2015 Volume 235 Issue 3 Pages 161-169
Lung cancer is the most common malignant tumor worldwide. MicroRNA has become an ideal biomarker for cancer diagnosis, prognosis and therapy. The relationship between microRNA-141 and non-small cell lung cancer (NSCLC) is contradictory. Thus, in current study, we aimed to investigate the level of microRNA-141 in NSCLC tissues and to evaluate its potential clinical value. This study enrolled 125 NSCLC patients (75 males and 50 females) with a median age of 61 years (range, 23-90 years). NSCLC patients included 23 squamous cell carcinomas (SCCs), 101 adenocarcinomas (ADCs) and 1 large cell carcinoma. The expression level of microRNA-141 was significantly higher in NSCLC tissues than in adjacent lung tissues (P < 0.001), detected by real time RT-PCR. Receiver operating characteristic (ROC) exhibited a moderate diagnostic value of microRNA-141 for NSCLC with the area under curve of 0.707. The microRNA-141 expression increased with the larger tumor size (P = 0.002), lymph node metastasis (P = 0.018) and advanced stage (P = 0.022) in NSCLC patients. For subgroup analysis, microRNA-141 expression in SCC was correlated with tumor size (r = 0.490, P = 0.018), and in ADC, microRNA-141 level was positively associated with tumor size (r = 0.222, P = 0.026), lymph node metastasis (r = 0.242, P = 0.015) and TNM stage (r = 0.210, P = 0.035). Furthermore, univariate analysis revealed that the expression of microRNA-141 was an independent prognostic indicator of ADC. In conclusion, microRNA-141 is a potential biomarker for the molecular diagnosis and risk stratification of NSCLC.
Lung cancer, as one of the leading causes of cancer-related death worldwide, has resulted in rising death rates, with approximate 1.4 million deaths per year all over the world (Jemal et al. 2011; De Mello et al. 2013). Lung cancer is divided into two major pathological categories: small cell lung cancer (SCLC, 13%) and non-small cell lung cancer (NSCLC, 87%) (DeSantis et al. 2014). NSCLC, including squamous cell carcinoma (SCC), adenocarcinoma (ADC), adenosquamous cell carcinoma and large cell carcinoma (LCC), accounts for roughly 80-87% of all lung cancer cases (Jemal et al. 2011), while the occurrence of SCLC is much lower. Furthermore, the treatment patterns were different between SCLC and NSCLC patients, especially the chemotherapy (Kuwabara et al. 2009), as well as molecular targeted therapy (Lauro et al. 2014; Asai et al. 2014). The most effective treatment for early NSCLC is surgical resection (Gazala et al. 2013). However, nearly 2/3 of patients with NSCLC are diagnosed at an advanced or metastatic stage of disease. In the circumstances, the most beneficial treatment is chemotherapy and/or concurrent administration of chemotherapy and radiation. In addition, usage of specific inhibitors (such as gefitinib, erlotinib, afatinib, crizotinib) is effective for those patients with a mutation in the epidermal growth factor receptor (EGFR) gene or rearrangement of the anaplastic lymphoma kinase (ALK) gene (Chen et al. 2013a; Gridelli et al. 2014). Nevertheless, on account of late stage diagnosis and high frequency of drug resistance, the 5-year survival rate in patients is only 17% in the United States (Siegel et al. 2014; DeSantis et al. 2014). The unfavorable outcome is due to the relatively inadequate understanding of the molecular mechanisms involved in lung carcinogenesis (Brothers et al. 2013). Thus, there is an urgent requirement to discover new early detection markers and novel therapeutic targets of NSCLC. However, the treatment of SCLC is still given priority to chemotherapy (Asai et al. 2014).
