2021 Volume 62 Issue 3 Pages 189-197
Ophiocordyceps xuefengensis is an ethnopharmacological fungus with broad pharmacological properties. Light is a critical environmental factor for the stromata formation and development of many fungi. In this study, photomorphogenesis and blue light receptor genes were studied using a strain of O. xuefengensis. Light represses vegetative growth, but conidia linked to stromata can be observed under both light and dark conditions. Light and dark conditions had little effect on the accumulation of polysaccharides and adenosine. The genes Oxwc-1 and Oxwc-2 encoding photoreceptors of O. xuefengensis were cloned and predicted to possess polypeptides of 937 and 525 amino acids, respectively. A phylogenetic analysis based on fungal WC-1/2 supported OxWC-1 and OxWC-2 were photoreceptor. The expression of both the Oxwc-1 and Oxwc-2 genes reached a maximum after receiving light stimulation for 15 min, which might relate to the inhibition of stromata growth.
Ophiocordyceps xuefengensis T.C. Wen, R.C. Zhu, J.C. Kang & K.D. Hyde is an ethnopharmacological fungus identified as the sister taxon of Ophiocordyceps sinensis (Berk.) G.H. Sung, J. M, Sung, Hywel-Jones & Spatafora (Wen et al., 2013) with broad pharmacological properties such as antibacterial, antiviral, and antitumor activities and the ability to enhance human immunity (Zhong et al., 2019). It is well known that stromata are consumed as fresh or dried food or as a medicinal nutrient, and it is generally difficult to obtain stromata of O. sinensis by artificial cultivation. Interestingly, through the artificial cultivation of O. xuefengensis, not only the fermentation of mycelia in liquid culture but also the cultivation of stromata on solid rice medium can be achieved (Jin et al., 2017). Moreover, this artificial cultivation fungus contains various active chemical constituents, including adenosine, polysaccharides, and amino acids (Jin et al., 2017; Liu et al., 2017; Jin et al., 2018a). These features indicate the potential for this fungal species to be used in industrial applications. Therefore, it could be meaningful to further investigate environmental factors affecting the growth of stromata at the molecular level to better understand their biological response.
Filamentous fungi are extremely versatile organisms that can grow under very different environmental conditions. Various adverse environmental conditions such as light, temperature, humidity and ventilation conditions are used for stromata induction. Among them, light is an environmental signal widely used by fungi to modulate developmental and metabolic processes (Idnurm, Verma & Corrochano, 2010) and has a complex effect on the growth and development of fungi. In most filamentous fungi, light is an essential factor for the formation and development of hyphal knots and stromata (Muraguchi et al., 2015). The primordia of Cordyceps militaris (L.) Link begin to develop after exposure to light, but no stromata production occurs under darkness (Basith & Madelin, 1968). In gray mold fungus Botrytis cinereal Pers, conidia form under light while sclerotia form in the dark (Cohrs, Simon, Viaud, & Schumacher, 2016). Additionally, secondary metabolites are affected under light; for example, the synthesis of nucleosides (Martens & Sargent, 1974) and polysaccharides (Friedl, Schmoll, Kubicek, & Druzhinina, 2008) is induced by light exposure.
Various photoreceptors have been investigated to explain cell morphogenesis responses to light. The white-collar complex (WCC) consisting of the WC-1 and WC-2 proteins, first identified in model fungus Neurospora crassa Shear & B. O. Dodge, are two well-studied photoreceptors (Ballario et al., 1996; Linden & Macino, 1997). WC photoreceptors have since been identified in many fungal species such as Schizophyllum commune Fr (Ohm, Aerts, Han & Lugones, 2013) and Bipolaris oryzae Sawada (Kihara, Moriwaki, Tanaka, Ueno, & Arase, 2007) for their involvement in the regulation of growth and development. The genes wc-1 and wc-2 have been cloned in traditional Chinese medicine cordyceps fungi O. sinensis and C. militaris (Yang, Xiong, & Dong, 2014; Yang & Dong, 2014). These two photoreceptors are known as essential components of light responses affecting metabolite production, including mycelial carotenogenesis, the phototropism of perithecial beaks and the circadian rhythm of conidiation (Ballario, Talora, Galli, Linden, & Macino, 1998). However, knowledge of the effects of light on the phenotype and gene expression of these photoreceptors in O. xuefengensis is limited. Thus, a systematic investigation of the growth and development of O. xuefengensis is necessary, especially to understand the molecular mechanisms of its response to light.
