Cercospora hokkaidensis: A Novel Species Associated with Leaf Spot in Sugar Beet (Beta vulgaris) in Hokkaido, Japan

Abstract

Cercospora leaf spot (CLS), caused by Cercospora beticola, is a devastating foliar disease of sugar beet (Beta vulgaris) that imposes a major constraint on yields worldwide. Various Cercospora species have recently been reported on sugar beet associated with CLS globally. The diversity of Cercospora species on CLS that occurred in Hokkaido, Japan, was examined based on the phylogenetic analyses in this study. These isolates of Cercospora species were divided into three groups based on multi-loci molecular phylogenetic analyses with a combined matrix of DNA sequences composed of rDNA ITS, actin, calmodulin, histone, and translation elongation factor. In addition, the ATP binding cassette transporter (ATR) gene sequences were newly introduced for multi-loci phylogenetic analyses as an alternative locus. Japanese Cercospora isolates from B. vulgaris formed well-supported clades by bootstrap values, which were recognized as C. beticola, C. cf. resedae, and an unknown lineage of Cercospora species. From these results, Cercospora hokkaidensis, isolated from sugar beet in three locations across Hokkaido, was described in this study. Moreover, ATR was proposed as a new candidate species barcoding region to recognize Cercospora species.

1. Introduction

Sugar beet (Beta vulgaris L.) is a biennial plant belonging to the family Amaranthaceae and was domesticated from sea beet along the Mediterranean coast (Sandell et al., 2022). It is an essential crop grown primarily in temperate regions, utilized as a source of sugar and feed, and accounts for around 25% of global sugar consumption (Tayyab et al., 2023). As of 2022, ca. 261 million tons of sugar beet are produced worldwide on ca. 4.3 million hectares of cultivation area across 55 countries. Grown mostly in cold climates in the Northern Hemisphere, the leading producers are Russia, France, the United States, Germany, Turkey, Poland, Egypt, Ukraine, China, and Japan (World Food and Agriculture, 2022).

Cercospora beticola Sacc., a fungal pathogen that causes Cercospora leaf spot, is the most destructive foliar disease affecting sugar beet worldwide. Economic losses and a decrease in yield result from this widespread disease (Chen et al., 2024; Tan et al., 2023), which has been confirmed in sugar beet-producing regions worldwide, causing significant economic losses to sugar beet cultivation and the sugar industry (Rangel et al., 2020). Leaf spots are scattered on both surfaces, 2-4 mm diam, later enlarged, and when it becomes severe, the leaves die (Rangel et al., 2020). According to agroclimatic conditions, the disease can result in considerable reductions in sugar output, and it consequently brings on significant financial losses if outbreaks are not effectively managed without the usage of resistant varieties (Jay et al., 2020; Skaracis et al., 2011). The application of chemical sprays is the main control measure in Japan (Kayamori et al., 2021). However, over-reliance on previously used chemicals, including methyl benzimidazole carbamate, QoI, and DMI, led to the selection of fungicide-resistance strains in many C. beticola populations, which has caused several outbreaks in recent years (Bolton et al., 2012; Kayamori et al., 2021; Kumar et al., 2021; Shrestha et al., 2020).

The absence of distinct morphological characteristics of the genus Cercospora has made the host-plant association a key factor in species delimitation (Braun et al., 2013; Crous & Braun, 2003). However, the broader host ranges observed in some taxa have rendered this criterion unreliable for taxonomy (Groenewald et al., 2013). Recent taxonomic studies have highlighted the phylogenetic relationship based on the multi-locus DNA sequence data. The challenge of species delimitation in Cercospora remains due to high levels of sequence conservation to the commonly used loci, such as ITS, actin (act), calmodulin (CaM), histone (his), and translation elongation factor-1a (tef), (Groenewald et al., 2013; Bakhshi et al., 2020). Thereafter, numerous cryptic species and polyxenic species having wide host ranges have been recognized, including C. apii (Fuckel) Fresen., C. armoraciae Sacc., C. cf. flagellaris, and Cercospora sp. G, remained unresolved even with a five-gene phylogenetic analysis (Bakhshi et al., 2015; Bakhshi et al., 2020; Chen et al. 2022). Cercospora species on sugar beet is not an exception. Although C. beticola has been known as the primary pathogen of sugar beet CLS for a long time, other Cercospora species have recently been globally reported from the phylogenetic relationship. Vaghefi et al. (2018) revealed the diversity of Cercospora species on Beta. They reported C. apii from the United Kingdom, as well as Cercospora sp. G, C. cf. flagellaris, and C. zebrina Pass. from the USA by adding the sequences of the gene encoding for the cercosporin facilitator protein (cfp) to the concatenated sequence matrix of Cercospora species. Bakhshi and Zare (2020) isolated C. gamsiana M. Bakhshi & Crous from lesions on sugar beet from Iran by adding the sequences of RNA polymerase II gene encoding the second largest protein subunit (rpb2) and glyceraldehyde-3-phosphate dehydrogenase (gapdh), and Vaghefi et al. (2021) reported C. americana Vaghefi, S.J. Pethybridge & R.G. Shivas and C. tecta Vaghefi, S.J. Pethybridge & R.G. Shivas from lesions on Swiss chard and table beets from the USA. In the case of the plant pathogenic Cercospora species, non-host-specific toxin cercosporin (Daub, 1982) plays an important role in the process of infection and colonization. On the other hand, the production ability of cercosporin is known only from several species or strains of thousands of species. In addition, there have been no reports of Cercospora species other than C. beticola on sugar beet in Japan. It is important to determine the involvement of Cercospora species in controlling this disease and its virulence against the various resistant cultivars against the CLS. To address this issue, the current study explores the ATP-binding cassette transporter (ATR) gene, a cercosporin auto-resistance gene encoding an ATP-binding cassette, as an additional candidate for species delimitation in the genus Cercospora. The objectives of this study are to: i) elucidate the diversity of Cercospora species associated with sugar beet CLS occurring in Japan using multi-loci molecular phylogenetic analyses with the five loci previously used in genus Cercospora (Groenewald et al., 2013); and ii) propose a robust locus for species barcoding discriminating Cercospora species on B. vulgaris.

2. Materials and methods

2.1 Sample Collection

A total of 43 fungal strains were established from the lesions of sugar beet showing CLS symptoms in 2014, 2015, 2017, and 2019 at four locations in Hokkaido, Japan (Table 1). The obtained isolates have been maintained in the culture collection of the Laboratory of Phytopathology, Mie University (TSU-MUCC), Tsu, Mie, Japan.