MicroRNAs are a class of small, endogenous, non-coding RNAs that modify the expression of protein-coding genes by binding the sequence to the 3′-untranslated region (3′-UTR) of target mRNA, leading to the repression of translation or degradation of the mRNA (Guz et al. 2014; Kang and Lee 2014; Oom et al. 2014; Ritchie and Rasko 2014). MicroRNAs play critical roles in tumorigenesis, tumor cell proliferation, migration, invasion, metastasis and angiogenesis (Iuliano et al. 2013; Di Leva et al. 2014). A large number of microRNAs have been aberrantly found in NSCLC, and many of them contribute to NSCLC development and progression (Chen et al. 2013b; Xia et al. 2014b; Xia et al. 2014a). The role of microRNAs may be altered between NSCLC (Hu et al. 2008) and SCLC (Liu and Chen 2011), thus we only focus on NSCLC. There are many factors influencing the prognosis of lung SCC and ADC. For example, high expression levels of MutS homologue 2 (MSH2) had a better outcome in SCC. However, increased MSH2 expression was a poor prognostic factor in ADC patients (Vageli et al. 2012). Vascular invasion was an independent prognostic factor in ADC, whereas it was not significant for SCC patients (Usui et al. 2013). Patients with SCC with the interleukin-10 non-ATA haplotype had poorer overall survival and relapse-free survival than those with the ATA haplotype. However, interleukin-10 haplotype was not directly correlated with the clinical outcome of patients with ADC (Wang et al. 2013). MicroRNA-662, -192 and -192* were confirmed as independent prognostic factors in SCC patients, while there was no similar findings in ADC (Skrzypski et al. 2014).
Has-microRNA-141, a member of an evolutionarily conserved family of microRNAs, locates in chromosome 12 and belongs to the same cluster as has-miR-200c. Growing evidence has indicated that abnormal expression/function of microRNA-141 was associated with tumorigenesis and carcinoma progression of various human cancers (Zhou et al. 2014; Liu et al. 2014; Chen et al. 2014b). MicroRNA-141, as a tumor suppressor, was down-regulated in numerous cancer types, such as gastric cancer (Chen et al. 2014a), hepatocellular carcinoma (Wu et al. 2014) and pancreatic cancer (Zhao et al. 2013). To date, 3 articles have reported the role of microRNA-141 in NSCLC. However, the results were contradictory (Liu et al. 2012; Mei et al. 2014; Tejero et al. 2014). Mei et al. (2014) and Liu et al. (2012) found that the expression of microRNA-141 in NSCLC tissues were up-regulated, whereas Tejero et al. (2014) showed that the level of microRNA-141 in NSCLC tissues was not significantly different from that in the adjacent non-cancerous lung tissues. In addition, Liu et al. (2012) found that the high expression of microRNA-141 was associated with poor prognosis of NSCLC. However, Tejero et al. (2014) showed that high microRNA-141 expression correlated with shorter overall survival in ADC, but not in SCC. Moreover, the relationship between microRNA-141 level and clinicopathological parameters has been not studied in NSCLC. Therefore, we examined the expression of microRNA-141 in 125 paired NSCLC and adjacent non-cancerous lung tissues, and evaluated its contribution to the NSCLC progression. Furthermore, we studied the relationship between microRNA-141 and the status of EGFR, a mature molecular target for the personalized therapy in NSCLC, including EGFR amplification, EGFR protein expression and EGFR mutations sensitive to tyrosine kinase inhibitor (TKI) treatment.
One hundred twenty-five paired formalin-fixed, paraffin embedded (FFPE) NSCLC tissues and adjacent non-cancerous lung tissues were obtained from the patients who underwent primary surgical resection of NSCLC between January, 2012 and February, 2014 at the First Affiliated Hospital of Guangxi Medical University in China. The Ethical Committee of First Affiliated Hospital, Guangxi Medical University, China approved the current research, and informed consent was obtained from all patients involved. All samples were reviewed and diagnosed by two independent pathologists. Table 1 showed the main clinical characteristics for all 125 patients. Median age was 61 years (range, 23-90) and 60% cases were males. One hundred and one (80.8%) patients were ADC, 23 (18.4%) SCC and 1 (0.8%) LCC. Fifty-four (43.2%) patients had TNM stage I or II disease. Median follow-up was 13 months (range, 1-50.6) for 57 patients. The EGFR status was detected as previously reported (Chen et al. 2011, 2012, 2013b).
The relationship between microRNA-141 and clinicopathological parameters in NSCLC.
aPaired t student’s test was performed.
bOne-way analysis of variance (ANOVA) test was performed.
cEGFR mutation included short in-frame deletions in exon 19 and point mutations that result in a substitution of arginine for leucine at codon 858 (L858R) in exon 21.
Smoking history was collected for only 68 cases and EGFR amplification, protein expression and mutation were detected in 57 cases.
