Two new Tricholoma species in the sect. Genuina from pine forests in Japan

Abstract

“Matsushimeji” identified as Tricholoma albobrunneum belonging to sect. Genuina is an edible mushroom commonly used in Japan. This species has been suggested to include another cryptic species with common morphological characteristics and identical internal transcribed spacer (ITS) sequences of nuclear ribosomal DNA (nuc rDNA). We compared T. albobrunneum specimens sampled in Japan and Denmark, including the holotype. Phylogenetic analyses of nuc rDNA ITS and intergenic spacer 1 (IGS1) regions, and tef-1a and rpb2 genes identified two phylogroups in Japanese T. albobrunneum. In addition, both Japanese phylogroups of T. albobrunneum were distinguished from European T. albobrunneum. Concatenated phylogenetic tree analysis based on these four DNA regions also distinguished two Japanese clades within T. albobrunneum. Here, we report two new species, T. matsushimeji distributed on Honshu Island under two-needle pines and T. miyama-matsushimeji on Rishiri Island under a five-needle pine from Japan.

Tricholoma albobrunneum (Pers.) P. Kummer (Japanese common name: “Matsushimeji”) belongs to section Genuina (Fr.) Sacc. (Aoki et al., 2021; Ding et al., 2023; Heilmann-Clausen et al., 2017). This fungus is widely distributed in the Northern Hemisphere and occurs in pine forests established on nutrient-poor soil (Christensen & Heilmann-Clausen, 2013). However, it has been suggested to be comprised of several phylogenetic lineages based on analyses of specimens from Europe, China, North America, and Japan (Ding et al., 2022, 2023; Jacques et al., 2022; Reschke et al., 2018). In Japan, Imai (1938) reported T. albobrunneum (Pers. ex Fr.) Quélet as new to Japan based on specimens collected from Hokkaido and Ibaraki Prefecture, with the Japanese common name “Matsushimeji”. Several Japanese mycologists confused Matsushimeji with a similar fungus, “Kakishimeji” identified as Tricholoma ustale (Fr.) P. Kumm. (e.g., Imazeki & Hongo, 1957, 1987). However, Kakishimeji was recently described as a new species, Tricholoma kakishimeji W. Aoki & A. Yamada (Aoki et al., 2021).

Matsushimeji has been reported as an edible mushroom harvested in coastal pine forests in some local regions in Japan (Hiroe, 1949; Kurogi, 2015). However, several mushroom guidebooks describe this mushroom as poisonous, probably due to confusion between Matsushimeji and Kakishimeji. Ustalic acid, a toxic compound causing digestive symptoms on ingestion, has been detected from T. kakishimeji but not from Japanese T. albobrunneum (Aoki et al., 2021; Ito et al., 2021). Until recently, T. kakishimeji had long been identified as T. ustale (Aoki et al., 2021). In Europe, T. albobrunneum was reported to be edible in some regions (Romagnesi, 1971) or of unknown edibility (Riva et al., 2003).

We have previously reported the nuclear ribosomal DNA (nuc rDNA) internal transcribed spacer (ITS) phylogeny of Japanese Tricholoma, including T. albobrunneum, and suggested that Japanese T. albobrunneum may consist of two species, i.e., true T. albobrunneum and another cryptic species, because they showed subclades with moderate statistical support (Aoki et al., 2021). Japanese T. albobrunneum specimens collected under a shrub of Pinus pumila on Rishiri Island formed a monophyletic subclade with European T. albobrunneum specimens, and other Japanese T. albobrunneum specimens formed another subclade. These observations also suggested the need for multi-gene phylogenetic analyses, as reported for several Tricholoma taxa (e.g., Aoki et al., 2022; Grubisha et al., 2012), and morphological comparisons of T. albobrunneum specimens sampled from both Japan and Europe. Here, we performed taxonomic reevaluation of Japanese T. albobrunneum based on multi-gene phylogenetic analysis and morphological comparisons with European specimens.

Thirty-three T. albobrunneum specimens and several specimens of related species collected in Japan and Europe were used in the analyses (Table 1). Fresh basidioma samples were tested using guaiac reagent (Aoki et al., 2021), lyophilized, oven-dried at 60 °C overnight to inactivate DNases and other oxidative enzymes, and stored in the laboratory. Where necessary, specimens were deposited in the National Museum of Nature and Science (TNS), Japan. In addition, we used two cultured strains of T. albobrunneum whose phylogenetic characteristics and ectomycorrhizal properties have been reported previously (Aoki et al., 2021; Yamada et al., 2010).

Table 1. List of Tricholoma specimens used for the morphological observation and phylogenetic analysis.