Table 1. List of examined isolates of Cercospora species on Beta vulgaris

Fungal Species	Isolate	MUCC1	Locality	Year of Isolation
Cercospora beticola	28	3417	Tokachi	2014
	52	3419	Tokachi	2014
	48	3420	Kamikawa	2015
	70	3421	West Okhotsk	2015
	83	3422	East Okhotsk	2015
	87	3423	West Okhotsk	2015
	98	3424	East Okhotsk	2015
	99	3425	East Okhotsk	2015
	G22	3426	Tokachi	2015
	J24	3427	Tokachi	2015
	KM31	3429	Kamikawa	2017
	Memu12	3431	Tokachi	2019
	Maku06	3432	Tokachi	2019
	KM37	3436	Kamikawa	2017
	KM43	3437	Kamikawa	2017
	KM45	3438	Kamikawa	2017
	OHK-17	3439	East Okhotsk	2015
	OHK-24	3440	East Okhotsk	2015
	OHK-34	3441	East Okhotsk	2015
	OHK-38	3442	East Okhotsk	2015
	OHK-44	3443	East Okhotsk	2015
	OHK-45	3444	East Okhotsk	2015
	OHK-56	3445	East Okhotsk	2015
	OHK-57	3446	East Okhotsk	2015
	OHK-58	3447	East Okhotsk	2015
	OHK-59	3448	East Okhotsk	2015
	OHK-63	3451	East Okhotsk	2015
	OHK-65	3452	East Okhotsk	2015
	OHK-73	3453	East Okhotsk	2015
	OHK-75	3454	East Okhotsk	2015
	OHK-76	3455	East Okhotsk	2015
	OHK-79	3456	East Okhotsk	2015
	OHK-87	3457	East Okhotsk	2015
	OHK-88	3458	East Okhotsk	2015
	OHK-93	3459	East Okhotsk	2015
Cercospora cf. resedae	41	3418	Tokachi	2014
	KM14	3433	Kamikawa	2017
Cercospora hokkaidensis	J27	3428	Tokachi	2015
	KM15	3434	Kamikawa	2017
	KM20	3435	Kamikawa	2017
	OHK-61	3449	East Okhotsk	2015

¹MUCC: the culture collection of the Laboratory of Phytopathology, Mie University, Tsu, Mie, Japan.

2.2 Primer Design

The sequences of ATR gene from several Cercospora spp., including the sequences of C. beticola, C. nicotianae Ellis & Everh., and Cercospora sp. (Amnuaykanjanasin & Daub, 2009; de Jonge et al., 2018; Lin et al., 2022), were retrieved from the NCBI nucleotide database (https://www.ncbi.nlm.nih.gov/nucleotide/) and were used as templates for primer design. Primer sets were designed using Primer3Plus (Untergasser et al., 2007) to amplify the full-length nucleotide sequence of the ATR gene (Table 2).

Table 2. Primers used for the PCR amplification and sequencing in this study.

Locus	Primer Name	Direction	Primer Sequence (5ʹ-3ʹ)	Reference
Internal Transcribed Spacer (ITS)	V9G	Forward	TTACGTCCCTGCCCTTTGTA	de Hoog and van den Ende, 1998
	ITS4	Reverse	TCCTCCGCTTATTGATATGC	White et al., 1990
Translation Elongation Factor (tef)	EF1-728F	Forward	CATCGAGAAGTTCGAGAAGG	Carbone and Kohn, 1999
	EF1-986R	Reverse	TACTTGAAGGAACCCTTACC	Carbone and Kohn, 1999
Actin (act)	ACT-512F	Forward	ATGTGCAAGGCCGGTTTCGC	Carbone and Kohn, 1999
	ACT-783R	Reverse	TACGAGTCCTTCTGGCCCAT	Carbone and Kohn, 1999
Calmodulin (CaM)	CAL228F	Forward	GAGTTCAAGGAGGCCTTCTCCC	Carbone and Kohn, 1999
	CAL2Rd	Reverse	TGRTCNGCCTCDCGGATCATCTC	Groenewald et al., 2013
Histone (his)	CYLH3F	Forward	AGGTCCACTGGTGGCAAG	Crous et al., 2004
	CYLH3R	Reverse	AGCTGGATGTCCTTGGACTG	Crous et al., 2004
ATP Binding Cassette Transporter (ATR)	ATRRUF1	Forward	AGAAGCGCCCTACTGAACAA	This study
	ATRRUR1	Reverse	TGCACGATCGTAGAACCTTG	This study
	ATRRUF2	Forward	ACGAAAGCTCGGTGTCACTT	This study
	ATRRUR2	Reverse	TGCACGATCGTAGAACCTTG	This study
	ATRRUF3	Forward	GCTGAGTATGAGAGAACGTC	This study
	ATRRUR3	Reverse	TTGCGGATAAGCTGGTCTTC	This study
	ATRRUF4	Forward	AAAGTGTCTGGATTTGCGGT	This study
	ATRRUR4	Reverse	TTGCTCAGTGTCCCAGAAAC	This study
	ATRRUF5	Forward	GTTTGGACGGTCAAGCTGCA	This study
	ATRRUR5	Reverse	CCGATACCTGGAGGGAGTTG	This study
	ATRRUF6	Forward	TCGTCACTGGCCTCATCGT	This study
	ATRRUR6	Reverse	GGATCATCACCCTCGCTTTC	This study
	ATRRUF7	Forward	ACGGCATCTGCAACAAGTCC	This study
	ATRRUR7	Reverse	AAGTCTGCAAGAAGCTGTCG	This study
	ATRRUF8 a	Forward	CACACACACGAGACCAAGGT	This study
	ATRRUR8 a	Reverse	CAAAACGCTGCGGGATGAT	This study

^a ATRRUF8 & ATRRUR8: Primers newly proposed for amplification of Cercospora species barcode region