In the present study, we observed different phenotypes under dark and light conditions, and light inhibited the growth of O. xuefengensis. The transcriptomes of O. xuefengensis under light and dark conditions were then studied to identify key genes of photoreceptors. Putative light photoreceptors of the genes Oxwc-1 and Oxwc-2 were cloned and analyzed. Moreover, real-time quantitative reverse transcription-PCR (RT-qPCR) was carried out to measure the expression of the Oxwc-1 and Oxwc-2 under light and dark conditions. To the best of our knowledge, this is the first report of phenotype and gene expression in response to light in ethnopharmacological fungus O. xuefengensis and provides information for the industrial production of this medicinal fungus.
The strain O. xuefengensis HACM 001 was used in this study. Firstly, the fermentation of mycelia in liquid culture, was carried out in an Erlenmeyer flask at 25 ℃ with shaking at 130 rpm in an incubator for 15 d. Then, the mycelium was filtered with double gauze, and 2 mL of fermentation was inoculated into solid medium in a transparent glass bottle at 25 ℃. The stromata primordia were first placed in dark conditions for 30 d and then transferred to a 12 h/12 h (light/dark) white light environment with an intensity of 800 lux (L) for 30 d in an illumination incubator (RXZ-280C, Hangzhou, China). The medium and other cultivation conditions were conducted according to our published method (Jin et al., 2017).
2.2. Phenotype observationThe harvested stromata were dried to a constant weight for biomass measurement. The phenotype of the stromata was observed under an Olympus SZ61 microscope (Olympus Optec Instrument Co., Tokyo, Japan). The tops of the stromata were mounted in chloral hydrate and stained with cotton blue in lactic acid. The microcharacters of the stromata were viewed and photographed under a Leica DM-2500 microscope (Leica, Wetzlar, Germany).
2.3. Extraction and quantitative measurement of polysaccharidesThe stromata harvested under different conditions were kept in an incubator at 60 ℃ until a constant weight was achieved. They were then extracted with distilled water using an ultrasonic method. The extracts were centrifuged to separate the supernatant from residues. Ethanol (95%) was then added to the supernatant to precipitate the polysaccharides. Afterward, the polysaccharides were separated by centrifugation (5000 rpm, 10 min). The precipitated polysaccharides were subsequently redissolved in distilled water for quantitative measurement by the phenol/sulfuric acid colorimetric method (Jin et al., 2018b).
2.4. Determination of adenosine by HPLC-QTOF-MSAdenosine in the stromata of O. xuefengensis was extracted with 15% methanol solution. The extracts were filtered through a 0.22 μm filter for HPLC-DAD-Q-TOF-MS analysis. Fractions were monitored at 260 nm, and the operation was controlled by an Agilent Mass Hunter LC/MS Acquisition console. Adenosine content was determined according to the MS data and through a comparison of the retention time to that of the standard compound as described previously (Jin et al., 2017).
2.5. RNA isolation and Illumina sequencingThe harvested stromata were immediately treated with liquid nitrogen and stored at –80 ℃ for RNA extraction for transcriptomic analysis. Total RNA was extracted with TRIzol reagent (Invitrogen, California, USA) and used for cDNA library construction. The Illumina HiSeq X platform was used for RNA sequencing, and paired-end reads were generated as described previously (Jin et al., 2018a). All data were recorded in the NCBI Sequence Read Archive (SRA) database (accession numbers: SAMN15512219, SAMN15512220, SAMN15512221, SAMN15512222, SAMN15512223, and SAMN15512224).