Tricholoma species	Specimen	Sampling:			Reference
		Date	Site	Canopy vegetation
T. albobrunneum	TUA-1 (=AY2080904-001)	2008/9/4	Mt. Rishiri-dake, Rishiri, Hokkaido, Japan	Ppu	1, 2
	TUA-2 (=AY2080904-002: TNS-F-83198)*3	2008/9/4	Mt. Rishiri-dake, Rishiri, Hokkaido, Japan	Ppu	1, 2
	TMI Fukuti 6	1930s	Ishikari, Sapporo, Hokkaido, Japan		1
	TMI Fukuroda 52	1937/10/11	Fukuroda, Daigo, Ibaraki, Japan		1
	AT-0610 (=NBRC 33139)*1, 2	1997/11/21	Naka, Hitachi-ohmiya, Ibaraki, Japan	Pde	1, 2
	AT-0612 (=NBRC 33141)*1, 2	1997/11/4	Naka, Hitachi-ohmiya, Ibaraki, Japan	Pde	1, 2
	TNS-F-18996*3	1978/10/14	Kunishige, Noto, Ishikawa, Japan	Pth	1, 2
	OMNH 2802*4	1963/10/7	Hasuike Pond, Yamanouchi, Nagano, Japan		1
	TUA-78	2018/10/17	Mt. Iizuna-yama, Iizuna, Nagano, Japan	Pde	1, 2
	TUA-203	2022/10/14	Mt. Iizuna-yama, Iizuna, Nagano, Japan	Pde, Qse	2
	TUA-118 (TNS-F-83197)*3	2019/10/30	Kuwahara, Nakagawa, Nagano, Japan	Pde	1, 2
	TUA-119	2019/10/30	Kuwahara, Nakagawa, Nagano, Japan	Pde	1, 2
	TUA-175	2021/6/20	Mt. Eimeiji-yama, Chino, Nagano, Japan	Pde	2
	TUA-4 (=AY-2070706-001)	2007/7/6	Toyooka, Nagano, Japan	Pde	1, 2
	OMNH 1938*4	1958/10/24	Ishiyama-sotohata, Otsu, Shiga, Japan		1
	OMNH 1947*4	1958/10/30	Sato, Otsu, Shiga, Japan		1
	OMNH 3008*4	1964/10/31	Senchou, Otsu, Shiga, Japan		1
	OMNH 3606*4	1967/11/9	Otsu, Shiga, Japan		1
	TUMH 62879*5	2016/12/16	Hamasaka, Tottori, Tottori, Japan	Pth	1
	TaY20181117-001	2018/11/17	Tottori Sand Dune, Tottori, Tottori, Japan	Pth	1, 2
	TUA-127 (TNS-F-83195)*3	2019/11/13	Tottori Sand Dune, Tottori, Tottori, Japan	Pth	1, 2
	TUA-128 (TNS-F-83196)*3	2019/11/13	Tottori Sand Dune, Tottori, Tottori, Japan	Pth	1, 2
	TUA-129	2019/11/13	Tottori Sand Dune, Tottori, Tottori, Japan	Pth	1, 2
	TUA-130	2019/11/13	Tottori Sand Dune, Tottori, Tottori, Japan	Pth	1, 2
	TUA-131	2019/11/13	Tottori Sand Dune, Tottori, Tottori, Japan	Pth	1, 2
	TUA-132	2019/11/13	Tottori Sand Dune, Tottori, Tottori, Japan	Pth	1, 2
	TUA-143	2019/11/13	Tottori Sand Dune, Tottori, Tottori, Japan	Pth	1, 2
	OMNH 1756*4	1958/4/13	Hitotsuba, Miyazaki, Miyazaki, Japan		1
	JHC91-718 (C-F-103453)*6	1991/10/13	Anholt, Denmark		2
	MC97-233 (C-F-59411)*6	1997/10/17	Rømø, Vråby Plantage, Denmark		2
	MC96-221 (C-F-59122)*6	1996/10/19	E Jylland, Skramsø Plantage, Djursland, Denmark		2
	JV04-471 (C-F-43791)*6	2004/10/3	Ålbæk Kliplantage, W end, Denmark		2
	JV08-268 (C-F-76787)*6	2008/9/19	Saaremaa, Kihelkonna commune, Odalätsi Landscape reserve, Estonia		2
T. stans	TMI 5614	1933/10/8	Jozankei, Sapporo, Hokkaido, Japan		1
	TUA-102	2019/11/3	Mt. Yatsugatake, Koumi, Nagano, Japan	Tdi	1
	TMI 12A	1940/10	Narusawa, Yamanashi, Japan		1
	TUMH 62876*5	2016/11/12	Kokufu, Tottori, Tottori, Japan	Qgl, Qmy	1
	MC 95-304 (C-F-59298)*6	1995/10/15	E Jylland, Skragen Klitplantage, Denmark		2
	MC 95-131 (C-F-59032)*6	1995/9/13	Medelpad, Borgsjiö, Bergåsens sydbergssluttning, Sweden		2
	MC 95-145 (C-F-59042)*6	1995/9/15	Medelpad, Borgsjiö, ved Folketshus (Västna by), Sweden		2
T. kakishimejioides	TNS-F-38558*3	2010/10/24	Shichikuro, Tsubata, Ishikawa, Japan	F, Pde	1
	TNS-F-18996*3	1978/10/14	Kunishige, Noto, Ishikawa, Japan	F, Pde	1
	TaY20191104-001	2019/11/4	Kashihara Shrine, Kashihara, Nara, Japan	Qgl	1
	TUMH62875*5	2016/11/3	Makibara, Tottori, Tottori, Japan	F	1
T. kakishimeji	TMI 5615	1934/10/8	Sapporo, Hokkaido (market), Japan		1
	TUA-75	2018/10/17	Mt. Iizuna-yama, Iizuna, Nagano, Japan	Pab	1
	TUA-125	2019/11/5	Asahi, Matsumoto, Nagano, Japan	Pde	1
	TMI Mizu5	1940/9/27	Mt. Mizugaki-yama, Hokuto, Yamanashi, Japan		1
	TMI 25	1940/10/4	Saiko Lake, Fuji-kawaguchiko, Yamanashi, Japan		1
	TUMH 62228*5	2015/11/24	Ooike Pond, Tottori, Tottori, Japan	Qgl, Qmy	1
	TUA-133	2019/11/13	Ooike Pond, Tottori, Tottori, Japan	Qgl, Qmy	1
	TUMH 61677*5	2013/11/23	Nishifumoto, Takaharu, Miyazaki, Japan	F	1

^*1 Cultured mycelium

^*2 NBRC = NITE Biological Resource Center

^*3 TNS = National Museum of Nature and Science

^*4 OMNH = Osaka Museum of Natural History

^*5 TUMH = Tottori University

^*6 C = University of Copenhagen

1: Aoki et al. (2021)