2.3 Molecular and Phylogenetic Analyses

Genomic DNA was extracted from the aerial mycelia of the isolates after seven d of culture on potato dextrose agar (PDA; Shimadzu Diagnostics Corporation, Tokyo, Japan) with DNeasy Ultra Clean Microbial Kit (Qiagen, Hilden, Germany) following the protocols provided by the manufacturer. Five genomic loci, namely ITS, act, CaM, his, and tef, were partially amplified by polymerase chain reaction with primers, which were used in the previous study for generating a backbone tree of the genus Cercospora (Groenewald et al., 2013) (Table 2). Additionally, the ATR gene was amplified utilizing the newly developed primers. The total volume of the PCR reaction mixture was 12.5 µL containing 1-10 ng of gDNA template, 1.6 µM of each primer, 2.5 mM of MgCl₂, 1.25 µL of 10 × NH₄ reaction buffer (Bioline, London, UK), 40 µM of dNTPs (Bioline), 0.5 U of Taq DNA polymerase (Bioline), and added sterilized Milli-Q water to its final volume. For tef, the final concentration of 5.6% dimethyl sulfoxide (DMSO; Sigma-Aldrich, St. Louis, MO) was added to the reaction mixture. Amplifications were performed on a thermal cycler (Bio-Rad T100; Bio-Rad Laboratories Inc., Tokyo, Japan). The PCR conditions were programmed as follows: for ITS, act, and his: initial denaturation at 94 °C for 5 min, 40 cycles of amplification (denaturation at 94 °C for 45 s, annealing at 48 °C for 30 s, and extension at 72 °C for 90 s), and final extension at 72 °C for 10 min; for tef: initial denaturation at 94 °C for 5 min, 40 cycles of amplification (denaturation at 94 °C for 30 s, annealing at 52 °C for 30 s, and extension at 72 °C for 45 s), and final extension at 72 °C for 2 min; CaM: initial denaturation at 95 °C for 10 min, 35 cycles of amplification (denaturation at 95 °C for 30 s, annealing at 52 °C for 45 s, and extension at 72 °C for 45 s), and final extension at 72 °C for 5 min; and ATR: initial denaturation at 94 °C for 2 min, 35 cycles of amplification (denaturation at 95 °C for 30 s, annealing at 60 °C for 30 s, and extension at 72 °C for 90 s), and final extension at 72 °C for 10 min. The amplicons were sequenced in both directions using the respective PCR primers and BigDye Terminator v3.1 Cycle Sequencing kit (Applied Biosystems, CA, USA) on an Applied Biosystems 3730xl DNA analyzer installed at the Mie University Advanced Science Research Promotion Center (Mie, Japan). All analyzed sequences were assembled and aligned as a concatenated matrix with seven sequences of Cercospora spp. retrieved from GenBank using the MEGA X software package (Kumar et al., 2018). Newly analyzed sequences were deposited in a DNA GenBank, as shown in Table 3.

Table 3. GenBank accession numbers of Cercospora species used in the phylogenetic analysis

Fungal Species	Strain No.	GenBank Accessions g						Reference
		ITS a	act b	ATR c	CaM d	his e	tef f
C. americana	HI-Ch-040	MK210521	MK210301	-	MK210334	MK210366	MK210404	Vaghefi et al., 2021
C. apii	QCYBC	JALBYB01000006	OQ790155.1	JALBYB01000004	OQ790156.1	OQ790157.1	OQ790158.1	Yang et al., 2023
C. beticola	S9-40 T	CP134192.1	NC_036775.1	NC_036773.1	XM_023601180.1	NC_036777.1	NC_036770.1	Wyatt et al., 2024; de Jonge et al., 2018
C. cf. flagellaris	CPC 1051	AY260069	JX143121	-	JX142875	JX142629	JX143367	Bakhshi et al., 2015, 2018
C. kikuchi	MAFF 305040	BOLY01000009	BOLY01000001	BOLY01000004	BOLY01000005	BOLY01000008	BOLY01000002	Kashiwa and Suzuki, 2021
C. cf. resedae	CPC 5057	DQ233319	DQ233369	-	DQ233421	DQ233395	DQ233343	Bakhshi et al., 2015, 2018
C. nicotianae	S1110	JANQAT0100000011	JANQAT000000001	JANQAT000000004	JANQAT0100000016	JANQAT000000000	JANQAT010000002	Kashiwa and Suzuki, 2021
C. beticola	MUCC3425	PP784262	PP793792	PP848226	PP793862	PP793827	PP848234	This study
C. beticola	MUCC3439	PP784271	PP793801	PP848227	PP793871	PP793836	PP848243	This study
C. beticola	MUCC3441	PP784273	PP793803	PP848228	PP793873	PP793838	PP848245	This study
C. beticola	MUCC3442	PP784274	PP793804	PP848229	PP793874	PP793839	PP848246	This study
C. beticola	MUCC3446	PP784278	PP793808	PP848230	PP793878	PP793843	PP848250	This study
C. cf. resedae	MUCC3418	PP789266	PP848262	PP848231	PP848266	PP848264	PP848260	This study
C. cf. resedae	MUCC3433	PP789267	PP848263	PP848232	PP848267	PP848265	PP848261	This study
Cercospora hokkaidensis	MUCC3428	PQ363090	PQ368141	PQ363013	PQ368153	PQ368149	PQ368145	This study
Cercospora hokkaidensis	MUCC3434 T	PQ363091	PQ368142	PQ363014	PQ368154	PQ368150	PQ368146	This study
Cercospora hokkaidensis	MUCC3435	PQ363092	PQ368143	PQ363015	PQ368155	PQ368151	PQ368147	This study

^a ITS: internal transcribed spacers and intervening 5.8S nrDNA. ^b act: actin. ^c ATR: ATP-binding cassette transporter. ^d CaM: calmodulin. ^e his: histone. ^f tef: translation elongation factor-1α. ^g Newly analyzed sequences in this study are indicated in bold. ^T: Type specimens

Maximum likelihood (ML) analyses using the ATR locus solely and five- or six-loci concatenated sequence matrix, composed of ITS, act, ATR, CaM, his, and tef, were conducted to estimate phylogenetic relationships. The backbone tree ML analyses were performed using RAxML-NG software (Kozlov et al., 2019). The best-fit substitution model computed by ModelTest-NG (Darriba et al., 2020) was applied to each locus based on the Akaike Information Criterion (AIC). The strength of the internal branches on the resultant trees was tested by bootstrap (BS) analysis (Felsenstein, 1985) using 1000 replications.

2.4 Cultural and Microscopic Characteristics

The morphological characteristics of the species identified in this study were observed under a compound-light microscope (Zeiss-AxioPhoto-ImagerA1; Zeiss, Göttingen, Germany) and a Scanning Electron Microscope (Hitachi S-4000; Hitachi, Ltd., Tokyo, Japan). For SEM observations, freshly collected symptomatic specimens were cut into small pieces. Those pieces were then fixed in 2% glutaraldehyde in 0.05 M phosphate buffer (pH 7.4) for 24 h at 4 °C and postfixed in 1% osmium tetroxide in 0.05 M phosphate buffer for 1 h. The fixed materials were dehydrated in a graded ethanol series and then transposed into 100% t-butyl alcohol. The dehydrated materials were freeze-dried using a t-butyl alcohol freeze dryer (model VFD-21S, Vacuum Device Inc., Ibaraki, Japan) and coated with gold using an Ion Sputter (Hitachi E-1010; Hitachi, Ltd., Tokyo, Japan). The coated materials were observed and photographed with the SEM operating at 10 kV.