2.6. Transcriptome assembly and gene functional annotationRaw data in fastq format were first processed through in-house Perl scripts. Clean data (clean reads) were obtained by removing reads containing adapters, containing poly-N sequences and low quality from raw data. Transcriptome assembly was accomplished using Trinity. Gene function was annotated based on the web databases.
2.7. Gene cloning and sequencingThe nucleotide sequences of the Oxwc-1 and Oxwc-2 were obtained from the O. xuefengensis transcriptome. cDNA was obtained as done with method 2.4. PCR amplification was performed in a MyGeneTM Series Peltier Thermal Cycler (LongGene, Hnagzhou, China). The Oxwc1-F/R and Oxwc2-F/R primers were designed as shown in Table 1. The PCR products were gel purified, cloned into TSV-007 vectors, and then sequenced by Tsingke Biotech (Changsha, China).
Primer name |
Sequence(5’ to 3’) |
Oxwc-1F |
ATGGATGGCTTCTACACGC |
Oxwc-1R |
CTACGATTGGCTATTCTCGC |
Oxwc-2F |
GACTTGACCCAACCTTGCACAG |
Oxwc-2R |
ACTACACCTCCCTACCTTGACCTTA |
18s-F |
TACTACATCCAAGGAAGGCAGC |
18s-R |
CAAGACCCAAAAGAGCCCTG |
qOxwc-1F |
CTGGACCCCTCCATCTACCA |
qOxwc-1R |
CATCTTGTCCCACGACTGCT |
qOxwc-2F |
TGGTCATGGGCATTTCGTCA |
qOxwc-2R |
CGGGCCATTTCTTTGGCTTC |
The gene model of the retrieved sequences was predicted using the NCBI web server (https://www.ncbi.nlm.nih.gov/). The theoretical isoelectric point (pI) and molecular weight (Mw) were predicted using the Compute pI/Mw tool of the ProtParam website (http://web.expasy.org/protparam/). Motif scan analysis was carried out with the Simple Modular Architecture Research Tool (SMART) program (http://smart.embl-heidelberg.de/). And the deduced amino acid sequences of OxWC-1 and OxWC-2 have been deposited in GenBank, under accession numbers MT181964 and MT181965 for strain O. xuefengensis HCMA001.
2.9. Phylogenetic analysisAlignments were performed with the MUSCLE method, and phylogenetic trees were generated using the neighbor-joining method and p-distance model (bootstrap resampling of 500 replicates) through MEGA 6.0 (Tamura, Stecher, Peterson, Filipski & Kumar, 2013). The data subset of gap and/or missing data were treated with complete deletion. The phylogenetic trees were edited using PPT. The WC-1 and WC-2 protein sequences of other fungi were used for tree construction together with the sequences generated in this study. In addition, the protein sequences of other fungi retrieved from NCBI are listed in Supplementary Tables S5 and S6.
2.10. Quantitative real-time reverse transcription-PCRThe stromata of O. xuefengensis was harvested and used for total RNA extraction and cDNA synthesis as indicated above. After continuous irradiation for 0, 15, 30, 60, 360 and 1440 min, RT-qPCR was performed using a TSE202 Mix (SYBR Green) kit (TsingKe, Cahangsha, China) and carried out in triplicate for each sample. Amplicon length ranged from 100 to 150 bp, and the gene-specific primers used (qOxwc1-F/R and qOxwc2-F/R) are shown in Table 1. The 18S rRNA gene (GenBank accession number: NG-065010.1) was selected as a reference gene. The RT-qPCR system and program are described in Supplementary Tables S1 and S2. The PCR reaction system was run in a BioRad CFX Connect instrument (BioRad, California, USA). Three independent biological replicates were performed, and 2−ΔΔCq was used for relative quantification.