2: This study

DNA was extracted from dried basidioma specimens and cultured mycelia as described by Gardes and Bruns (1993) with minor modifications. We performed PCR focusing on several loci: the ITS and intergenic spacer 1 (IGS1) regions of nuc rDNA, translation elongation factor 1-alpha (tef-1a), and RNA polymerase II second largest subunit (rpb2). The primers used are listed in Table 2. PCR was performed using the GeneAmp PCR System 2700 (Applied Biosystems, Foster City, CA, USA). The 25-µL reaction mixture consisted of 2.5 µL of 10× DreamTaq buffer, 2.5 µL of dNTP mixture (0.2 mM), 2.5 µL of each primer (0.5 µM), 0.125 µL of DreamTaq DNA polymerase (0.625 U; Thermo Fisher Scientific, Waltham, MA, USA), and 0.5 µL of extracted DNA as the template. The PCR profile consisted of an initial denaturation step at 95 °C for 3 min followed by 35 cycles of denaturation at 95 °C for 30 s, annealing at 46-55 °C (Table 2) for 30 s, extension at 72 °C for 1.5 min, and a final extension step at 72 °C for 10 min. The PCR amplicons were electrophoresed (Mupid®-exU; TaKaRa Bio, Kusatsu, Japan) on a 1.5% agarose gel for fragments ≥ 1 kb (01163-76; Nacalai Tesque, Kyoto, Japan) for 30 min, stained with 0.001% ethidium bromide solution, and visualized using an ultraviolet transilluminator (NM-15; UVP, Upland, CA, USA). The PCR amplicons were purified using a QIAquick PCR Purification Kit (Qiagen, Venlo, the Netherlands) and subjected to cycle sequencing. The ITS and IGS1 regions of nuc rDNA were cloned manually before cycle sequencing using a Mighty TA-Cloning Kit (TaKaRa Bio) and then inserted into competent Escherichia coli JM109 cells (TaKaRa Bio). For cycle sequencing, the 10-µL reaction mixture consisted of 2 µL of distilled water (DW), 2 µL of 10× buffer, 1 µL of 5 mM primer, 1 µL of Ready Reaction Mix (BigDye Terminator v. 3.1 Cycle Sequencing Kit; Thermo Fisher Scientific), and 4 µL of purified DNA solution. The PCR profile for cycle sequencing consisted of an initial denaturation step at 96 °C for 1 min followed by 25 cycles of denaturation at 96 °C for 10 s, annealing at 46-55 °C (Table 2) for 5 s, and extension at 60 °C for 4 min. The amplicons were sequenced using an Applied Biosystems 3130 Genetic Analyzer (Applied Biosystems). The sequences were aligned using ClustalW (Larkin et al., 2007) and MEGA11 (Tamura et al., 2021), and the consensus sequence in each region was established and deposited in DDBJ (Supplementary Table S1). Several sequences for the ITS region were downloaded from GenBank and UNITE (Supplementary Table S1). For phylogenetic analysis of each DNA region, alignment gaps were treated as missing data, and ambiguous positions were manually excluded from the analysis. Data sets for the ITS (ITS1-5.8S-ITS2; 651 bp) and IGS1 (420 bp) regions of nuc rDNA, rpb2 (461 bp), and tef-1a (695 bp) were prepared. Maximum likelihood (ML) and Bayesian inference analyses were performed to clarify the phylogenetic relationships among species and specimens within sect. Genuina. Phylogenetic trees were constructed based on the ML methods using IQ-TREE 2 (Minh et al., 2020). For ML analysis, the TPM2+F+I model for ITS1-5.8S-ITS2, HKY+F+G4 model for IGS1, K2P+I model for rpb2, TNe+G4 model for tef-1a, were selected as the best fit substitution models using BIC with ModelFinder (Kalyaanamoorthy et al., 2017). For construction of a concatenated phylogenetic tree based on data of the four DNA loci, we preliminarily created an alignment file in which four DNA loci in each sample were concatenated, and the concatenated sequences were distinguished and analyzed as partition files. Branch support was evaluated by bootstrap analysis with 1000 replicates using the ultrafast bootstrap option (Minh et al., 2013), approximate Bayesian test (Anisimova et al., 2011), and SH-nLRT branch test (Guindon et al., 2010). Outgroup sequences were designated T. roseoacerbum A. Riva and T. imbricatum (Fr.) Sacc. based on phylogenetic trees in Ding et al. (2023). Tricholoma roseoacerbum was selected as the outgroup for the ITS, rpb2, and tef-1a, and the outgroup of IGS1 was used T. imbricatum. Outgroup of the concatenated tree was used the ITS, IGS1, rpb2, and tef-1a that were extracted from whole genome data of Lyophyllum atratum (Fr.) Singer (JACGCN010000000). Phylogenetic trees were edited using Figtree v. 1.4.4 (http://tree.bio.ed.ac.uk/software/figtree/). We deposit to TreeBASE (https://www.treebase.org) about method of phylogenetic analysis, alignment, and trees (ID: S31100). In addition, we compute the average distances between groups of taxa in the ITS, rpb2 and tef-1a alignments with MEGA 11 plugin (Tamura et al., 2021).

Table 2. PCR Primers used in this study.

Target region	Primer name	sequence (5’→3’)	Tm (℃)	Reference
ITS	ITS1F (F)	CTTGGTCATTTAGAGGAAGTAA	55	1
	ITS4 (R)	TCCTCCGCTTATTGATATGC	60	2
IGS1	CNL13 (F)	CTGAACGCCTCTAAGTCAG	56	3
	5S-Anderson (R)	CAGAGTCCTATGGCCGTGGAT	66	4
rpb2	rpb2_tu_f1 (F)	CTGTCGGYTCYTATTCTGC	53	5
	rpb2_tu_r1 (R)	GCTRGGATGAATCTCACAATG	52	5
tef-1a	983F (F)	GCYCCYGGHCAYCGTGAYTTYAT	53	6
	EF-983R (R)	CCRGCRACRGTRTGTCTCAT	51	7
	tef1_tu_f1 (F)	GTGAACAAGATGGACACYAC	53	5
	tef1_tu_r1 (R)	GACAACGTYGGYTTCAAC	51	5

1: Gardes and Bruns (1993), 2: White et al. (1990), 3: Anderson and Stasovski (1992), 4: Henrion et al. (1992), 5: Aoki et al. (2021), 6: Rehner and Buckley (2005), 7: fLutzoni laboratory, AFToL.

