exposed to UV light before use. The glassware was cleaned with deionized water and then immersed in 10% (v/v) HNO3 and rinsed with deionized water prior to use. Standard solutions of Sb(V) were prepared using potassium hexahydroxo-antimonate KSb(OH)6 (99.95% purity, Sigma-Aldrich, St. Louis, MO, USA), while Sb(III) solutions were prepared using Sb2O3 (99.99% w/w, Sigma-Aldrich). Solutions were prepared in deionized water daily and stored in a plastic container at 4°C. In addition, the standard solution of Sb(III) used for cell line incubations was prepared using Sb2O3 (99.99% w/w from Sigma-Aldrich). The solutions of Sb(III) were prepared as described previously (Verdugo et al., 2016). The amount indicated (0.0200 g) of Sb2O3 (99.99%, Sigma-Aldrich) was prepared with 10 mL of deionized water and sonicated for 10 min, degassed with nitrogen gas for 10 min at 25°C in a thermal bath and at room temperature and filtrated in a 0.20 µm filter to prevent precipitation of saturated solution. This procedure leads to a solution of 2743 ± 77 µg of Sb L-1 with 96.0 ± 0.1% Sb(III) (n=5). This standard solution was prepared daily and stored at 4°C for later use and discarded at the end of the day of analysis and incubation. The acid used for the digestion was HNO3 (65% w/v, supra-pure grade, Merck, Darmstadt, Germany). Reducing agents used were KI (p. ISO Merck), ascorbic acid (C6H8O6; ACS ISO Merck), and NaBH4 (Merck Analytical Reactive Grade). Sb2O3, nitric acid, hydrogen peroxide, EDTA and potassium hexahydroxyantimonate were purchased from Wako Pure Chemicals Industries, Ltd. (Osaka, Japan). The solution of Sb2O3 was prepared daily according to the previously published method of Verdugo et al. (2017). Sb(V) was prepared from potassium antimoniate hexahydroxide and stored at 4°C (Kobayashi and Ogra, 2009). MA was synthesized following the method described by Demicheli et al. (2003), which involves the reaction of Sb(V) with MA under controlled temperature and pH conditions to form the pentavalent organoantimonial complex. The purity of MA was then analyzed, revealing a composition of 86% NMG-Sb(V) and 14% Sb(V), as determined by the analytical method described in the same study (Roldán et al., 2019).

Justification of different doses of Sb

We have previously reported the concentrations of Sb in human (Quiroz et al., 2009, 2013). We have converted concentrations in nanograms per gram of tissue in nanograms per liter according to blood density (1.06 g L-1). We tested the effect of Sb at different concentrations described in Table 1 that were described in environmental sources according to authors.

Table 1. Concentrations of Sb(V) and Sb(III) in high and low ranges based on blood sample analysis.

Total ng/g Sb(V) ng/g Sb(III) ng/g
High concentration 59 19.5 39.5
Low concentration 24 7.92 16.1
33.3% 66.7%
Conversion a μg μg/L
High and low concentration Sb(V) Sb(III)
Total dose μg/L 9 and 21 17 and 42

This table presents the concentrations of Sb(V) and Sb(III) found in blood samples, expressed in nanograms per gram (ng g−1) and converted to micrograms per liter (μg/L). The high and low concentration ranges are provided for both Sb species, based on environmental sources. The conversion from ng g−1 to μg/L is used for the incubation of cells in this study by blood density.

Cell culture

Cell lines of liver (HepG2), kidney (HEK293) and lung (A549) were purchased in RIKEN cell bank (Tsukuba, Ibaraki, Japan). The cells were seeded at 1 x 106 cells per well using Dulbecco’s modified Eagle medium (DMEM) with 10% FBS, dexamethasone 5M, a the mixture containing insulin-transferrin-selenium (Maker) and 100 U/mL of penicillin/streptomycin (P/S) at 5% CO2 and 37°C [40]. HepG2: DMEM 10% FBS, 1% penicillin; A549: DMEM, 10% FBS, 1% P/S; HEK293: MEM (Eagle’s minimal essential medium), 10% FBS, 1% P/S. Cells were incubated with Sb(V) and Sb(III) for 24 hr, according to the literature from low and high doses: Sb(V): 9 - 21 μg/L; Sb(III): 17 - 42 µg/L (Quiroz et al., 2009, 2013). All culture media and supplements, including DMEM, FBS, dexamethasone, insulin-transferrin-selenium, and penicillin/streptomycin, were obtained from Gibco (Thermo Fisher Scientific, Waltham, MA, USA).

