The common marmoset (Callithrix jacchus) is a small-bodied Neotropical primate and a useful preclinical animal model for translational research into autoimmune-mediated inflammatory diseases (AIMID), such as rheumatoid arthritis (RA) and multiple sclerosis (MS). The animal model for MS established in marmosets has proven their value for exploratory research into (etio) pathogenic mechanisms and for the evaluation of new therapies that cannot be tested in lower species because of their specificity for humans. Effective usage of the marmoset in preclinical immunological research has been hampered by the limited availability of blood for immunological studies and of reagents for profiling of cellular and humoral immune reactions. In this paper, we give a concise overview of the procedures and reagents that were developed over the years in our laboratory in marmoset models of the above-mentioned diseases.

View full abstract

The combination of ketamine and xylazine is a widely used anesthetic for laboratory animals. However, due to an abuse problem in Japan, ketamine has been specified as a narcotic since 2007. Instead of using ketamine, Kawai et al. reported an injectable formula with an equivalent effect to the mixture of ketamine and xylazine [11]. The mixture of 0.3 mg/kg body weight (b.w.) medetomidine (Med.), 4.0 mg/kg b.w. midazoram (Mid.), and 5.0 mg/kg b.w. butorphanol (But.) produced an anesthetic duration of around 40 min in outbred ICR mice. However, the anesthetic effect of the mixture for inbred mice strains remains unknown. Therefore, we examined anesthetic effects of the mixture of Med., Mid., and But. in the BALB/c and C57BL/6J strains. After intraperitoneal injection into mice, right front paw, left hind paw, and tail pinch reflexes as well as corneal and righting reflexes were observed. Every 5 min, we scored each reflex category as 0 for reaction or 1 for no reaction. As long as the total score was at least 4 out of 5, we considered the mixture as putting a mouse in a surgical anesthetic state. The mixture produced an anesthetic duration of more than 45 min in both strains of mice. These results indicate that the mixture of Med., Mid., and But. can be a useful and effective anesthesia for the BALB/c and C57BL/6J strains of inbred mice as well as outbred ICR mice.

View full abstract

Amygdala kindling is useful for modeling human epilepsy development. It has been known that genetic factors are involved in the development of amygdala kindling. The purpose of this study was to identify the loci that are responsible for the development of amygdala kindling. To achieve this, rat strains from a LEXF/FXLE recombinant inbred (RI) strain panel were used. The phenotypes of amygdala kindling-related parameters for seven RI strains and parental LE/Stm and F344/Stm strains were determined. They included the afterdischarge threshold (ADT), the afterdischarge duration (ADD), and the kindling rate, an incidence of development of kindling. Quantitative trait loci (QTL) analysis was performed to identify linkage relationships between these phenotypes and 1,033 SNP markers. Although no significant differences in pre-kindling ADT and ADD were observed, a significant difference in the kindling rate was found for the LEXF/FXLE RI strain. Two QTLs for the amygdala kindling rate (Agkr1 and Agkr2) were identified on rat chromosome 2. These findings clearly prove the existence of genetic influences that are involved in kindling development and suggest that substantial genetic components contribute to the progression of partial seizures into generalized seizures.

View full abstract

This study aims to investigate the effects of rhBMP-2/ACS composite on bone regeneration and mineralization during expansion of the interparietal suture in rats. Forty 10-week-old Sprague-Dawley rats were divided into four groups (n=10). The first group (intact group) did not receive any intervention. The second group (expansion control group) received an expansion force of 60 g. The remaining two groups received an expansion force of 60 g and were implanted with an atelo-type I absorbable collagen sponge and rhBMP-2/ACS composite positioned on the suture beneath the periosteum. The relapse, relapse ratio, relevant bone remodelling, and calcium and osteocalcin contents were evaluated. Bone regeneration in the interparietal suture was estimated by the histological method. The osteocalcin content was measured by radioimmunoassay, and the calcium content was measured by atomic absorption spectrophotometry. Bone regeneration was more active in the suture after application of the expansion force compared with that of the suture without any intervention. Bone bridges formed in the rhBMP-2/collagen composite group. Both osteocalcin and calcium content were higher in the rhBMP-2/collagen composite group than in the other three groups (P<0.01). The relapse ratio in the rhBMP-2/collagen group was much lower than that in the other two expansion groups (P<0.01). RhBMP-2/ACS composite can promote bone regeneration and bone mineralization in the expanded suture and decrease the relapse ratio. Thus, the rhBMP-2/ACS composite may be therapeutically beneficial to the inhibition of relapse and shortening of the retention period during rapid expansion.