We performed microscopic observation of lamella, pileal surface, and stipe surface, measurement of cell size, and comparisons of these data between specimens distinguished by phylogenetic analyses. Small amounts of mycelial tissues were cut from each dried basidioma specimen, rehydrated in 2-3 mL of 5% KOH solution for 30 min, transferred to 2-3 mL of DW, and incubated for 30 min. Lamella were sectioned with a razor. Fully rehydrated tissues were mounted on glass slides using lactic acid and observed under a differential interference contrast (DIC) microscope with a 100× oil-immersion objective lens (BX51N-33; Olympus, Tokyo, Japan, or AXIO Scope 2; Carl Zeiss, Göttingen, Germany). The lengths and widths of cells were measured at a resolution of 0.1 µm on recorded micrographs using ImageJ (https://imagej.nih.gov/ij/). The Q-value (length/width ratio) of each spore was calculated. Measured numerical data were subjected to statistical analyses. For most samples, the shortest 5% of all measured spore length data (n ≥ 50) were excluded from the evaluation because such spores were most likely immature. The minimum-average-maximum values are indicated in each description as outlined below. For the morphological definition of T. albobrunneum, we followed Christensen and Heilmann-Clausen (2013). In addition, we conducted DIC microscopy for the holotype specimen of T. albobrunneum C-F-59411 (MC97-233) sampled in Denmark (Christensen & Heilmann-Clausen, 2013).

The phylogenetic trees of ITS and IGS1 of rDNA showed several subclades in T. albobrunneum (Figs. 1, 2), with Japanese T. albobrunneum specimens distinguished into two subclades, i.e., the Honshu Island group and Rishiri Island group (Fig. 2). The Honshu Island group had slight support as a monophyletic linage (BP/PP/SH-aLRT) and the Rishiri Island group belonged to the same clade as several Danish T. albobrunneum specimens. However, the tef-1a (Supplementary Fig. S1) tree showed a single clade for all Japanese specimens, including those form Hokkaido, which was independent from the European (Denmark and Estonia) T. albobrunneum clade. In addition, the rpb2 tree (Supplementary Fig. S2) included the Danish T. albobrunneum subclade within the Japanese T. albobrunneum clade. The concatenated phylogenetic tree based on nuc rDNA ITS and IGS1, tef-1a, and rpb2 sequences showed three distinct clades in T. albobrunneum with well supported values, i.e., the Honshu Island clade, Rishiri Island clade, and European clade (Fig. 3). The Honshu Island clade - Rishiri Island clade - European clade were shown low distance between taxa and tentative species, in ITS region, rpb2 and tef-1a (Supplementary Tables S2-S4).

Fig. 1 - ML phylogenetic trees of the nuc rDNA ITS region of Tricholoma albobrunneum and related species. Several known Tricholoma species within sect. Genuina were analyzed as outgroup species. Approximate Bayesian posterior probability (aBayes) and ultrafast bootstrap support (UFBoot). Thick nodes indicate significant support by statistical tests, UFBoot > 95%, aBayes > 0.95, and SH-aLRT > 85%. Double thin-line nodes indicate significant supported by two statistical tests.

Fig. 2 - ML phylogenetic trees of the IGS region of Tricholoma albobrunneum and related species. Several known Tricholoma species within sect. Genuina were analyzed as outgroup species. Approximate Bayesian posterior probability (aBayes) and ultrafast bootstrap support (UFBoot). Thick nodes indicate significant support by statistical tests, UFBoot > 95%, aBayes > 0.95, and SH-aLRT > 85%. Double thin-line nodes indicate significant supported by two statistical tests.

Fig. 3 - ML phylogenetic tree of concatenated sequences of ITS and IGS1 regions, tef-1a, and rpb2 loci of Tricholoma albobrunneum and related species. Several known Tricholoma species within and outside sect. Genuina were analyzed as outgroup species. Thick nodes indicate significant support by statistical tests, UFBoot > 95%, aBayes > 0.95, and SH-aLRT > 85%. Double thin-line nodes indicate significant supported by two statistical tests.

Based on the concatenated phylogenetic tree data (Fig. 3), we compared T. albobrunneum specimens sampled from Honshu Island, Rishiri Island, and Europe (Table 3). All T. albobrunneum specimens sampled from these three geographic regions showed common pileal surface characteristics, i.e., dark reddish brown to reddish brown in color and viscid when moist. Specimens from Honshu Island showed a striate-like structure at the pileal margin (Fig. 4), while this characteristic was very faintly or absent in those from Rishiri Island and Europe (Christensen & Heilmann-Clausen, 2013) (Fig. 4). The lamella density was similar in the Honshu Island and European specimens, while the Rishiri Island specimens had a lower density. In addition, all Honshu Island specimens were collected under temperate two-needle pine trees, i.e., coastal Pinus thunbergii and inland P. densiflora, while Rishiri Island specimens were collected under alpine five-needle pine shrubs, i.e., P. pumila. However, T. albobrunneum specimens from these three different regions showed similar basidiospore size (Supplementary Fig. S3). Based on these phylo-morpho-ecological data, Japanese T. albobrunneum specimens were assigned into two new species as described below.

Table 3. Comparison of morphological and ecological characteristics and geographic distribution of Tricholoma albobrunneum sensu lato.