Cell viability

Cell proliferation and viability assay was performed with kit CellTiter 96® Non-Radioactive Cell Proliferation Assay (Promega, Madison, WI, USA). The optical density ratio of the treated cells to the control gives the cell viability. Values are expressed as the mean ± SEM (standard error of the mean of 3 independent experiments (Riss et al., 2004; Stockert et al., 2018). Cells were incubated with Sb(V) and Sb(III) for 24 hr at concentrations of 0.001 to 1 µg/L for Sb(V) and 1 to 500 µg/L for Sb(III), based on environmentally relevant levels and their respective toxicological profiles. Since Sb(III) is significantly more toxic than Sb(V), a broader concentration range was used for Sb(III) to better assess its effects, while Sb(V) was tested at lower concentrations to reflect its environmental occurrence and lower biological reactivity.

Measurement of ROS in A549, HEK293 and HepG2

ROS production was measured in the same way as it was measured by Roldán et al. (2020). Briefly, the cells were plated in 96-well plates and were washed with sterile phosphate buffered-saline (PBS) and incubated with 25 μL of 25 μM DCFHDA for 30 min at 37°C and again washed with PBS. ROS production was measured with a fluorescence imager (FMBIO III; Hitachi, Yokohama, Japan). To normalize results, total protein from each well was quantified by the bicinchoninic acid (BCA) method. A positive control was conducted using 100 mM H2O2 (Roldán et al., 2020).

Analysis of mRNA levels for CTGF, PAI-1 and α-SMA transcripts

The cells were collected using a cell scrapper with 1 mL of ISOGEN II (Nippon Gene, Toyama, Japan), quantified by spectrophotometer and a 260/280 ratio close to 1.8 was obtained in all samples. Integrity was verified by 0.8% agarose gel. The cDNA was synthesized using the ReverTra Ace qPCR RT Master Mix kit (Toyobo, Osaka, Japan) and then each transcript was amplified and analyzed using quantitative polymerase reaction (q-PCR) with the Brilliant III Ultra-Fast SYBR Green QPCR Master Mix With Low ROX (Agilent Technologies, Santa Clara, CA, USA) probe, with the primers previously standardized. Primers used for QPCR amplification are described in Table 2.

Table 2. Primers and annealing temperatures for qPCR amplification of fibrotic and housekeeping genes.

Primer 5`-->3` Annealing Temperature ºC
PAI-1 FW CGGTCATTCCCAGGTTCTCT 60
RV TCTCTGCCCTCACCAACATT
CTGF FW GGCCCAGACCCAACTATGAT 60
RV TGGGAGTACGGATGCACTTT
α-SMA FW ACCCAGCACCATGAAGATCA 57
RV TTTGCGGTGGACAATGGAAG
ß -Actin FW CATCCGCAAAGACCTGTACG 57
RV CCTGCTTGCTGACCACATC

Sequences of primers used for the amplification of the profibrotic markers PAI-1, CTGF, and α-SMA, as well as the housekeeping gene ß-actin, along with their respective annealing temperatures for qPCR analysis.

Statistics analysis

Each experiment consisted of 3 independent observations (each well represented an independent observation). Experiments were performed in at least three different cell passages, with n = 5 per treatment. Cells were used until passages 10–12. The data were tabulated, and statistical analyses were performed using GraphPad Prism (Version 10.4.1). Normality was assessed using the Shapiro-Wilk test. Depending on the normality results, either a Student’s t-test or an analysis of variance (ANOVA) was performed. A P-value < 0.05 was considered statistically significant.