View full abstract

Cell delivery via the retrograde coronary route boasts less vessel embolism, myocardial injury, and arrhythmogenicity when compared with those via antegrade coronary administration or myocardial injection. However, conventional insertion into the coronary sinus and consequent bleeding complication prevent its application in small animals. To overcome the complication of bleeding, we described a modified coronary retroinfusion technique via the jugular vein route in rats with myocardial infarction (MI). A flexible wire with a bent end was inserted into the left internal jugular vein and advanced slowly along the left superior vena cava. Under direct vision, the wire was run into the left cardiac vein by rotating the wire and changing the position of its tip. A fine tube was then advanced along the wire to the left cardiac vein. This modified technique showed less lethal hemorrhage than the conventional technique. Retroinfusion via transjugular catheter enabled efficient fluid or cell dissemination to the majority areas of the free wall of the left ventricle, covering the infarcted anterior wall. In conclusion, transjugular cardiac vein catheterization may make retrocoronary infusion a more safe and practical route for delivering cell, drug, and gene therapy into the infarcted myocardium of rats.

View full abstract

Qualitative measurement of the infective level is relatively difficult in experimental vaginal candidiasis. Female BALB/c mice aged 8 to 10 weeks were randomly divided into E1, E2 and E0 groups, which received subcutaneous injection of 0.05 mg, 0.1 mg of estradiol benzoate or 0.1 ml soybean oil 3 days before vaginal inoculation, respectively, and hormone treatment continued every other day thereafter. Each group was further divided into infected and noninfected subgroups. The infected mice were inoculated intravaginally with 10 μl (5 × 10⁴ conidia) of Candida albicans suspension, while the noninfected mice were inoculated with 10 μl phosphate-buffered saline. Direct microscopic examination, colony count and vaginal histopathology including infection degree and inflammation extent were performed at 3, 7 and 14 days post inoculation. Estrogen treatment increased the vaginal fungal burden and extent of infection and inflammation compared with the control group, and 0.3 mg/week estrogen generally induced more severe infection and inflammation than 0.15 mg/week estrogen did. Colony count peaked on day 3 and decreased remarkably after 7 days. Infection score increased gradually during the first 7 days and decreased on day 14, while inflammation extent exacerbated progressively over the course of 14 days. This study demonstrates that the modified histological scoring system might be more feasible than colony count for evaluation of infectivity and dynamic change in experimental vaginal candidiasis.

View full abstract

Duchenne muscular dystrophy (DMD) is an X-linked recessive progressive muscle degenerative disorder that causes dilated cardiomyopathy in the second decade of life in affected males. Dystrophin, the gene responsible for DMD, encodes full-length dystrophin and various short dystrophin isoforms. In the mouse heart, full-length dystrophin Dp427 and a short dystrophin isoform, Dp71, are expressed. In this study, we intended to clarify the functions of these dystrophin isoforms in DMD-related cardiomyopathy. We used two strains of mice: mdx mice, in which Dp427 was absent but Dp71 was present, and DMD-null mice, in which both were absent. By immunohistochemical staining and density-gradient centrifugation, we found that Dp427 was located in the cardiac sarcolemma and also at the T-tubules, whereas Dp71 was specifically located at the T-tubules. In order to determine whether T tubule-associated Dp71 was involved in DMD-related cardiac disruption, we compared the cardiac phenotypes between DMD-null mice and mdx mice. Both DMD-null mice and mdx mice exhibited severe necrosis, which was followed by fibrosis in cardiac muscle. However, we could not detect a significant difference in myocardial fibrosis between mdx mice and DMD-null mice. Based on the present results, we have shown that cardiac myopathy is caused predominantly by a deficiency of full-length dystrophin Dp427.