Characteristics	Honshu Island Clade	Rishiri Island Clade	European Clade
	TUA-127 (TNS-F-83195)*	TUA-2 (TNS-F-83198)*	Christensen and Heilmann-Clausen (2013)	MC97-233 (C-F-59411)*
Pileus	Convex, reddish brown to dark brown, striate structure in pileus margin.	Flat to semispherical, reddish brown, striate absent.	30-90 mm, Convex to flat, pale brown to reddish brown.
Gill	White, sinuate, close, brown stain when old.	White, sinuate, roughly close or distance, brown stain.	Adnate to sinuate, medium spaced, white to pinkish, brown stained in old.
Stipe	White or pale brown, cylindric or tapering upwards.	White to pale brown, cylindric.	30-100 × 7-20 mm, tapering toward the base.
Spore	Ellipsoidal, length 4.5-4.9-5.7 μm, width 3.1-3.5-3.9μm, Q-value 1.3-1.4-1.5.	Ellipsoidal, length 3.7-4.6-5.9 μm, width 2.7-3.3-4.3 μm, Q-value 1.1-1.4-1.7.	Ellipsoidal, length 4.3-6.4 μm (ave. 5.0-5.7μm), width 2.9-4.3 µm (ave. 3.3-3.8 µm), Q-value 1.2-1.9 (ave. 1.44-1.56).	Ellipsoidal, length 4.2-4.9-5.7 μm, width 2.8-3.2-3.9 μm, Q-value 1.4-1.6-1.8.
Basidia	Length 23.3-27.9-31.5 µm, width 3.9-5.9-6.8 µm.	Length 23.0-27.1-34.1 µm, width 5.3-6.3-7.5 µm.	Length 30-40 µm, width 4.0-6.0 µm.	Length 20.9-24.2-31.9 µm, width 3.7-5.1-5.8 µm.
Pileipellis	Cyllindrical, clamp connection absent, length 49.4-61.3-72.9 µm, width 4.6-5.2-5.8 µm.	Cyllindrical, clamp connection absent, length 28.6-60.3-124.6 µm, width 3.3-5.1-9.0 µm.	Cyllindrical, clamp connection absent, length 30-80 µm, width 4.0-5.0 µm.
Habitat	Under two-needle pine, nutrient- poor soil site, Sep-Dec, rarely Jun	Under P. pumila, Sep.	Under two-needle pine, sandy soil of poor nutrient site, Sep-Oct	Under Pinus nigra and P. mugo.
Distribution	Honshu Island to Kyushu Island, Japan.	Mt. Rishiridake, Rishiri Island, Hokkaido, Japan.	Southern to northern Europe.	Denmark

* Cell sizes in these specimens are indicated as minimum-average-maximum.

Fig. 4 - Morphological characters of Tricholoma matsushimeji. A, B: external morphology of basidiomata TUA-127 (sampled under Pinus thunbergii) and TUA-78 (sampled under P. densiflora), respectively. The basidiomata in A are identical to those in Fig. 5A by Aoki et al. (2021). C: Basidiomata TUA-128 (sampled under P. thunbergii) showing indistinguishable striate structure on the pileal margin. D: Mature and young basidiomata (TUA-118), identical to that in Fig. 5B by Aoki et al. (2021). E: Drawing of OMNH1938 (Hongo collection), which had been identified as T. ustale (Fr.) P. Kummer by T. Hongo. F: Mature basidiospores (TUA-127). G: Mature basidia (TUA-127). H: Pileipellis and its constituting hyphae (TUA-127). I: Stipitipellis hyphae (TUA-127). Bars: A-D 2 cm; F, G 10 μm; H, I 20 μm.

Tricholoma matsushimeji W. Aoki & A. Yamada, sp. nov.

MycoBank no.: MB 847767.

Fig. 4.

= T. albobrunneum (Pers. ex Fr.) Quél. sensu Imai, S. (1938). Studies on the Agaricaceae of Hokkaido. I, Journal of the Faculty of Agriculture, Hokkaido Imperial University, 43, 68.

= T. albobrunneum (Pers.) P. Kumm. sensu Aoki et al. (2021). Mycoscience, 62, 319.

Diagnosis: Tricholoma matsushimeji is closely related to European T. albobrunneum, but they were separated from each other by phylogenetic analyses (Fig. 2; Supplementary Figs. S1, S2), distinct striate-like structure at the pileal margin, and Q-value of basidia size (Table 3).

Type: JAPAN, Tottori Prefecture, Tottori, Hamasaka, in a coastal Pinus thunbergii forest, N 35°32′03.3″, E 134°12′58.2″, alt. 35 m, 13 Nov 2019: leg, W. Aoki (Holotype, TNS-F-83195 [= TUA-127]).

Gene sequences ex-holotype: LC574899 (nuc rDNA ITS: Honshu Island Clade, Fig. 3-1), LC587198 (nuc rDNA IGS), LC587119 (tef-1a), LC586907 (gapdh), LC586862 (rpb2), LC587153 (mt rDNA SSU).

Etymology: “matsu” and “shimeji” mean pine tree and fleshy mushroom, respectively, in Japanese.

Japanese common name: Matsushimeji adopted by S. Imai (1938) from the old name of this mushroom in Japan.