RESULTS AND DISCUSSION

Effects of Sb species on cell viability

Figures 1 and 2 show the effects of different Sb species, including Sb(III), Sb(V), and NMG-Sb(V), on cell viability in HEK293 (renal), HepG2 (hepatic), and A549 (pulmonary) cell lines. A significant reduction in HEK293 cell viability was observed following exposure to Sb(III) and Sb(V), while HepG2 and A549 cells showed no significant changes under the same conditions.

Fig. 1

Results of cell viability assay in HEK293, A549, and HepG2 cell lines exposed to different concentration of MA and Sb species. (A) MA (0–100,000 µg/L), (B) Sb(V) concentrations found in MA (~19% of total MA content). All incubations were performed for 24 hr. The percentage of cell viability was measured in HEK293 (blue), HepG2 (red), and A549 (green) cell lines. Statistical significance was determined using two-way ANOVA followed by Tukey's post hoc test. Data are represented as mean ± SEM (n=4). *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001 vs. untreated control (0 µg/L).

Fig. 2

Cell viability of HEK293, A549, and HepG2 cell lines exposed to Sb(V) and Sb(III) at environmentally relevant concentrations. (A) Sb(V) exposure (0.001–1 µg/L) and (B) Sb(III) exposure (1–500 µg/L) for 24 hr. The percentage of cell viability was measured in HEK293 (blue), HepG2 (red), and A549 (green) cell lines. Data are expressed as mean ± SEM (n=4). Statistical significance was determined using two-way ANOVA followed by Tukey's post hoc test. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001 vs. control (0 µg/L).

In HEK293 cells, exposure to Meglumine Antimoniate (MA) at 1000 μg/L significantly reduced cell viability (p < 0.05) (Fig. 1A). This suggests that MA exerts cytotoxic effects at high concentrations, which could be attributed to its Sb(V) content. To test this, exposure to pure Sb(V) at concentrations equivalent to those of Sb(V) found in MA also led to a significant reduction in cell viability at 0.19 µg/L (≈ 0.2 µg/L, as shown in Fig. 1B) and 190 µg/L (p < 0.05) (Fig. 1B).

Environmentally relevant Sb(V) concentrations also demonstrated cytotoxic effects in HEK293 cells, with significant reductions in viability at 1 and 10,000 µg/L (p < 0.05) (Fig. 2A). However, the most pronounced impact on cell viability was observed with Sb(III), with significant decreases at 100 and 500 µg/L (p < 0.05) in HEK293 cells (Fig. 2B). In A549 cells, a significant reduction in viability was also observed at 1 µg/L of Sb(III) (p < 0.05), though the effect was less pronounced than in HEK293. Unlike HEK293 and A549 cells, HepG2 cell lines showed no significant changes in viability when exposed to Sb under the same experimental conditions.

The toxic effect of Sb may be mediated by reactive oxygen species (ROS) generation, a mechanism well-documented in previous studies. It has been demonstrated that inhibiting mitochondrial ROS production improves cell viability in A549 cells exposed to Sb(V), suggesting that a similar mechanism could be involved in the cytotoxicity observed in HEK293 cells (Su et al., 2022). Additionally, Sb affects mitochondrial function by reducing the activity of electron transport chain complexes I and III, decreasing ATP production, and compromising mitochondrial membrane integrity (Su et al., 2022). These mitochondrial alterations align with the viability reduction observed in HEK293 cells.

Another potential mechanism contributing to Sb toxicity is autophagy induction, as previously reported in A549 cells exposed to trichloride Sb in a dose-dependent toxicity model (Zhao et al., 2017). A similar mechanism may be involved in HEK293 cell viability reduction, given that autophagy is associated with the removal of damaged proteins and cellular dysfunction in the presence of heavy metals.