View full abstract

The tremor rat is an autosomal recessive mutant exhibiting sterility with gonadal hypoplasia in both sexes. The causative mutation tremor (tm) is known as a genomic deletion spanning >200 kb in Chr 10q24. Spermatogenesis associated 22 (Spata22) has been shown to be a vertebrate-specific gene essential for the progression of meiosis through prophase I and completion of chromosome synapsis and meiotic recombination using a mouse repro42 mutant carrying an N-ethyl-N-nitrosourea (ENU)-induced nonsense mutation in Spata22. In this study, we show that Spata22 was identified as the gene responsible for the failure of gametogenesis to progress beyond meiosis I in tm homozygous rats by a transgenic rescue experiment. Meiosis was arrested during prophase I in the mutant testis. Precise mapping of the breakage point revealed that the deleted genomic region spanned approximately 240 kb and comprised at least 13 genes, including Spata22. Rat Spata22 was predominantly expressed in the testis, and its transcription increased with the first wave of spermatogenesis, as seen in the mouse ortholog. These results suggest that Spata22 may play an important role in meiotic prophase I in rats, as seen in mice, and that the tm homozygous rat may be useful for investigating the physiological function of Spata22, as an experimental system for clarifying the effect of a null mutation, and may be an animal model for studying the pathogenesis and treatment of infertility caused by impaired meiosis.

View full abstract

Post-weaning individual housing induces significant alterations in the reward system of adult male rats presented with sexually receptive female rats. In this study, we examined the effects of post-weaning individual housing on autonomic nervous activity in adult male rats during encounters with sexually receptive female rats to assess whether different affective states depending on post-weaning housing conditions are produced. Changes in heart rate and spectral parameters of heart rate variability indicated that in post-weaning individually housed male rats, both sympathetic and parasympathetic activity increased with no change in the sympathovagal balance, while in post-weaning socially housed male rats, both sympathetic and parasympathetic activity decreased with a predominance of parasympathetic activity. These two patterns of shifts in sympathovagal balances closely resembled changes in autonomic nervous activity with regard to classical appetitive conditioning in male rats. The autonomic changes in male rats housed individually after weaning corresponded to changes associated with the reward-expecting state evoked by the conditioned stimulus, and the autonomic changes observed in male rats housed socially after weaning corresponded to changes associated with the reward-receiving state evoked by the unconditioned stimulus. These results suggest that different affective states were induced in adult male rats during sexual encounters depending on male-male social interactions after weaning. The remarkable change caused by post-weaning individual housing may be ascribed to alteration of the reward system during sexual encounters induced by deficiency of intermale social communication after weaning.

View full abstract

We evaluated the in vitro efficacy of weak acid hypochlorous solution (WAHS) against murine norovirus (MNV) by plaque assay and compared the efficacy with diluted NaOCl (Purelox) and 70% ethanol. WAHS was as effective as 70% ethanol and diluted Purelox for 0.5-min reactions. For 0.5-min reactions in the presence of mouse feces emulsion, the efficacy of WHAS and 1:600 diluted Purelox was decreased, reducing the virus titers by 2.3 and 2.6 log₁₀, respectively, while 70% ethanol reduced the titer by more than 5 log₁₀. However, WAHS showed more than 5 log₁₀ reductions for the 5-min reaction even in the presence of feces emulsion. Since WAHS showed enough efficacy in inactivating MNV in vitro, we tried to eliminate MNV from MNV-infected mice by substituting WAHS for their drinking water. However, MNV was found to be positive in feces of mice drinking WAHS by an RT-nested PCR and plaque assay. To investigate whether hypochlorite-based disinfectants could prevent infection of a mouse with MNV, WAHS or 1:6,000 diluted Purelox was substituted for the drinking water of mice for 2 or 4 weeks, and then the mice were placed in a cage with an MNV-infected mouse. The supply of disinfectants was continued after cohabitation, but MNV was detected in the feces of all the mice at 1 week after cohabitation. In this study, we tried to eliminate and prevent MNV infection from mice by supplying hypochlorite-based disinfectants as an easy and low-cost method. Unfortunately, drinking disinfectants was ineffective, so it is important to keep the facility environment clean by use of effective disinfectants. Also, animals introduced into facilities should be tested as MNV free by quarantine and periodically confirmed as MNV free by microbiological monitoring.