Description: Pileus first convex and later flat, margin involved and flat when mature, reddish brown, dark brown in the center, and paler color at the margin, surface innately fibrillose, margin fibrillose and striate, viscid when moist (Fig. 4A-E). Stipe white to pale brown, cylindrical to slightly tapering toward the base, hollow or medullary, powdery at the top surface (Fig. 4B, D, E). Lamella white, close, sinuate to the stipe, later brownish with distinct brown stain (Fig. 4B, D, E). Flesh white, thick, negative on guaiac test (Fig. 4D), smell farinaceous, taste slightly bitter in the pileal surface and mild in the flesh. Basidiospores 4.5-4.9-5.7 × 3.1-3.5-3.9 μm, Q = 1.3-1.4-1.5, ellipsoidal to broadly ellipsoidal, single intracellular large transparent oily droplet in fresh material (Fig. 4F). Basidia 23.1-26.0-27.9 × 4.9-5.5-6.3 μm, clavate to cylindrical, four-spored, several intracellular transparent oily droplets in fresh material, non-amyloid, clamp connections not observed on the basal septum of the basidium, sterigmata 2.4-3.1-3.8 × 0.9-1.3-1.5 μm (Fig. 4G), pleurocystidia and cheilocystidia not observed. Pileipellis ixocutis to ixotrichoderm, constituting hyphae 49.4-61.3-72.9 × 4.6-5.2-5.8 μm, cylindrical, intracellular brown pigment, no clamp connections (Fig. 4H). Stipitipellis cutis, constituting hyphae 31.3-53.6-82.5 × 5.0-6.7-9.6 μm (TUA-127), hyaline to pale brown, smooth, cylindrical, no clamp connections (Fig. 4I).

Specimens examined: JAPAN: Nagano Prefecture: TUA-4 (A. Yamada), TUA-78 (W. Aoki), TUA-118 (W. Aoki), TUA-119 (W. Aoki), OMNH 2802 (T. Hongo); Tottori Prefecture: TUA-127 (W. Aoki), TUA-143 (W. Aoki), TaY20181117-001 (N. Endo); Ishikawa Prefecture: TNS-F-18996 (Y. Ikeda); Ibaraki Prefecture: TMI Fukuroda 52 (S. Imai); Shiga Prefecture: OMNH 1756 (T. Hongo), OMNH 1938 (T. Hongo), OMNH 1947 (T. Hongo), OMNH 3008 (T. Hongo), OMNH 3606 (T. Hongo).

Ecology: Tricholoma matsushimeji specifically fruits under two-needle pine trees, i.e., Pinus thunbergii and P. densiflora, established on coastal sandy soil land and inland mountain areas in the temperate zone, fruiting in Sep-Dec, rarely in Jun.

Comment: basidia of T. matsushimeji are smaller than those of European T. albobrunneum. Pileipellis hyphae of T. matsushimeji are longer than those of European T. albobrunneum. T. matsushimeji was first reported as T. albobrunneum (Pers.) Quélet by Imai (1938). We previously identified T. matsushimeji as Japanese T. albobrunneum (Aoki et al., 2021), and discussed the historical transition of this fungus identification in Japan (Imazeki, 1942; Imazeki & Hongo, 1965, 1987). Specimens identified as T. ustale by T. Hongo (OMNH 1756, OMNH 1938, OMNH 1947, OMNH 3008, OMNH 3606) were all identified as T. matsushimeji based on characteristics of the fruiting body and measurement of spores and basidia size. The TMI Fukuroda 52 specimen (Imai, 1938) was not selected as the holotype of T. matsushimeji because its DNA data were not obtained for phylogenetic analyses. Tricholoma matsushimeji specimens in the Hongo collection were also not selected as the holotype of T. matsushimeji. Mycelial cultures AT-0610 (= NBRC 33139) and AT-0612 (= NBRC 33141) reported as T. ustale (Yamada et al., 2010) were identified as T. matsushimeji. Both mycelial cultures were reidentified as T. albobrunneum based on multi-gene phylogenetical analysis, in Aoki et al. (2021).

Tricholoma miyama-matsushimeji W. Aoki & A. Yamada, sp. nov.

MycoBank no.: MB 847768.

= Tricholoma albobrunneum (Fr.) P. Kummer sensu Aoki et al. (2021). Mycoscience, 62, 319.

Fig. 5.

Fig. 5 - Morphological characters of Tricholoma miyama-matsushimeji. A: External morphology of basidiomata in the field. B: Basidiospores. C: Basidia. D: Pileipellis and its constituting hyphae. Bars: B, C 10 μm.

Diagnosis: Tricholoma miyama-matsushimeji showed phylogenetic differences from T. albobrunneum on tef-1a and rpb2 analyses, and from T. matsushimeji on nuc rDNA ITS and IGS1 analyses. T. miyama-matsushimeji is distinguishable from both phylogenetically related T. matsushimeji and T. albobrunneum by the lower lamella density, and from T. matsushimeji by the habitat.

Type: Japan, Hokkaido Prefecture, Rishiri Island, Mt. Rishiri-dake, in Pinus pumila shrubs: 4 Sep 2008: leg, A. Yamada (Holotype, TNS-F-83198 [TUA-2 and AY2080904-002]).

Gene sequences ex-holotype: LC574919 (nuc rDNA ITS; Rishiri Island Clade: Fig. 2), LC587191_clone1, LC587192_clone2 (nuc rDNA IGS), LC587145 (tef-1a), LC586933 (gapdh), LC586893 (rpb2), LC587177 (mt rDNA SSU), LC587106 (atp6).

Etymology: “miyama” means “deep in the mountains” in Japanese, and “matsushimeji” indicate as resemble to “T. matsushimeji”.

Japanese common name: “Miyama-matsushimeji” was found in Pinus pumila shrubs and is closely related to T. matsushimeji.

Description: Pileus flat to convex, margin wave, center brown, margin pale brown, surface smooth to innately fibrillose and slightly striate or lacking, viscid when moist (Fig. 5A). Stipe white to pale brown, powdery at the top surface (F). Lamella white, close, sinuate to the stipe, later brownish stain occurred (Fig. 5A). Basidiospores 3.7-4.6-5.9 × 2.7-3.3-4.3 μm, Q = 1.1-1.4-1.7, ellipsoidal to predominantly ellipsoidal (Fig. 5B). Basidia 23.0-27.1-34.1 × 5.3-6.3-7.5 μm, clavate to cylindrical, two- or four-spored, non-amyloid, clamp connections not observed on the basal septum of the basidium, sterigma 1.9-3.6-5.5 × 1.1-1.5-1.8 μm, pleurocystidia and cheilocystidia not observed (Fig. 5C). Pileipellis ixocutis to ixotrichoderm, constituting hyphae 28.6-60.3-124.6 × 3.3-5.1-9.0 μm, cylindrical, intracellular brown pigment, no clamp connections (Fig. 5D).