Total RNAs were extracted from FFPE cancer and non-cancerous tissues by using miRNeasy FFPE Kit (QIAGEN, KJ Venlo, Netherlands) under the manufacturer protocol. Reverse transcription (RT) and qPCR kits were applied to evaluate expression of microRNA-141 as described previously (Chen et al. 2011, 2012, 2013b; Rong et al. 2014). Previously, we found that the combination of microRNA-191 and microRNA-103 was the most stable housekeeping microRNA by using NormFinder and geNorm. This combination was used in the current study for the detection of microRNA-141 expression. The primers for microRNA-141, microRNA-191 and microRNA-103 were included in TaqMan® MicroRNA Assays (4427975, Applied Biosystems, Life Technologies Grand Island, NY, 14072, USA). Sequence of microRNA and references used in the paper are: microRNA-141 (Applied Biosystems Cat. No. 4427975-000463): UAACACUGUCUGGUAAAGAUGG; microRNA-191 (Applied Biosystems Cat. No. 4427975-000490): CAACGGAAUCCCAAAAGCAGCU; microRNA-103 (Applied Biosystems Cat. No. 4427975-000439): AGCAGCAUUGUACAGGGCUAUGA. The reverse primers were also used for the reverse transcription with TaqMan® MicroRNA Reverse Transcription Kit (4366596, Applied Biosystems, Life Technologies Grand Island, NY, 14072, USA) in a total volume of 10 μl. Real-time qPCR for microRNA was performed with Applied Biosystems PCR7900. The microRNA-141 expression in FFPE experiment was calculated with the formula 2-Δcq (Chen et al. 2013b; Dang et al. 2013, 2014).
Statistical analysisThe statistical analyses were performed using SPSS 20.0 software (SPSS, Inc., Munich, Germany). Paired sample t-test was used to compare the difference of microRNA-141 expression between NSCLC tissue and adjacent non-cancerous lung tissue. Comparisons between unpaired groups were conducted using the student t-test. One-way analysis of variance (ANOVA) test was used to analyze the correlation between the expression levels of microRNA-141 and pathological grading and histological classification. Receiver operating characteristic (ROC) curve was generated to evaluate the power of microRNA-141 to distinguish the NSCLC patients from non-cancerous lung tissue. Survival analysis was estimated by the Kaplan-Meier method, and the log-rank test was used to compare the survival between groups. Cox proportional hazard regression model was applied to analyze the risk factors for NSCLC. A P-value less than 0.05, which was calculated by two-tailed test, was considered statistically significant.
The microRNA-141 expression levels were significantly higher in NSCLC tissues compared with adjacent non-cancerous lung tissues (P < 0.001, Fig. 1A). For subgroup of histological classification, microRNA-141 expression levels were both elevated in SCC or ADC, compared with corresponding lung tissues (P < 0.01). Furthermore, ROC curve was performed to identify the diagnostic value of microRNA-141 level in NSCLC. The area under curve (AUC) of microRNA-141 was 0.707 (95% CI 0.643~0.771, P < 0.001). The cut-off value for microRNA-141 was 3.32. The sensitivity and specificity were 64.8% and 64.8%, respectively (Fig. 1B). Meanwhile, ROC curve was performed to identify the diagnostic value of microRNA-141 level in SCC. The AUC of microRNA-141 was 0.750 (95% CI 0.662~0.837, P < 0.001). The cut-off value for microRNA-141 was 5.54. The sensitivity and specificity were 73.9% and 69.2%, respectively. For ADC, the AUC of microRNA-141 was 0.622 (95% CI 0.553~0.691, P = 0.001). The cut-off value for microRNA-141 was 3.32. The sensitivity and specificity were 62.4% and 58.4%, respectively.
MicroRNA-141 expression and its diagnostic value in NSCLC.
Quantitative real-time RT-PCR was performed to detect the expression of microRNA-141 in non-small cell lung cancer (NSCLC) and the paired adjacent non-cancerous lung tissue (A). *P < 0.001. ROC curve of microRNA-141 level in NSCLC (B). The area under curve (AUC) of microRNA-141 was 0.707 (95% CI 0.643~0.771).
Higher expression of microRNA-141 was found in the groups of larger tumor size, lymph node metastasis and TNM stage III-IV than in the corresponding groups (all P < 0.05, Table 1, Fig. 2A-C). Moreover, according to Spearman correlation test, microRNA-141 expression level was found to correlate with tumor size (r = 0.272, P = 0.002), lymph node metastasis (r = 0.211, P = 0.018) and TNM stage (r = 0.205, P = 0.022). However, no significant relationship was detected between microRNA-141 level and other clinicopathological parameters, such as age, gender, smoke, vascular invasion, pathological grading, histological classification, EGFR amplification, EGFR protein expression and EGFR mutation status (all P > 0.05, Table 1). For subgroup analysis, the relationships between microRNA-141 and clinicopathological parameter in SCC or ADC are shown in Tables 2 and 3, respectively. According to Spearman correlation test, microRNA-141 expression level in SCC was found to correlate with tumor size (r = 0.490, P = 0.018). While in ADC, microRNA-141 level was positive association with some clinicopathological parameters, such as tumor size (r = 0.222, P = 0.026), lymph node metastasis (r = 0.242, P = 0.015) and TNM stage (r = 0.210, P = 0.035).