2.11. Statistical analysisGenes with a Padj < 0.05 found by DESeq were assigned as differentially expressed. The data were treated in triplicate and expressed as mean ± standard deviation values. Differences between groups under light and dark conditions were analyzed statistically through a one-way analysis of variance (ANOVA) with P < 0.05 set as a significant difference using originPro 9.1.
Light significantly affected the phenotype of the stromata of O. xuefengensis as shown in Fig. 1. Skinny stromata have grown under light conditions for 30 d, and the surface of stromata formed a fluffy structure while lush and straight stromata formed under dark conditions (Fig.1 A and B). In addition, the color of the top of the stromata changed from white to brown with thread structure by asana microscopic observation (Fig.1 C,E) under light conditions. Notably, the top of the stromata under dark conditions was white (Fig.1 D,F). Asexual nonmotile spores of higher fungi called conidia (conidiospores) formed from the apex or side of conidiogenous cells through mitosis, which was followed by repeated asymmetric division(Park & Yu, 2012). A further microscope observation of the top of stromata shows that the conidia linked to stromata were both yielded in light and dark conditions (Fig.1 G,H). Herein, the conidia of O. xuefengensis seemed to be uniform with a diameter of approximately 10 μm.
The light conditions were not suitable for the growth of O. xuefengensis stromata because less biomasses were accumulated under light conditions than under dark conditions (P < 0.05) (Fig. 2A). No significant difference in stromata diameter was found between light and dark conditions, but the stromata were shorter under light conditions than under dark conditions (Fig. 2B). It is worth noting that few effects on the accumulation of adenosine (Fig. 2C) and polysaccharides (Fig. 2D) were detected under the two experimental conditions.
Samples of O. xuefengensis were collected under light and dark conditions for RNA sequencing to identify photoactive-related genes. The sequencing generated a total of 76,740,960 raw reads, which were recorded in the NCBI database. After removing low-quality raw reads, 75,049,888 clean reads were obtained. A de novo transcriptomic analysis was carried out because the genome of O. xuefengensis is not available. A total of 2789 genes were only expressed under light conditions, 3351 genes were only expressed under dark conditions (Fig. 3A). A total of 945 genes (542 upregulated genes and 403 downregulated genes) were assigned as significantly differentially expressed under light and dark conditions by DESeq with an adjusted P-value < 0.05 (Fig. 3B; Supplementary Table S3).
The differentially expressed genes were assigned to different specific pathways using KEGG. These upregulated differentially expressed genes matching metabolic pathways under light conditions did not appear to be significantly different because the adjusted P-values were larger than the default value of 0.05. For the genes downregulated under light conditions, a total of 20 pathways were enriched as illustrated in Fig. 3C. Among these pathways, the downregulated genes were mainly significantly enriched in proteasome and amino acid biosynthesis pathways, i.e., phenylalanine, tyrosine and tryptophan biosynthesis (Supplementary Table S4).
3.3. Cloning and nucleotide sequence analysis of white-collar photoreceptorsThe coding sequences of Oxwc-1 and Oxwc-2 were first obtained by transcriptomic analysis and RT-PCR. The cDNA sequences encoding OxWC-1 and OxWC-2 were 2814 bp and 1578 bp, respectively, from the predicted translational start site to the stop codon. The observed protein characteristics compared to cordyceps and other pattern fungi are shown in Table 2. It seems that the proteins differed little in length. However, the SMAT diagram represents a summary of the results of the domain architecture analysis of the white-collar complex (Fig. 4). The diagram shows that the composition and arrangement of conserved domains of OxWC-1 are the same as those of other species while their location is slightly different. OxWC-1 contained three PAS domains (LOV domain 349–418 aa, 544–610 aa and 658–729 aa), two PAC domains (435–477 aa, 615–657 aa) and one putative GATA-type Znf domain (883–930 aa). However, the OxWC-2 protein contained one PAS domain (127–193 aa), similar to other fungi, but a C2H2-type Znf domain (422–427 aa) instead of the GATA-type Znf domain.