Specimens examined: JAPAN: Hokkaido Prefecture: TUA-1 (=AY2080904-001) (A. Yamada).

Ecology: T. miyama-matsushimeji fruits in autumn under P. pumila shrubs.

Comments: T. miyama-matsushimeji was placed phylogenetically between T. albobrunneum and T. matsushimeji in the concatenated tree based on four DNA loci. This species is only found from Rishiri Island. It is not clear whether this species is distributed in P. pumila shrubs in the region, such as Honshu Island in Japan and Siberia in Russia.

We reevaluated Japanese T. albobrunneum specimens and found two new taxa that are different from European T. albobrunneum. T. matsushimeji, T. miyama-matsushimeji, and T. albobrunneum showed common features, e.g., similar external morphology of basidiomata and almost identical basidiospore size (Aoki et al., 2021; Christensen & Heilmann-Clausen, 2013; Riva et al., 2003) (Supplementary Fig. S3). Therefore, it is difficult to distinguish these three species based on morphology alone. However, T. matsushimeji showed distinct striate-like structures on the pileal margin. This characteristic is also faintly seen in T. striatum (Schaeff.) Sacc. (e.g., Riva et al., 2003), which is a synonym of T. albobrunneum (Christensen & Heilmann-Clausen, 2013; Hansen & Knudsen, 1992). However, most European T. albobrunneum and North American T. aff. albobrunneum have not been described as having a distinct striate-like structure on the pileal margin (Christensen & Heilmann-Clausen, 2013; Jacques et al., 2022). These observations suggest that the striate-like structure on the pileal margin may not clearly distinguish these related species.

The rate of divergence among T. albobrunneum, T. matsushimeji and T. miyama-matsushimeji was significant but not high compared with other species in sect. Genuina. Therefore, the gene and regions used in the present study were not necessarily sufficient to identify these three species. Further research is needed to find suitable genes or DNA markers that can easily distinguish these species by a single PCR test. However, the geographic distributions and host pine associations strongly supported the independence of the two Japanese T. albobrunneum-related species, i.e, T. matsushimeji and T. miyama-matsushimeji described here as new species.

Disclosure

The authors declare no conflicts of interest. All of the experiments in this study were performed in compliance with the current laws of Japan.

Acknowledgement

We thank Daisuke Sakuma, Naoki Endo, Yuichi Tamai and Christian Lange for providing us specimens and information in the habitat of fungal materials. We also thank the staff of the Research Center for Human Environmental Sciences, Shinshu University, for the DNA sequencing. This work was supported by JST SPRING, Grant Number JPMJSP2144.