Relationship between microRNA-141 expression and some clinicopathological features in NSCLC.
A: lymphatic metastasis; B: tumor size; C: clinical TNM stages. *P < 0.05.
The relationship between microRNA-141 and clinicopathological parameters in lung squamous cell carcinoma.
aPaired t student’s test was performed.
bOne-way analysis of variance (ANOVA) test was performed.
cEGFR mutation included short in-frame deletions in exon 19 and point mutations that result in a substitution of arginine for leucine at codon 858 (L858R) in exon 21.
The relationship between microRNA-141 and clinicopathological parameters in lung adenocarcinoma.
aPaired t student’s test was performed.
bOne-way analysis of variance (ANOVA) test was performed.
cEGFR mutation included short in-frame deletions in exon 19 and point mutations that result in a substitution of arginine for leucine at codon 858 (L858R) in exon 21.
Smoking history was collected for only 44 cases and EGFR amplification, protein expression and mutation were detected in 33 cases.
As the survival data was limited, we could only explore the relationship between microRNA-141 expression and prognosis of ADC. We employed Kaplan-Meier method, log-rank test and univariate Cox proportional hazard regression model to analyze the survival of ADC patients with the expression of microRNA-141 and other clinicopathological features. Among the 57 patients followed up, 26 had higher microRNA-141 levels, compared to the mean level of 5.5464, and 31 had lower microRNA-141 levels. The survival of high microRNA-141 expression group was 12.1 ± 2.6 months, significantly shorter than that of the low expression group (24.2 ± 3.6 months, P = 0.037, Fig. 3) as shown with Kaplan-Meier method. No other clinicopathological parameters showed significant impact on survival of ADC. Furthermore, univariate analysis of overall survival revealed that the relative level of microRNA-141 expression (P = 0.041) was prognostic indicator for ADC (Table 4).
Kaplan-Meier survival curves for NSCLC patients.
NSCLC patients with high microRNA-141 expression had a significantly poorer prognosis than those with low expression (P = 0.037).
Univariate Analysis of clinicopathological factors for overall survival in adenocarcinoma.
MicroRNA-141 expression has been reported to be down-regulated or up-regulated in different malignancies, which raises a controversial issue for the role of microRNA-141. Several research groups have reported the expression level of microRNA-141 in NSCLC. Tejero et al. (2014) found no significant difference in microRNA-141 expression between NSCLC (SCC n = 70 and ADC n = 73) and their adjacent non-cancerous lung tissues in a Spanish population. Inversely, in the present study, microRNA-141 level was 1.97-fold higher in NSCLC (all n = 125: SCC n = 23, ADC n = 101, and LCC n = 1) than in the paired adjacent non-cancerous lung tissues. These results were concordant with the studies with small size of NSCLC patients (all n = 70: SCC n = 36 and ADC n = 34) (Liu et al. 2012) and NSCLC (n = 12) (Mei et al. 2014). The number of SCC may be a factor for the contradicting results. Since the studies of Liu et al. (2012), Mei et al. (2014) and ours were all based on Chinese NSCLC patients, it could be possible that microRNA-141 expression may be related to the race, e.g., microRNA-141 may play a different role in the NSCLC of yellow race and white race. However, this hypothesis needs to be verified and thoroughly investigated. Besides, for the first time, we employed ROC curve to analyze the diagnostic value of microRNA-141 level in NSCLC patients. As a result, ROC demonstrated that microRNA-141 had a moderate diagnostic value for NSCLC with the AUC of 0.707. Meanwhile, microRNA-141 level in SCC had higher diagnosis value than that in ADC. Together with literatures, the current finding strongly indicates the possible role of microRNA-141 as an oncogenic microRNA in NSCLC and the potential characteristic of microRNA-141 in the carcinogenesis of NSCLC.