Colony characteristics were recorded after seven d of the incubation period onto PDA. Color names are from Rayner (1970). Artificial sporulation was induced on Potato Carrot Agar (PCA; 20 g agar, 20 g carrot, 20 g potato per liter of distilled water, autoclaved at 121 °C for 20 min) after a wk of incubation at room temperature and then subjected to the inclined coverslip method (Kawato & Shinobu, 1960, revised in Nugent et al., 2006; Videira et al., 2017). Microscopic characteristics of conidia and the mode of conidial ontogeny were observed. Reference strains and specimens of the studied fungi are maintained in the culture collection (MUCC) and the herbarium (TSU-MUMH) of the Phytopathology Lab., Mie University, Tsu, Mie, Japan.

2.5 Pathogenicity test

Healthy B. vulgaris cv. 'Yukimaru' distributed by Hokkaido Nosan Kyokai (Hokkaido Agricultural Association), a mildly susceptible CLS-resistant variety, was used in the pathogenicity assay. Isolates obtained from CLS symptoms, including C. beticola (MUCC3417), C. cf. resedae (MUCC3418), and C. hokkaidensis (MUCC3434), were used as inocula, with their phylogenetic positions confirmed by an ML tree using a five-loci concatenated matrix. Conidial suspensions were prepared with artificially produced conidia on a medium following the method for Pseudocercospora species in Chen et al. (2022). The inoculum containing 10,000 conidia/mL was sprayed onto B. vulgaris and covered with a plastic bag for 24 h to keep moist condition. The inoculated plants were maintained in a greenhouse.

3. Results

3.1 Primer Design for nucleotide sequences of the ATR gene

Seven primer sets were designed using the previously published nucleotide sequences of the ATR gene of several Cercospora spp. (Amnuaykanjanasin & Daub, 2009; de Jonge et al., 2018; Lin et al., 2022). As a result, the entire length of ~5000 bp of ATR gene sequences was obtained by the primer walking strategy. Based on the nucleotide sequences, two additional primers, ATRRUF8 (5'- CACACACACGAGACCAAGGT-3') and ATRRUR8 (5'- CAAAACGCTGCGGGATGAT-3'), were designated to amplify the sequence with species-specific mutations (Table 2).

3.2 Phylogeny

A maximum likelihood (ML) tree using a five loci concatenated matrix consisting of sequences of the comprehensive Cercospora species matrix used in Groenewald et al. (2013) and newly obtained sequences in this study was generated as a backbone tree to grasp the phylogenetic position of isolates. The applied evolutional models and length of sequences are: act = JC, 1-188; CaM = TrN (TN93), 189-438; his = TrN+G4, 439-798; ITS = JC, 799-1270; and tef = TPM3uf, 1271-1547. On the backbone tree, examined isolates from B. vulgaris were located in three clades with well-supported clades by BS values, as shown in the extracted tree (Supplementary Fig. S1). From the phylogeny, the examined isolates were recognized as C. beticola (MUCC3425, MUCC3439, MUCC3441, MUCC3442, and MUCC3446), C. cf. resedae (MUCC3418 and MUCC3433), and C. hokkaidensis (MUCC3428, MUCC3434, and MUCC3435), respectively. An ML tree using ATR gene sequences (648 bp) alone was generated by RAxML with an evolutional model = TrN. Although isolates of C. beticola formed a clade supported by BS (73%), clades of C. cf. resedae and C. hokkaidensis collapsed and formed a clade supported by low BS (Fig. 1A).

Fig. 1- Maximum-likelihood (ML) phylogenetic tree of Cercospora species based on sequences. A: Phylogeny based on the partial sequences of the ATR gene. B: Maximum-likelihood (ML) phylogenetic tree of Cercospora species based on a concatenated matrix composed of rDNA ITS sequences, and partial sequences of act, ATR, CaM, his, and tef genes. The bootstrap (BS) values are given near branches (BS > 60). Japanese isolates examined in this study are shown in red.

The additional locus ATR gene sequence was added to the five loci concatenated matrix of 16 OTUs and analyzed. The applied evolutional model and length of sequences of each locus are: ATR = TrN+G4, 1-648; act = TIM1ef, 649-836; CaM = TrN+G4, 837-1086; his = TrN+G4, 1087-1446; ITS = TrNef, 1447-1918; and tef = TPM3uf, 1919-2195. From a resultant tree, Cercospora isolates collected from B. vulgaris were similarly found in three distinct clades, recognized as C. beticola (MUCC3425, MUCC3439, MUCC3441, MUCC3442, and MUCC3446), C. cf. resedae (MUCC3418 and MUCC3433), and C. hokkaidensis (MUCC3428, MUCC3434, and MUCC3435) (Fig. 1B). The majority of the isolates examined in this study (n=35) were grouped with the strain of C. beticola (S9-40) (data not shown).

3.3 Pathogenicity Assay

The pathogenicity of an isolate of C. beticola (MUCC3417) was tested on healthy sugar beet cv. “Yukimaru”. Similar symptoms initially observed in the field (Figs. 2AB) were reproduced 45 d after inoculation, and a fungus from the symptomatic inoculated plants was isolated and was identified as C. beticola. The inoculated C. beticola fulfilled Koch's postulate. On the other hand, C. cf. resedae (MUCC3418) and C. hokkaidensis (MUCC3434) did not show the pathogenicity to B. vulgaris.

Fig. 2- Cercospora leaf spot (CLS) and its causal fungus, Cercospora beticola, on sugar beets, Beta vulgaris. A: Severe occurrence of CLS in a sugar beet field. B: Magnified symptoms of CLS. C-E: Scanning electron microscopy micrographs. C: Fasciculate conidiophores and acicular conidia of C. beticola erumpent through the stoma of B. vulgaris. D: Acicular and filamentous conidia. E: Thickened hila of the basal ends of conidia (red arrows) and sympodially proliferating conidiogenous cells with a thickened locus at the shoulder (white allows). Bars: C, D: 20 μm; E: 10 μm.

3.4 Taxonomy

Cercospora beticola Sacc., emend. Groenewald et al. (2005). Figs. 2CDE.

Description: See Groenewald et al. (2005).