View full abstract

As malfunction/absence of immune cells causes a variety of immunosuppressive disorders and chemical synthetic drugs for curing these diseases have many adverse effects, vigorous studies are being conducted. The Acanthopanax family has been used as traditional medicines for gastric ulcer, diabetes, etc. and culinary materials in East-South Asia. In this study, the immunostimulating properties of A. sessiliflorus were evaluated. A. sessiliflorus increased not only the splenocyte number but also immune-related cytokines such as TNF-α. However, it could not upregulate the expressions of IFN-γ and IL-2. A. sessiliflorus increased the swimming time, and comparison of organ weights relative to body weights for immune-related organs such as the spleen and thymus after a forced swim test showed that it could recover the spleen and thymus weights. It also increased the expression of TNF-α and slightly increased the concentration of IFN-γ but not IL-2. From the results, we concluded that as A. sessiliflorus has not only a host defense effect but also a stress-ameliorating property, further study it will be a promising material of immunostimulating material.

View full abstract

Although recent studies suggest that hyperlipidemia is a risk factor for osteoarthritis (OA), the link between OA and hyperlipidemia is not fully understood. As the number of activated, circulating myeloid cells is increased during hyperlipidemia, we speculate that myeloid cells contribute to the pathology of OA. Here, we characterized myeloid cells in STR/Ort mice, a murine osteoarthritis model, under hyperlipidemic conditions. Ratios of myeloid cells in bone marrow, the spleen, and peripheral blood were determined by flow cytometry. To examine the influence of the hematopoietic environment, including abnormal stem cells, on the hematopoietic profile of STR/Ort mice, bone marrow transplantations were performed. The relationship between hyperlipidemia and abnormal hematopoiesis was examined by evaluating biochemical parameters and spleen weight of F₂ animals (STR/Ort x C57BL/6J). In STR/Ort mice, the ratio of CD11b⁺Gr1⁺ cells in spleens and peripheral blood was increased, and CD11b⁺Gr1⁺ cells were also present in synovial tissue. Splenomegaly was observed and correlated with the ratio of CD11b⁺Gr1⁺ cells. When bone marrow from GFP-expressing mice was transplanted into STR/Ort mice, no difference in the percentage of CD11b⁺Gr1⁺ cells was observed between transplanted and age-matched STR/Ort mice. Analysis of biochemical parameters in F₂ mice showed that spleen weight correlated with serum total cholesterol. These results suggest that the increase in circulating and splenic CD11b⁺Gr1⁺ cells in STR/Ort mice originates from hypercholesterolemia. Further investigation of the function of CD11b⁺Gr1⁺ cells in synovial tissue may reveal the pathology of OA in STR/Ort mice.

View full abstract

We analyzed the Hr gene of a hairless mouse strain of unknown origin (HR strain, http://animal.nibio.go.jp/e_hr.html) to determine whether the strain shares a mutation with other hairless strains, such as HRS/J and Skh:HR-1, both of which have an Hr^hr allele. Using PCR with multiple pairs of primers designed to amplify multiple overlapping regions covering the entire Hr gene, we found an insertion mutation in intron 6 of mutant Hr genes in HR mice. The DNA sequence flanking the mutation indicated that the mutation in HR mice was the same as that of Hr^hr in the HRS/J strain. Based on the sequence, we developed a genotyping method using PCR to determine zygosities. Three primers were designed: S776 (GGTCTCGCTGGTCCTTGA), S607 (TCTGGAACCAGAGTGACAGACAGCTA), and R850 (TGGGCCACCATGGCCAGATTTAACACA). The S776 and R850 primers detected the Hr^hr allele (275-bp amplicon), and S607 and R850 identified the wild-type Hr allele (244-bp amplicon). Applying PCR using these three primers, we confirmed that it is possible to differentiate among homozygous Hr^hr (longer amplicons only), homozygous wild-type Hr(shorter amplicons only), and heterozygous (both amplicons) in HR and Hos:HR-1 mice. Our genomic analysis indicated that the HR, HRS/J, and Hos:HR-1 strains, and possibly Skh:HR-1 (an ancestor of Hos:HR-1) strain share the same Hr^hr gene mutation. Our genotyping method will facilitate further research using hairless mice, and especially immature mice, because pups can be genotyped before their phenotype (hair coat loss) appears at about 2 weeks of age.

View full abstract