Protein name |
Species |
Amino acids/aa |
Molecular weight/Da |
pI value |
OxWC-1 |
O. xuefengensis |
937 |
102652.89 |
6.57 |
NcWC-1 |
Neurospora crassa |
1167 |
127453.93 |
7.66 |
OsWC-1 |
O. sinensis |
1105 |
120768.27 |
6.73 |
CmWC-1 |
Cordyceps militaris |
963 |
105251.10 |
8.64 |
OxWC-2 |
O. xuefengensis |
525 |
57167.73 |
5.70 |
NcWC-2 |
N. crassa |
530 |
56895.01 |
5.71 |
OsWC-2 |
O. sinensis |
476 |
55284.06 |
5.51 |
Database searches made via NCBI-blastn in GenBank reveal that the predicted OxWC-1 protein was highly similar (93.92%) to OsWC-1 (white collar-1 protein of O. sinensis) and that the OxWC-2 protein was also highly similar (92.33%) to OsWC-2. A phylogenetic tree with the identified protein sequences of the fungal photoreceptor-like proteins retrieved from GenBank was constructed. The tree of the WC-1 protein shows that families from the Hypocreales, Helotiales and Eurotiales were well clustered into a clade (Fig. 5A). In addition, it is clear that each of the five families involved formed a subclade in the Hypocreales clade (Supplementary Table S5). The tree of the WC-2 protein also shows that the clades and clusters strongly support the evolution of these fungi (Fig. 5B; Supplementary Table S6). Without a doubt, phylogenetic analysis based on fungal WC-1/2 supported OxWC-1 and OxWC-2 were photoreceptor.
To investigate the regulation of the Oxwc-1 and Oxwc-2 in response to light, the relative expression levels of the corresponding mRNAs were determined by RT-qPCR. Relative expression was measured in reference to the value of O. xuefengensis under dark conditions as a control. As shown in Fig. 6, the expression levels of genes Oxwc-1 and Oxwc-2 increased significantly after irradiation for 15 min (P < 0.05). Then, the expression of these two photoreceptor genes gradually decreased to normal levels. The expression levels of Oxwc-1 and Oxwc-2 were not different after irradiation for 1440 min.
It is well known that light exposure has regulatory effects on the growth and secondary metabolism of fungi (Dong et al., 2013). Controlling darkness and daylight conditions is traditionally applied in the cultivation of cordyceps (Dong et al., 2013; Dong, Liu, Lei, Zheng, & Wang, 2012; Chen, Liu, & Chang, 2011). In the present study, an obvious inhibition of stromata growth in O. xuefengensis was observed under light conditions. Stromata of O. xuefengensis could not even form when the mycelia were placed directly in the light. This is why we first cultivated the stromata in the dark and then transferred them to light conditions to observe the resulting effect. This observation stands in contrast to observations of C. militaris, in which stromata grow faster with irradiation. Polysaccharide and adenosine are considered to be the main active components in the stromata of cordyceps. Light and dark conditions had few effects on the accumulation of polysaccharides and adenosine, which is in accordance with a previous report on C. militaris showing no significant difference in the content of adenosine and other bioactive components between dark and light conditions (Dong et al., 2012). Conidiation does not generally occur in fungi until cells have completed a defined stage of vegetative growth necessary for cells to acquire the ability to respond to development signals (Lee et al., 2016). Light is usually a major environmental factor that controls conidia development (Idnurm & Heitman, 2005). Surprisingly, conidia linked to the stromata of O. xuefengensis could be observed under both light and dark conditions. This characteristic could facilitate industrial production and reproduction without sacrificing vegetative growth.