Notes: Cercospora beticola has been isolated from diverse hosts, including Apium graveolens L. (Apiaceae), Chrysanthemum segetum L. (Asteraceae), Goniolimon tataricum L. (Plumbaginaceae), Malva pusilla Sm. (Malvaceae), Limonium sinuatum L. (Plumbaginaceae), Raphanus sativus L. (Brassicaceae) and Spinacia sp. (Amaranthaceae) (Bakhshi & Zare, 2020; Crous et al., 2004; Groenewald et al., 2006; Groenewald et al., 2013). All C. beticola isolates (Table 2) had identical sequences of the ATR gene and were identical with the retrieved sequence of the genome sequence database of C. beticola published in de Jonge et al. (2018). The morphological characteristics of C. beticola found in the present study are very similar to those described in Groenewald et al. (2013) except for our own measurement of relatively shorter conidiophores, 21-157 µm (vs. 16-240 µm) and a bit narrower conidia, 2-5 µm (vs. 2.5-5 µm) (Figs. 3ABCD).

Fig. 3- Colony characteristics of Cercospora species on Beta vulgaris. A-D: Cercospora beticola. E-H: C. cf. resedae. I-L: C. hokkaidensis. A, E, J: Colony on PDA (obverse). B, F, J: Colony on PDA (reverse). C, G, K: Conidia artificially formed on PCA. D, H, L: Conidiogenous cells integrated in conidiophores or creeping hyphae on PCA. Bars: 20 μm.

Cercospora cf. resedae, in Groenewald et al. (2013). Figs. 3EFGH.

Notes: Based on the results of phylogenetic analyses, two isolates, MUCC3418 and MUCC3433, form a highly supported clade (BS: 98) with an isolate of C. cf. resedae (CPC 5057 ex Helianthemum sp., Cistaceae; Groenewald et al., 2013) (Fig. 1B). According to Groenewald et al. (2006) and Groenewald et al. (2013), this species has been isolated from hosts of Cistaceae (Romania) and Resedaceae (New Zealand). However, there are no records of sugar beet as its host in Japan or other countries. Hitherto, this is the first record of C. cf. resedae from sugar beet worldwide, adding the family Amaranthaceae to its host range.

Cercospora hokkaidensis R.J. Uy, H. Uda & C. Nakash., sp. nov. Figs. 3IJKL. MycoBank no.: MB 855943.

Etymology: Derived from the name of the type locality in Japan, Hokkaido + Latin adjectival ending -ensis.

Description in vivo (natural substrates): Stromata present, epidermal, stomatal or erumpent, brown, 20-50 µm diam. Conidiophores fasciculate, straight, gently curved or geniculate, pale olivaceous at the base, paler towards the apex, truncate at the apex, sometimes constricted at septa, 25-159 × 3-5 µm, 1-7-septate; conidiogenous cells integrated, terminal, proliferating sympodially or percurrently, mildly curved, geniculate, cylindrical, conically attenuated towards apex, with distinct thickened and darkened-refractive conidiogenous loci at the apex or shoulders formed by geniculation, 1-1.5 µm diam. Conidia formed holoblastically, hyaline, solitary, cylindrical to obclavate, straight to mildly curved, subacute to rounded at the tip, 35-155 × 3.25-6.25 µm, 0-14-septate, short-obconically truncated at the base, with a thickened, darkened-refractive and protruding hilum, 1.5-2 µm diam.

Description in vitro (on PDA; MUCC 3434): Colony olivaceous to pale olivaceous, white at the margin, concentric, fluffy at the surface, dark olivaceous, forming concentric rings, white at the margin at the reverse. Mycelium hyaline or pale olivaceous, hyphae septate, smooth, 2.5-3.5 μm in width. Conidiophores hyaline or pale colored, emerging from hyphae, smooth, straight to geniculous-sinuous, simple or rarely branched, septate or aseptate, 25-159 × 3-5 μm; conidiogenous cells integrated, terminal, hyaline or pale colored, monoblastic or polyblastic, proliferating sympodially or percurrently, with thickened and darkened-refractive loci, 2-2.5 μm diam. Conidia hyaline, solitary, straight to mildly curved, cylindrical to obclavate, subacute to rounded at the apex, 0-14 septate, 35-155 × 3.25-6.25 μm, short-obconically truncated at the base, with thickened and darkened-refractive and protruded scar, 1.5-2 µm diam.

Holotype: JAPAN, Hokkaido, Kamikawa, on Beta vulgaris subsp. vulgaris Altissima Group, 2017, by M. Kayamori (TSU-MUMH 12023, dried culture of MUCC 3434).

Additional examined specimens: JAPAN, Hokkaido, East Okhotsk, on Beta vulgaris subsp. vulgaris Altissima Group, 2015, by M. Kayamori (TSU-MUMH 12024, dried culture of MUCC 3435); ibid, Tokachi, on Beta vulgaris subsp. vulgaris Altissima Group, 2015, by M. Kayamori (TSU-MUMH 12022, dried culture of MUCC 3428).

Notes: The phylogenetic relationship between other closely related Cercospora species isolated from B. vulgaris in Japan was examined using six distinct gene regions. The results of the phylogenetic analyses showed that the isolates of C. hokkaidensis formed an independent clade (Fig. 1B). The pathogenicity of this species against B. vulgaris is not observed in this study. This cercosporoid fungus detected in Japan on sugar beet represents a new so far undescribed species. Based on the tree constructed from the 646 bp partial sequence of the ATR gene, the three isolates of C. hokkaidensis cluster together in a distinct, well-supported clade with C. cf. resedae, showing identical sequences (Fig. 1A). In the combined tree (Fig. 1B), this species forms a clade separate from C. cf. resedae, with the two species being sister taxa. Cercospora hokkaidensis differs from C. beticola and C. cf. resedae identified in the study by 10 nucleotide changes in the act gene (five transitions and five transversions) and 10 changes in the his gene (six transitions and four transversions). Notably, all three Cercospora species recognized in this study share identical tef and ITS sequences. Furthermore, C. hokkaidensis is morphologically well characterized and distinguished from C. beticola and C. cf. resedae by having rather pale conidiophores and cylindrical-obclavate conidia.