Interestingly, we found that the relative expression of microRNA-141 was lower in the SCC-adjacent tissues than that in the ADC-adjacent tissues. This difference could not be explained by the histological morphology, since no obvious distinction of the adjacent tissues between SCC and ADC was found, except that in some cases of SCC-adjacent tissues, squamous metaplasia could be observed. We hypothesize that the altered unclarified mechanisms of microRNA-141 expression in the tumorigenesis of SCC and ADC lead to the variation of the expression level in SCC- and ADC-adjacent tissues. Further work should include absolutely normal lung tissues as controls, and in vitro and in vivo experiments would also be required to figure out this issue.
MicroRNAs are proved to be more stable and reproducible than mRNA (Ramshankar and Krishnamurthy 2013). Thus, circulating microRNAs might be considered as blood-based biomarker in cancer diagnosis and prognosis (Qu et al. 2011). However, Liu et al. (2012) failed to test the aberrant microRNA-141 expression in serum of NSCLC patients. Quantitative RT-PCR results showed that serum level of microRNA-141 in NSCLC patients was not obviously different from normal volunteers, which was inconsistent with the overexpression in NSCLC tissues. Thus, the expression profiles of microRNA-141 were variable in NSCLC tissues and sera, suggesting that serum microRNA-141 might not truly reflect the level of tumor microRNAs. We also compared some microRNA profiles in the NSCLC tissues and their paired serum samples, and found the similar conflicting expression patterns (data not shown). The relationship between tissue microRNAs and serum microRNAs is uncertain. Cancer heterogeneity of primary tumor cells and circulating tumor cells could be one of the potential explanations for this discrepancy. Thus, the clinical significance of serum microRNA-141 remains to be determined.
Regarding the relationship between microRNA-141 expression and clinicopathological parameters, Liu et al. (2012) determined no association between microRNA-141 level and any clinicopathological feature. In the present study, microRNA-141 expression with larger tumor was found to be significantly higher than that with smaller ones. Meanwhile, microRNA-141 expression was significantly upregulated in lymph node metastatic group compared to that in the non-metastatic group. Interestingly, when NSCLC patients were divided into SCC, ADC and LCC, we found that microRNA-141 expression level in SCC was associated with tumor size. Additionally, microRNA-141 expression was correlated with the clinical TNM stage. The status of tumor size and lymph node metastasis generally reflects tumor growth, invasion and metastasis and the disease deterioration. Thus, the result in current study reveals an obvious relationship between the high expression level of microRNA-141 and the progression of NSCLC. Furthermore, patients with high microRNA-141 level tended to have shorter survival; namely, microRNA-141 was an independent prognostic indicator to predict the prognosis of NSCLC, which was accordant with Liu et al. (2012) and Tejero et al. (2014). Hence it may be valuable to examine microRNA-141 expression for the prediction of deterioration and prognosis of NSCLC.
Treatment strategies for NSCLC continue to evolve, most of which have produced positive trial results for EGFR TKIs in the first-line setting in molecularly targeted populations (Zheng et al. 2013). Thus, we were also interested in the relationship between microRNA-141 expression and the EGFR status. However, no correlation was found between microRNA-141 level and all EGFR status, including EGFR amplification, EGFR protein expression and EGFR mutations in exon 19 and exon 21.
Concerning the mechanism of microRNA-141 being upregulated in advanced stage of NSCLC, different target genes and pathways involved could play vital roles. Diverse target genes and related signaling of microRNA-141 have been demonstrated in NSCLC. Tejero et al. (2014) found that overexpression of microRNA-141 reduced KLF6 protein levels and produced an increase of secretion of VEGFA in vitro and microRNA-141 was associated with higher blood micro vessel density in patient tumor samples. Mei et al. (2014) reported that microRNA-141 directly targets PH domain leucine-rich-repeats protein phosphatase 1 (PHLPP1) and PHLPP2, which enhance the proliferation of NSCLC cells by promoting cell cycle progression. The in-depth mechanism of microRNA-141 needs further investigation.
In conclusion, microRNA-141 level increases in NSCLC tissues. The high expression level of microRNA-141 was closely related to the poor prognosis of NSCLC. Therefore, microRNA-141 may be a new biomarker for molecular diagnosis, risk evaluation and prognosis prediction of NSCLC.
The study was supported by the Fund of Guangxi Natural Scientific Research (No. 2011GXNSFA018212), Guangxi Provincial Health Bureau Scientific Research Project (Z2013201, Z2014055) and the Fund of National Natural Science Foundation of China (NSFC 81360327). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
The authors declare no conflict of interest.