Investigations of the white collar system are interesting and have been carried out on various fungal species such as O. sinensis (Yang et al., 2014), C. militaris (Yang & Dong, 2014), and Ganoderma lucidum (Leyss. Ex Fr.) Karst (Xu et al., 2017). A further analysis of amino acids found that the open reading frame of Oxwc-1 encoded a predicted polypeptide 937 amino acids in length, differing from that of other blue light receptors (He et al., 2005). In addition, the open reading frame of Oxwc-2 encoded a predicted polypeptide that was 525 amino acids in length and thus of nearly the same length as Ncwc-2 (Linden & Macino, 1997). The phylogenetic analysis of fungal WC-1/2-like proteins shows OxWC-1/2 to act as blue light receptors. To the best of our knowledge, this is the first report of a white-collar complex in ethnopharmacological fungus O. xuefengensis. The presented data suggest that the WC-1 LOV domain is essential for light-activated transcription (He et al., 2002).
Yang and Dong found expression levels of the Oswc-1 and Cmwc-1 increase significantly after irradiation for 15 min (Yang et al., 2014; Yang & Dong, 2014). To our surprise, various large fungal photoreceptor protein genes can also be expressed in the dark, but the expression level rises rapidly within a certain period of time after illumination. After 20 min of light stimulation, Tbwc-1 gene expression was measured as 4 times higher than that measured under dark conditions (Ambra et al., 2004), and the Le. phrA of Pleurotus ostreatus was found to be higher in immature fruiting bodies (Sano, Narikiyo, Kaneko, Yamazaki & Shishido, 2007). Our study shows that the expression of both the Oxwc-1 and Oxwc-2 reached a maximum after 15 min of light stimulation, after which expression gradually decreased to a steady state with light exposure time, similar to what has been observed in previous studies (Yang & Dong, 2014; Yang et al., 2014).
The genes of photoreceptors could be defined as early and late light responders. Early light responders show an average peak in mRNA expression after approximately 15 to 30 min of light stimulation (Brenna & Talora, 2019). Accordingly, OxWC-1/2 should belong to early light responders. These white collar photoreceptors are DNA binding transcription factors (He et al., 2002). A combined analysis of the transcriptome and the expression of OxWC-1/2 might indicate that these white collar photoreceptors receive light stimulation and then downregulate the proteasome and amino acid biosynthesis pathways, eventually leading to stromata growth inhibition since interference of the proteasome (Liu & Xue, 2014) and amino acid (Chang, Sui, Siov & Li, 2015) pathways could regulate other fungal growth pathways. However, this hypothesis must be further investigated.
The involvement of light and photoreceptors in ethnopharmacological fungal development beyond model organisms is a particularly exciting area of research with medical relevance. We first studied the light response and photoreceptor of O. xuefengensi. We found that light represses vegetative growth, but conidia linked to stromata could be observed under both light and dark conditions. Light and dark conditions had little effect on the accumulation of polysaccharides and adenosine. Oxwc-1 and Oxwc-2 were cloned and predicted to possess polypeptides of 937 and 525 amino acids, respectively. A phylogenetic analysis based on fungal WC-1/2 supported OxWC-1 and OxWC-2 were photoreceptor. The expression of both the Oxwc-1 and Oxwc-2 reached a maximum after 15 min of light stimulation, which might relate to the inhibition of stromata growth. This study of white-collar genes for growth and development can facilitate research in the still largely unexplored field of stromata development for cordyceps.
The authors declare no conflicts of interest. All experiments undertaken in this study comply with the current laws of the country in which they were performed.
This research was funded by the National Natural Science Foundation of China (No. 81673585), Natural Science Foundation of Hunan Province (2018JJ3309, 2020JJ5330), Program for Surveying and Monitoring of Chinese Medicines for National Drugs ([2017] 66), Key Project at the Central Government Level for the Ability Establishment of Sustainable Use for Valuable Chinese Medicine Resources (2060302) and Training Program for Excellent Young Innovators of Changsha (kq1905027).