4. Discussions

Species of the genus Cercospora with “mycosphaerella-like” teleomorphs are known to parasitize a wide range of hosts, including herbaceous to woody plants, causing yield reduction in crops and devaluing ornamental plants (Bakhshi & Zare, 2020; Braun et al., 2013; Crous & Braun, 2003; Groenewald et al., 2013; Videira et al., 2017). In Japan, over 400 species of Cercospora sensu lato (s. lat.) and related cercosporoid genera have been reported (Katsuki, 1965; Katumoto, 2010). Furthermore, the taxonomical position of several species has been examined by the morphological characteristics and phylogeny (Chen et al., 2022; Groenewald et al., 2013; Nakashima et al., 2016). The meaning of host plants and morphological traits has long been a crucial criterion for species delimitation of Cercospora s. lat. (Braun et al., 2013). On the other hand, some species may pass over in a plant different from the original host plant, which is known as the pogo stick hypothesis (Crous & Groenewald, 2005). Phylogenetic analyses based on a multi-loci concatenated matrix have successfully shown the delimitation of closely allied species of the genus Cercospora. In addition to resultant phylogenetic trees, most species were suggested to be host specific with narrow host ranges even though several species have wide host range (Groenewald et al., 2013). These species with a wide host range located in a single clade are recognized as species complex, in which species are indistinguishable from other members by a combination of DNA barcoding and morphological characteristics (Bakhshi et al., 2015; Chen et al., 2024; Groenewald et al., 2013). Bakhshi et al. (2018) recommended the necessity of a more thorough investigation by adding three gene loci to give a stronger phylogenetic foundation for species delimitation, namely β-tubulin, rpb2, and gapdh. However, the resolution at the species level within a species complex is still low. In this study, the ATR gene has been examined as an additional locus. The auto-resistance of plant pathogenic Cercospora species against the photoactivated toxin cercosporin is facilitated by ATR, which was previously discovered in a subtractive cDNA library between a C. nicotianae wild type and a cercosporin-sensitive mutant (Amnuaykanjanasin & Daub, 2009). The ability of this mycotoxin is dispensable for the infection of the host plant but it involves cell death and severity. Therefore, it is suggested that the ATR gene is widely distributed and well-conserved among Cercospora species. In fact, between the two other Cercopora species found in this study and C. beticola, three amino acid differences were found in the ATR locus. In the phylogeny of partial sequences of the ATR gene (Fig. 1A), C. cf. resedae and C. hokkaidensis were not distinguished from each other as a species. In a phylogenetic tree using a concatenate sequence matrix with six loci, composed of ITS, act, ATR, CaM, his, and tef sequences, species delimitations of the Cercospora species on B. vulgaris were, however, evident (Fig. 1B).

There have been no reports of Cercospora species other than C. beticola from leaf lesions of sugar beet in Japan so far. As mentioned above, at least three Cercospora species associated with CLS disease symptoms were detected in this study. Cercospora cf. resedae and C. hokkaidensis suggested that they have weak or opportunistic pathogenicity from the results of inoculation tests, which did not reveal the pathogenicity by inoculum containing a low level of conidia, and in the fields wherein the symptom forming those conidia were observed. According to Vaghefi et al. (2018), Cercospora cf. flagellaris, which has been associated with Cercospora leaf blight and purple seed stain on soybean as the primary pathogen, shows weak aggressiveness to B. vulgaris and this finding has important implications as valuable information on the distribution of cryptic species in agricultural landscapes. Moreover, the period of prevalence of CLS seems to be prolonged due to recent climate change (Kayamori et al., 2021), indicating changes in the cultivation environment surrounding the pathogen. Therefore, monitoring the Cercospora species involved in this disease is necessary. Advancements in pathogen detection techniques and the discovery of previously overlooked cryptic species through molecular phylogenetic analysis, as well as the potential reclassification of fungi based on molecular phylogenetic relationships, may lead to the discovery that fungi previously considered to be the same species are, in fact, different species. Moreover, hidden further damages by the polyxenic Cercospora species suspected to parasitize originally other host plants may be revealed, as in the case of C. apii, C. cf. fragellaris, and C. cf. resedae.

In this study, C. cf. resedae, which had not yet been reported from Japan, was isolated from B. vulgaris. Although our assay did not show the pathogenicity of the species, it is plausible that C. cf. resedae may also be involved in diseases causing leaf spots on sugar beet too, because it has a broad host range, including plants belonging to Apiaceae and Malvaceae (Groenewald et al., 2013). Furthermore, a new species of the genus Cercospora, C. hokkaidensis, is described in this study. The specimens of the species were collected from sugar beet fields in East Okhotsk and Tokachi in 2015 and Kamikawa in 2017. It can be possible that additional undescribed species may be found causing CLS through further studies.

Accurate species identification is essential for comprehending the epidemiology of diseases and creating efficient control strategies. This study aimed to elucidate the diversity of Cercospora spp. linked with sugar beet leaf spot disease in Japan. Based on the results, three Cerscospora species were identified using a six-gene loci combination in the phylogenetic analysis. Each gene contributes distinct evolutionary information; however, some loci may lack sufficient phylogenetic resolution due to high conservation or low variability (Bakhshi et al., 2020). Introducing a sixth gene locus enhances genetic diversity in analyses, providing a stronger phylogenetic signal and improving the resolution of closely related species and cryptic taxa that may remain indistinguishable with only five loci. For example, cryptic clades such as those in C. apii and C. armoraciae often cannot be resolved because conserved loci like ITS, tef, or act fail to capture subtle genetic differences (Bakhshi et al., 2020). Incorporating an additional locus, such as ATR gene, with higher sequence variation based on the sequence data matrix increases the likelihood of discriminating cryptic species within the genus Cercospora. Furthermore, exploring additional loci may reveal genes with greater species-level resolution, offering potential candidates for universal barcoding markers in Cercospora. The addition of a potential barcoding gene locus, ATR, generated a good resolution for the identification of the species in this study. Hence, the insights gained from this study, utilized as fundamental information for accurate diagnoses and appropriate control measures, can contribute to ensuring a sustainable sugar beet supply in Japan and improving species delimitation in the genus Cercospora.