When comparing Sb toxicity to other metalloids, arsenic has been reported to generate high levels of cytosolic ROS, whereas Sb primarily affects protein dynamics and mitochondrial homeostasis (Verdugo et al., 2016). This difference in toxicity mechanisms may explain the greater sensitivity observed in HEK293 cells, in contrast to the resistance seen in HepG2 and A549 cells.

Overall, these findings reinforce the evidence that Sb(III) is significantly more cytotoxic than Sb(V) and that renal cell toxicity is mediated by mitochondrial dysfunction and oxidative stress. Since the most pronounced effects were observed in HEK293 cells, these results highlight the relevance of Sb exposure in renal toxicity and underscore the need for further evaluation in broader biological models to better understand its impact on human health.

Effects of Sb species on reactive oxygen species (ROS)

In this study, we evaluated the generation of reactive oxygen species (ROS) in three human cell lines (A549 - lung, HepG2 - liver, and HEK293 - kidney) following exposure to different concentrations of Sb(V) and Sb(III). Our results indicate that low concentrations of Sb(V) (Sb(V) Low) and high concentrations of Sb(III) (Sb(III) High) significantly increased ROS levels in A549 cells, whereas no significant changes were observed in HepG2 and HEK293 cells (Fig. 3). These findings suggest that Sb toxicity is cell type-dependent and may be influenced by redox status and tissue-specific biotransformation capacity.

Fig. 3

Quantification of reactive oxygen species (ROS) by DCF fluorescence normalized to protein concentration in A549 (green), HepG2 (red), and HEK293 (blue) cell lines following 24 hr of exposure to different experimental conditions. Cells were incubated with different concentrations of Sb (µg/L) or MA for 24 hr. ROS levels were assessed using the DCFHDA probe, and DCF formation was used as an indicator of ROS generation. H2O2, used as a positive control, induced a significantly higher ROS production compared to the untreated controls of each cell line (p < 0.05), confirming its effectiveness as a positive control. Bars represent the mean ± standard error of the mean (SEM) from at least n = 5 independent experiments. Statistical analysis was performed using two-way ANOVA, followed by Tukey’s post hoc test. Significant differences between cell lines under the same experimental conditions are indicated as follows: * p < 0.05, *** p < 0.001, **** p < 0.0001.

The observation that A549 cells exhibited a significant increase in ROS compared to hepatic and renal cells (Fig. 4) aligns with previous studies demonstrating a greater susceptibility of the pulmonary epithelium to the toxicity of heavy metals and oxidative stress-inducing compounds (Su et al., 2022). In contrast, HepG2 and HEK293 cells did not exhibit significant ROS generation, suggesting that Sb toxicity in these tissues may be mediated by alternative mechanisms unrelated to oxidative stress, such as mitochondrial dysfunction, apoptosis, or disruption of calcium homeostasis (Boreiko and Rossman, 2020).

Fig. 4

Heatmap representation of the relative expression levels of CTGF, α-SMA, and PAI-1 in HEK293 cells exposed to different Sb compounds. Gene expression was measured by quantitative real-time polymerase chain reaction (RT-qPCR). Cells were treated with Sb(V) low (7.92 µg/L), Sb(V) high (21 µg/L), Sb(III) low (17 µg/L), Sb(III) high (42 µg/L), and MA for 24 hr. Color intensity represents normalized expression levels, with blue indicating lower expression and red indicating higher expression. Only Sb(III) low significantly increased the expression of the profibrotic gene CTGF, while Sb(V) high and MA showed moderate increases in α-SMA expression. No significant changes were observed for PAI-1. Statistical significance was determined relative to the control (*) p < 0.001**. Data are expressed as relative expression normalized to β-actin.

A possible explanation for the lack of ROS induction by Sb(V) is its intracellular reduction to Sb(III). It has been reported that Sb(V) can be reduced to Sb(III) in biological systems through the action of glutathione (GSH), NADPH, and other reducing agents (Filella et al., 2002). This conversion is crucial because Sb(III) is significantly more toxic and reactive than Sb(V). Thus, the toxic effects of Sb(V) may become apparent over time as it is metabolized into Sb(III), rather than inducing ROS immediately. The differences in cellular responses may reflect variations in the capacity of each tissue to reduce Sb(V) to Sb(III). Given that the liver and kidneys possess higher antioxidant capacities and detoxification systems, this could explain the lower ROS response observed in HepG2 and HEK293 cells compared to A549 (Gebel, 1997).