References

• Anisimova, M., Gil, M., Dufayard, J. F., Dessimoz, C., & Gascuel, O. (2011). Survey of branch support methods demonstrates accuracy, power, and robustness of fast likelihood-based approximation schemes. Systematic Biology, 60, 685-699. https://doi.org/10.1093/sysbio/syr041
• Anderson, J. B., & Stasovski, E. (1992). Molecular phylogeny of northern hemisphere species of Armillaria. Mycologia, 84, 505-516. https://doi.org/10.1080/00275514.1992.12026170
• Aoki, W., Bergius, N., Kozlan, S., Fukuzawa, F., Okuda, H., Murata, H., Ishida, T. A., Vaario, L.-M., Kobayashi, H., Kalmiş, E., Fukiharu, T., Gisusi, S., Matsushima, K., Terashima, Y., Narimatsu, M., Matsushita, N., Ka, K.-H., Yu, F., Yamanaka, T., Fukuda, M., & Yamada, A. (2022). New findings on the fungal species Tricholoma matsutake from Ukraine, and revision of its taxonomy and biogeography based on multilocus phylogenetic analyses. Mycoscience, 63, 197-214. https://doi.org/10.47371/mycosci.2022.07.004
• Aoki, W., Endo, N., Ushijima, S., Nagai, H., Ito, T., Fukuda, M., & Yamada, A. (2021). Taxonomic revision of the Japanese Tricholoma ustale and closely related species based on molecular phylogenetic and morphological data. Mycoscience, 62, 307-321. https://doi.org/10.47371/mycosci.2021.06.002
• Christensen, M., & Heilmann-Clausen, J. (2013). The genus Tricholoma - Fungi of Northern Europe - vol. 4. Tilst, Denmark: Svampetryk.
• Ding, X. X., Xu, X., Cui, Y. Y., Kost, G., Wang, P. M., & Yang, Z. L. (2023). A fifty-locus phylogenetic analysis provides deep insights into the phylogeny of Tricholoma (Tricholomataceae, Agaricales). Persoonia, 50, 1-26. https://doi.org/10.3767/persoonia.2023.50.01
• Ding, X. X., Cui, Y. Y., & Yang, Z. L. (2022). Two new species of Tricholoma sect. Genuina (Agaricales) from China based on molecular phylogenetic and morphological evidence. Mycological Progress, 21, 37. https://doi.org/10.1007/s11557-022-01797-x
• Gardes, M., & Bruns, T. D. (1993). ITS primer with enhanced of specificity for basidiomycetes - application to the identification of mycorrhizae and rusts. Molecular Ecology, 2, 113-118. https://doi.org/10.1111/j.1365-294X.1993.tb00005.x
• Grubisha, L. C., Levsen, N., Olson, M. S., & Taylor, D. L. (2012). Intercontinental divergence in the Populus-associated ectomycorrhizal fungus, Tricholoma populinum. New Phytologist, 194, 548-560. https://doi.org/10.1111/j.1469-8137.2012.04066.x
• Guindon, S., Dufayard, J.-F., Lefort, V., Anisimova, M., Hordijk, W., & Gascuel, O. (2010). New algorithms and methods to estimate maximum-likelihood phylogenies: assessing the performance of PhyML 3.0. Systematic Biology, 59, 307-321. https://doi.org/10.1093/sysbio/syq010
• Hansen, L. & Knudsen H. (1992). Nordic Macromycetes Vol. 2. Copenhagen: Nordsvamp.
• Heilmann-Clausen, J., Christensen, M., Frøslev, T. G., & Kjøller, R. (2017). Taxonomy of Tricholoma in northern Europe based on ITS sequence data and morphological characters. Persoonia, 38, 38-57. http://dx.doi.org/10.3767/003158517X693174
• Henrion, B., Le Tacon, F., & Martin, F. (1992). Rapid identification of genetic variation of ectomycorrhizal fungi by amplification of ribosomal RNA genes. New Phytologist, 122, 289-298. https://doi.org/10.1111/j.1469-8137.1992.tb04233.x
• Hiroe, I. (1949). Science of fungi (In Japanese). Osaka, Fuminsha.
• Imai, S. (1938). Studies on the Agaricaceae of Hokkaido. I, Journal of the Faculty of Agriculture, Hokkaido Imperial University, 43, 1-178.
• Imazeki, R. (1942). Colored illustrations of mushroom: How to collect and identification of mushrooms (In Japanese). Tokyo: Sanseido.
• Imazeki, R., & Hongo, T. (1957). Colored illustrations of fungi of Japan (In Japanese). Osaka: Hoikusha.
• Imazeki, R., & Hongo, T. (1965). Colored illustrations of fungi of Japan, vol. II (In Japanese). Osaka: Hoikusha.
• Imazeki, R., & Hongo, T. (1987). Illustrations of mushrooms of Japan, vol. I (In Japanese). Osaka: Hoikusha.
• Ito, T., Nagai, H., Aoki, W., Yamada, A., Kawagishi, H., Fukaya M., & Konishi, H. (2021). Quantification of ustalic acid, a chemotaxonomic marker, in Tricholoma ustale using liquid chromatography-mass spectrometry. Journal of natural Medicines 75, 688-691. https://doi.org/10.1007/s11418-021-01496-z
• Jacques, L., Lamoureux, Y., & Lebeuf, R. (2022). Répertoire des tricholomes du Québec (In French). Quebéc: Mycoqébec.
• Kalyaanamoorthy, S., Minh, B., Wong, T., Haeseler, A., & Jermiin, L. (2017). ModelFinder: fast model selection for accurate phylogenetic estimates. Nature Methods, 14, 587-589. https://doi.org/10.1038/nmeth.4285
• Kurogi, S. (2015). Mushrooms in Miyazaki (In Japanese). Miyazaki: Koumyakusha.
• Larkin, M. A., Blackshields, G., Brown, N. P., Chenna, R., McGettigan, P. A., McWilliam, H., Valentin, F., Wallace, I. M., Wilm, A., Lopez, R., Thompson, J. D., Gibson T. J., & Higgins, D. G. (2007). ClustalW and ClustalX version 2.0. Bioinformatics Applications Note, 23, 2947-2948. https://doi.org/10.1093/bioinformatics/btm404
• Minh, B. Q., Heiko A Schmidt H. A., Chernomor, O., Schrempf, D., Woodhams, M. D., Haeseler, A. V., & Lanfear, R. (2020). IQ-TREE 2: New Models and Efficient Methods for Phylogenetic Inference in the Genomic Era. Molecular Biology and Evolution, 37, 1530-1534. https://doi.org/10.1093/molbev/msaa131
• Minh, B. Q., Nguyen, M. A. T., & Haeseler, A. (2013). Ultrafast approximation for phylogenetic bootstrap. Molecular Biology and Evolution, 30, 1188-1195. https://doi.org/10.1093/molbev/mst024
• Rehner, S. A., & Buckley, E. (2005). A Beauveria phylogeny inferred from nuclear ITS and EF1-alpha sequences: evidence for cryptic diversification and links to Cordyceps teleomorphs. Mycologia, 97, 84-98. https://doi.org/10.1080/15572536.2006.11832842
• Reschke, K., Popa, F., Yang, Z. L., & Kost, G. (2018). Diversity and taxonomy of Tricholoma species from Yunnan, China, and notes on species from Europe and North America. Mycologia, 110, 1081-1109. https://doi.org/10.1080/00275514.2018.1512295
• Riva, A., Dermek, A., Rebaudengo, E., & Beati, JP. (2003). Fungi Europaei, Volume 3: Tricholoma (In Italian). Edizioni Candusso: Milan.
• Romagnesi, H. (1971). Petit atlas des champignons tome 2. Paris: Bordas.
• Tamura, K., Stecher, G., Kumar, S. & Battistuzzi F. U. (2021). MEGA11: Molecular Evolutionary Genetics Analysis Version 11. Molecular Biology and Evolution, 38, 3022-3027. https://doi.org/10.1093/molbev/msab120
• White, T. J., Bruns, T., Lee, S., & Taylor, J. (1990). Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis, M. A., Gelfand, D. H., Sninsky, J. J., & White, T. J. (eds), PCR Protocols: A guide to methods and applications (pp. 315-322). San Diego: Academic Press.
• Yamada, A., Kobayashi, H., Murata, H., Kalmiş E., Kalyoncu, F., & Fukuda, M. (2010). In vitro ectomycorrhizal specificity between the Asian red pine Pinus densiflora and Tricholoma matsutake and allied species from worldwide Pinaceae and Fagaceae forests. Mycorrhiza, 20, 333-339. https://doi.org/10.1007/s00572-009-0286-6