References

• Amnuaykanjanasin, A., & Daub, M. E. (2009). The ABC transporter ATR1 is necessary for efflux of the toxin cercosporin in the fungus Cercospora nicotianae. Fungal Genetics and Biology, 46, 146-158. https://doi.org/10.1016/j.fgb.2008.11.007
• Bakhshi, M., Arzanlou, M., Babai-Ahari, A., Groenewald, J. Z., Braun, U., & Crous, P. W. (2015). Application of the consolidated species concept to Cercospora spp. from Iran. Persoonia, 34, 65-86. https://doi.org/10.3767/003158515x685698
• Bakhshi, M., Arzanlou, M., Babai-Ahari, A., Groenewald, J. Z., & Crous, P. W. (2018). Novel primers improve species delimitation in Cercospora. IMA Fungus, 9, 299-332. https://doi.org/10.5598/imafungus.2018.09.02.06
• Bakhshi, M., & Zare, R. (2020). Development of new primers based on gapdh gene for Cercospora species and new host and fungus records for Iran. Mycologia Iranica, 7, 63-82. https://doi.org/10.22043/mi.2020.122549
• Bolton, M. D., Rivera-Varas, V., Del Río Mendoza, L. E., Khan, M. F. R., & Secor, G. A. (2012). Efficacy of variable tetraconazole rates against Cercospora beticola isolates with differing in vitro sensitivities to DMI fungicides. Plant Disease, 96, 1749-1756. https://doi.org/10.1094/pdis-03-12-0255-re
• Braun, U., Nakashima, C., & Crous, P. W. (2013). Cercosporoid fungi (Mycosphaerellaceae) 1. Species on other fungi, Pteridophyta and Gymnospermae. IMA Fungus, 4, 265-345. https://doi.org/10.5598/imafungus.2013.04.02.12
• Carbone, I., & Kohn, L. M. (1999). A method for designing primer sets for speciation studies in filamentous ascomycetes. Mycologia, 91, 553-556. https://doi.org/10.1080/00275514.1999.12061051
• Chen, C., Keunecke, H., Neu, E., Kopisch‐Obuch, F. J., McDonald, B. A., & Stapley, J. (2024). Molecular epidemiology of Cercospora leaf spot on resistant and susceptible sugar beet hybrids. Plant Pathology, 74, 69-83. https://doi.org/10.1111/ppa.13998
• Chen, Q., Bakhshi, M., Balci, Y., Broders, K. D., Cheewangkoon, R., Chen, S. F., Fan, X. L., Gramaje, D., Halleen, F., Horta Jung, M., Jiang, N., Jung, T., Májek, T., Marincowitz, S., Milenković, I., Mostert, L., Nakashima, C., Nurul Faziha, I., Pan, M., . . . Crous, P. W. (2022). Genera of phytopathogenic fungi: GOPHY 4. Studies in Mycology, 101, 417-564. https://doi.org/10.3114/sim.2022.101.06
• Crous, P. W., & Braun, U. (2003). Mycosphaerella and its anamorphs 1 : names published in Cercospora and Passalora. Centraalbureau voor Schimmelcultures.
• Crous, P. W., & Groenewald, J. Z. (2005). Hosts, species and genotypes: opinions versus data. Australasian Plant Pathology, 34, 463-470. https://doi.org/10.1071/ap05082
• Crous, P., Groenewald, J., Pongpanich, K., Himaman, W., Arzanlou, M., & Wingfield, M. (2004). Cryptic speciation and host specificity among Mycosphaerella spp. occurring on Australian Acacia species grown as exotics in the tropics. Studies in Mycology, 50, 457-469.
• Darriba, D., Posada, D., Kozlov, A. M., Stamatakis, A., Morel, B., & Flouri, T. (2020). ModelTest-NG: A new and scalable tool for the selection of DNA and protein evolutionary models. Molecular Biology and Evolution, 37, 291-294. https://doi.org/10.1093/molbev/msz189
• Daub, M. E. (1982). Peroxidation of tobacco membrane lipids by the photosensitizing toxin, cercosporin, Plant Physiology, 69, 1361-1364, https://doi.org/10.1104/pp.69.6.1361
• de Hoog, G. S., & van den Ende, A. H. G. G. (1998). Molecular diagnostics of clinical strains of filamentous Basidiomycetes. Mycoses, 41, 183-189. https://doi.org/10.1111/j.1439-0507.1998.tb00321.x
• de Jonge, R., Ebert, M. K., Huitt-Roehl, C. R., Pal, P., Suttle, J. C., Spanner, R. E., Neubauer, J. D., Jurick, W. M., Stott, K. A., Secor, G. A., Thomma, B. P. H. J., Van De Peer, Y., Townsend, C. A., & Bolton, M. D. (2018). Gene cluster conservation provides insight into cercosporin biosynthesis and extends production to the genus Colletotrichum. Proceedings of the National Academy of Sciences of the United States of America, 115, E5459-E5466. https://doi.org/10.1073/pnas.1712798115
• Felsenstein, J. (1985). Confidence Limits on Phylogenies: An Approach Using the Bootstrap. Evolution, 39, 783-791. https://doi.org/10.1111/j.1558-5646.1985.tb00420.x
• Groenewald, J. Z., Nakashima, C., Nishikawa, J., Shin, H., Park, J., Jama, A., Groenewald, M., Braun, U., & Crous, P. W. (2013). Species concepts in Cercospora: spotting the weeds among the roses. Studies in Mycology, 75, 115-170. https://doi.org/10.3114/sim0012
• Groenewald, M., Groenewald, J. Z., Braun, U., & Crous, P. W. (2006). Host range of Cercospora apii and C. beticola and description of C. apiicola, a novel species from celery. Mycologia, 98, 275-285. https://doi.org/10.3852/mycologia.98.2.275
• Groenewald, M., Groenewald, J. Z., & Crous, P. W. (2005). Distinct species exist within the Cercospora apii morphotype. Phytopathology, 95, 951-959. https://doi.org/10.1094/phyto-95-0951
• Jay, S., Comar, A., Benicio, R., Beauvois, J., Dutartre, D., Daubige, G., Li, W., Labrosse, J., Thomas, S., Henry, N., Weiss, M., & Baret, F. (2020). Scoring Cercospora leaf spot on sugar beet: Comparison of UGV and UAV phenotyping systems. Plant Phenomics, 2020, 9452123. https://doi.org/10.34133/2020/9452123
• Kashiwa, T., & Suzuki, T. (2021). High-quality genome assembly of the soybean fungal pathogen Cercospora kikuchii. G3 Genes Genomes Genetics, 11. https://doi.org/10.1093/g3journal/jkab277.
• Katumoto, K. (2010). List of Fungi recorded in Japan [In Japanese]. The Kanto Branch of the Mycological Society of Japan.
• Katsuki, S. (1965). Cercosporae of Japan. Transactions of the Mycological Society of Japan, Extra Issue 1, 1-100.