Another critical aspect is the approximate toxicological equivalence between Sb(III) High (42 µg/L) and Sb(V) Low (7.92 µg/L). Since Sb(III) is 3 to 10 times more toxic than Sb(V) (Sundar and Chakravarty, 2010), the observed ROS responses in A549 cells under these conditions may be comparable despite differences in absolute concentration (Fig. 4).

Finally, H2O2, used as a positive control, induced a significant increase in ROS levels in all cell lines, confirming the assay’s validity (Fig. 4). However, since neither Sb(V) High nor Sb(III) Low induced significant ROS generation, our findings suggest that Sb toxicity in these cells may be mediated through mechanisms other than direct oxidative stress. Future studies should investigate mitochondrial damage, apoptosis markers, and calcium homeostasis regulation to better understand the cellular effects of Sb exposure.

Effects of Sb(III) and Sb(V) on profibrotic markers

There is limited evidence of the effects of Sb(III) and Sb(V) on the gene expression of profibrotic factors such as CTGF, PAI-1, and α-SMA in human cell lines. Our results showed that Sb(V) at high concentrations caused increases in CTGF, PAI-1, and α-SMA expression, although these changes were not statistically significant compared to control cells (Fig. 4). However, Sb(III) at low environmental concentrations significantly increased CTGF expression. The MA compound also induced an increase in CTGF and α-SMA expression, though these effects were not statistically significant. These findings are consistent with the observations by Verdugo et al. (2016), where Sb(III) was shown to induce fibrosis-related gene expression in kidney cells, potentially explaining the fibrotic response seen in the kidney compared to other tissues.

Speciation and toxicity of Sb

The Environmental Protection Agency (EPA) has set the maximum permissible concentration of total Sb at 6 µg/L, but this limit does not account for the speciation of the metalloid. In this study, we observed that 1 µg/L of Sb(V) reduced cell viability by approximately 20% in kidney cells. A similar observation was made in liver cells treated with inorganic Sb(III), although no significant effects were observed in lung cells. These findings highlight the importance of distinguishing between different Sb species when assessing biological effects, as their toxicities can vary significantly (Abbasi et al., 2022). Studies have shown that Sb(III) can enter kidney cells (Roldán et al., 2020), which could explain the observed cell mortality in the HEK293 kidney cell line. Further in vivo research is required to confirm these results and understand the mechanisms underlying Sb toxicity. Previous studies have reported that Sb(III) induces apoptosis through the activation of ROS and mitochondrial dysfunction (Lösler et al., 2009). However, no significant ROS increases were observed in this study, possibly due to the low exposure times or insufficient Sb concentrations to trigger ROS-mediated pathways.

Mechanisms of cell death and profibrotic gene expression

Our findings suggest that cell death in HEK293 cells may not be related to ROS generation, as no significant increases were observed. It is possible that alternative mechanisms, such as the activation of signaling pathways related to apoptosis or autophagy, could be involved (Wan et al., 2021). To explore this further, we assessed early cellular responses by measuring the expression of profibrotic factors such as CTGF, PAI-1, and α-SMA. Cells exposed to low concentrations of Sb(III) showed a significant increase in CTGF expression, supporting the hypothesis that Sb(III) could activate fibrosis-related pathways. At higher Sb(III) concentrations (42 µg/L), no significant changes in gene expression were observed, possibly due to the activation of protective cellular mechanisms, as suggested in previous studies (Roldán et al., 2016, 2020). These results are consistent with findings that Sb(V) induces fibrosis-related gene expression at high concentrations (Fig. 4). However, it remains unclear whether the observed effects were primarily due to the MA compound or the Sb(V) contained within it.