• Kawato, M., & Shinobu, R. (1960). On Streptomyces herbaricolor nov. sp.: Supplement A simple technique for the microscopical observation. Memoirs of the Osaka University of the Liberal Arts and Education. B, Natural science, 8, 114-119.
• Kayamori, M., Zakharycheva, A., Saito, H., & Komatsu, K. (2021). Resistance to demethylation inhibitors in Cercospora beticola, a pathogen of sugar beet in Japan, and development of unique cross-resistance patterns. European Journal of Plant Pathology, 160, 39-52. https://doi.org/10.1007/s10658-021-02219-6
• Kozlov, A. M., Darriba, D., Flouri, T., Morel, B., & Stamatakis, A. (2019). RAxML-NG: a fast, scalable and user-friendly tool for maximum likelihood phylogenetic inference. Bioinformatics, 35, 4453-4455. https://doi.org/10.1093/bioinformatics/btz305
• Kumar, S., Stecher, G., Li, M., Knyaz, C., & Tamura, K. (2018). MEGA X: Molecular evolutionary genetics analysis across computing platforms. Molecular Biology and Evolution, 35, 1547-1549. https://doi.org/10.1093/molbev/msy096
• Kumar, R., Mazakova, J., Ali, A., Sur, V. P., Sen, M. K., Bolton, M. D., Manasova, M., Rysanek, P., & Zouhar, M. (2021). Characterization of the molecular mechanisms of resistance against DMI fungicides in Cercospora beticola populations from the Czech Republic. Journal of Fungi, 7, 1062. https://doi.org/10.3390/jof7121062
• Lin, Z., Wang, W., & Chen, J. (2022). Genome sequence resource for Cercospora rodmanii J1, a potential biological control agent for water hyacinth. Phytopathology, 112, 2462-2465. https://doi.org/10.1094/phyto-04-22-0119-a
• Nakashima, C., Motohashi, K., Chen, C.-Y., Groenewald, J. Z., & Crous, P. W. (2016). Species diversity of Pseudocercospora from Far East Asia. Mycological Progress, 15(10-11), 1093-1117. https://doi.org/10.1007/s11557-016-1231-7
• Nugent, L. K., Sangvichen, E., Sihanonth, P., Ruchikachorn, N., & Whalley, A. J. S. (2006). A revised method for the observation of conidiogenous structures in fungi. Mycologist, 20, 111-114. https://doi.org/10.1016/j.mycol.2006.06.003
• Rangel, L. I., Spanner, R. E., Ebert, M. K., Pethybridge, S. J., Stukenbrock, E. H., De Jonge, R., Secor, G. A., & Bolton, M. D. (2020). Cercospora beticola: The intoxicating lifestyle of the leaf spot pathogen of sugar beet. Molecular Plant Pathology, 21, 1020-1041. https://doi.org/10.1111/mpp.12962
• Rayner, R. W. (1970). A mycological colour chart. Commonwealth Mycological Institute & British Myclogical Society.
• Sandell, F. L., Stralis-Pavese, N., McGrath, J. M. (2022). Genomic distances reveal relationships of wild and cultivated beets. Nature Communications, 13, 2021. https://doi.org/10.1038/s41467-022-29676-9.
• Shrestha, S., Neubauer, J., Spanner, R., Natwick, M., Rios, J., Metz, N., Secor, G. A., & Bolton, M. D. (2020). Rapid detection of Cercospora beticola in sugar beet and mutations associated with fungicide resistance using LAMP or probe-based qPCR. Plant Disease, 104, 1654-1661. https://doi.org/10.1094/pdis-09-19-2023-re
• Skaracis, G. N., Pavli, O. I., & Biancardi, E. (2011). Cercospora leaf spot disease of sugar beet. Sugar Tech, 12, 220-228. https://doi.org/10.1007/s12355-010-0055-z
• Tan, W., Li, K., Liu, D., & Xing, W. (2023). Cercospora leaf spot disease of sugar beet. Plant Signaling & Behavior, 18. https://doi.org/10.1080/15592324.2023.2214765.
• Tayyab, M., Wakeel, A., Mubarak, M. U., Artyszak, A., Ali, S., Hakki, E. E., Mahmood, K., Song, B., & Ishfaq, M. (2023). Sugar beet cultivation in the tropics and subtropics: challenges and opportunities. Agronomy, 13, 1213. https://doi.org/10.3390/agronomy13051213.
• Untergasser, A., Nijveen, H., Rao, X., Bisseling, T., Geurts, R., & Leunissen, J. A. (2007). Primer3Plus, an enhanced web interface to Primer3. Nucleic Acids Research, 35, W71-W74. https://doi.org/10.1093/nar/gkm306.
• Vaghefi, N., Kikkert, J. R., Hay, F. S., Carver, G. D., Koenick, L. B., Bolton, M. D., Hanson, L. E., Secor, G. A., & Pethybridge, S. J. (2018). Cryptic diversity, pathogenicity, and evolutionary species boundaries in Cercospora populations associated with Cercospora leaf spot of Beta vulgaris. Fungal Biology, 122, 264-282. https://doi.org/10.1016/j.funbio.2018.01.008
• Vaghefi, N., Shivas, R. G., Sharma, S., Nelson, S. C., & Pethybridge, S. J. (2021). Phylogeny of cercosporoid fungi (Mycosphaerellaceae, Mycosphaerellales) from Hawaii and New York reveals novel species within the Cercospora beticola complex. Mycological Progress, 20, 261-287. https://doi.org/10.1007/s11557-021-01666-z
• Videira, S. I. R., Groenewald, J. Z., Nakashima, C., Braun, U., Barreto, R. W., de Wit, P. J. G. M., & Crous, P. W. (2017). Mycosphaerellaceae - Chaos or clarity? Studies in Mycology, 87, 257-421. https://doi.org/10.1016/j.simyco.2017.09.003
• White, T. J., Bruns, T., Lee, S., & Taylor, J. (1990). Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: M. A. Innis, D. H. Gelfand, J. J. Sninsky, & T. J. White (Eds.), PCR protocols: A guide to methods and applications (pp. 315-322). Academic Press.
• World Food and Agriculture - Statistical Yearbook 2022. (2022). In FAO eBooks. https://doi.org/10.4060/cc2211en.
• Wyatt, N., Spanner, R., & Bolton, M. (2024). The complete and gapless genome sequence of the sugar beet pathogen Cercospora beticola. PhytoFrontiers, 4, 434-437. https://doi.org/10.1094/phytofr-11-23-0146-a.
• Yang, L., Gao, G., Gao, W., Zhang, C., Wu, F., Huo, J., & Wang, Y. (2023). Complete Genome Sequence Resource for Cercospora apii Causing Leaf Spot of Celery. Molecular Plant-Microbe Interactions, 36, 670-673. https://doi.org/10.1094/mpmi-04-23-0039-a