Sb redox changes and their potential role in fibrosis

The potential intracellular reduction of Sb(V) to Sb(III) may contribute to the activation of profibrotic genes, as Sb(III) exhibited stronger cytotoxic effects in kidney cells. It has been reported that Sb(V) can be reduced to Sb(III) in biological systems (Hansen et al., 2011), raising the possibility that Sb(III) could mediate the fibrosis-related effects observed in some studies. However, further in vivo research is required to confirm these redox changes and their impact on gene expression across different tissues (Gebel, 1997; Filella et al., 2002).

Our results demonstrate that Sb(III) significantly reduces cell viability in human kidney cells at concentrations ranging from 100 to 500 µg/L, whereas Sb(V) and MA exhibited less pronounced effects. CTGF expression was significantly induced by Sb(III) at low environmental concentrations, supporting its potential role in fibrosis initiation. However, no significant changes were observed in α-SMA or PAI-1 expression, suggesting that additional signaling pathways may be involved in the fibrotic response. In contrast, liver (HepG2) and lung (A549) cells showed no significant changes in viability or fibrosis-related gene activation under the tested conditions (Sundar and Chakravarty, 2010; ATSDR, 2019).

These results highlight the importance of Sb speciation in toxicity assessments, as different Sb species exhibit distinct toxicological profiles (Barth, 1979). Given the complex nature of Sb(V) to Sb(III) bio-reduction and the variability in the observed effects, further in vivo studies are required to confirm these findings and to determine the precise mechanisms underlying chronic Sb toxicity (NCBI, 2021; Ogra et al., 2023).

To address the lowest doses inducing toxicity in each cell line, the following concentrations were identified as the minimum effective doses causing significant toxic effects (p < 0.05): In HEK293 cells, Sb(III) reduced cell viability at 100 µg/L and induced CTGF expression at 17 µg/L, while Sb(V) reduced cell viability at 1 µg/L; MA reduced cell viability at 1000 µg/L. In A549 cells, Sb(V) at 7.92 µg/L and Sb(III) at 42 µg/L significantly increased ROS production, with no significant effects on cell viability or profibrotic markers. In HepG2 cells, no significant toxic effects were observed for any Sb species or MA at the tested concentrations in terms of cell viability, ROS production, or profibrotic marker expression. These findings highlight the greater susceptibility of renal cells (HEK293) to Sb toxicity, particularly at environmentally relevant concentrations of Sb(III) and Sb(V), which aligns with their accumulation in protein-rich tissues and potential to induce fibrotic changes (Roldán et al., 2020; Verdugo et al., 2016). The lack of toxicity in HepG2 cells suggests tissue-specific detoxification mechanisms, warranting further investigation into the molecular pathways involved (Gebel et al., 1997). For A549 cells, the ROS response at low Sb(V) concentrations indicates pulmonary sensitivity to oxidative stress, but the absence of viability or fibrotic effects underscores the need to explore longer exposure times or different endpoints to fully characterize Sb’s pulmonary toxicity (Su et al., 2022).

Future studies should focus on:

1. The tissue distribution of Sb species and the redox changes that may occur in vivo.

2. The evaluation of long-term effects of Sb(III) and Sb(V) exposure on renal and hepatic fibrosis.

3. Identifying the molecular mechanisms responsible for Sb(V) to Sb(III) bio-reduction and its impact on the expression of profibrotic genes such as CTGF, PAI-1, and α-SMA.

Overall, the results suggest that Sb(III) has a higher potential for renal toxicity than Sb(V), and the effects observed in vitro must be validated in animal studies to assess their clinical and environmental relevance.

ACKNOWLEDGMENTS

The authors gratefully acknowledge the financial support of FONDECYT grants 1191041 and 1191006, internal scholarship of Advanced Studies (VRIEA), and CONICYT scholarship (Folio number: 21180083). We are also thankful for the financial support from JSPS KAKENHI (Grant numbers 24H00749 and 24K21304).

Conflict of interest

The authors declare that there is no conflict of interest.

REFERENCES
 
2025 The Japanese Society of Toxicology
feedback
Top