Protective Effects of Apomorphine against Zinc-Induced Neurotoxicity in Cultured Cortical Neurons

Abstract

There is evidence that excessive zinc (Zn²⁺) release from presynaptic terminals following brain injuries such as ischemia and severe epileptic seizures induces neuronal cell death. Apomorphine (Apo), a dopamine receptor agonist, has been shown to have pleiotropic biological functions. In this study, we investigated whether Apo protects cultured cortical neurons from neurotoxicity provoked by excessive Zn²⁺ exposure. Pretreatment with Apo dose- and time-dependently ameliorated Zn²⁺ neurotoxicity. In addition, pretreatment with Apo prevented intracellular nicotinamide adenine dinucleotide (NAD⁺) and ATP depletion caused by Zn²⁺ exposure. Dopamine receptor antagonists did not influence Apo protection against Zn²⁺ neurotoxicity. Apo is shown to be autoxidized to produce oxidized products such as reactive oxygen species and quinones. N-Acetylcysteine, a thiol compound, partially reduced Apo protection. Entry of Zn²⁺ into neurons is thought to be a critical step of Zn²⁺ neurotoxicity. Interestingly, we found that pretreatment with Apo decreased elevation of intracellular Zn²⁺ levels after Zn²⁺ exposure and induced mRNA expression of the zinc transporter ZnT1, which transports intracellular Zn²⁺ out of cells, and metallothionein. Taken together, these results suggest that the protective effects of Apo are regulated, at least in part, by its oxidized products, and preventing intracellular accumulation of Zn²⁺ contributes to Apo protection against Zn²⁺ neurotoxicity.

In the central nervous system, zinc (Zn²⁺) is mainly stored in the presynaptic vesicles along with glutamate and released into the extracellular space in an activity-dependent manner. The released Zn²⁺ is thought to function as a neurotransmitter or a neuromodulator.¹⁾ However, there is increasing evidence that ischemic stroke stimulates excessive Zn²⁺ release from presynaptic terminals, leading to neuronal cell death.^2,3) It was reported that the blockade of free Zn²⁺ by Zn²⁺ chelators abolishes the neurodegeneration induced by ischemia.⁴⁾ These findings support the concept that Zn²⁺ is a mediator of the neuronal cell death following brain ischemia. However, the mechanism by which excessive free Zn²⁺ causes neurotoxicity is not fully understood.

The entry of Zn²⁺ into neurons is thought to be a critical step of Zn²⁺ neurotoxicity. It has been reported that Zn²⁺ influx is mediated through voltage-gated Ca²⁺ channels (VGCCs) and the N-methyl-d-aspartate (NMDA) receptor.⁵⁾ Elevation of intracellular Zn²⁺ levels caused by Zn²⁺ exposure has been shown to reduce cellular nicotinamide adenine dinucleotide (NAD⁺) level, leading to inhibition of glyceraldehyde-3-phosphate dehydrogenase (GAPDH).^6,7) Zn²⁺ also directly inhibits GAPDH. In addition, Zn²⁺ suppresses the mitochondrial respiratory chain, resulting in mitochondrial depolarization and dysfunctions.⁸⁾ These events provoke a progressive decline of ATP level and energy failure. Moreover, restoration of NAD⁺ was shown to attenuate neuronal cell death induced by Zn²⁺.⁶⁾ Therefore, it is proposed that accumulation of Zn²⁺ in neuronal cells suppresses cellular energy production, leading to Zn²⁺ neurotoxicity.

Apomorphine (Apo), a nonselective dopamine receptor agonist, is used for clinical therapy of Parkinson’s disease.⁹⁾ It has been reported that Apo has pleiotropic biological functions. For example, Apo has been shown to act as a potent antioxidant and prevent the neuronal cell death associated with oxidative stress induced by hydrogen peroxide or the neurotoxin 6-hydroxydopamine.^10,11) Apo markedly increases the expression of nerve growth factor and glial cell line-derived neurotrophic factor in mouse astrocytes.¹²⁾ A recent report demonstrates that Apo stimulates degradation of intracellular amyloid-β in Alzheimer’s disease model mouse.¹³⁾ These multiple pharmacological functions of Apo are thought to exert neuroprotective effects.

The aim of this study is to determine whether Apo protects cortical neurons from neuronal cell death caused by excessive Zn²⁺ exposure. We demonstrated here that Apo exerts protective effects against Zn²⁺ neurotoxicity through dopamine receptor-independent mechanisms.

Materials and Methods

Preparation of Cortical Neurons

Cortical neuronal-enriched cultures were prepared from embryonic day 17 rat fetuses as previously described.¹⁴⁾ Briefly, dissociated cells were cultured in a plating medium containing 80% Dulbecco’s modified Eagle’s medium (DMEM), 10% Ham’s F12-nutrients, 10% heat-inactivated fetal calf serum, 100 units/mL penicillin G, and 0.1 mg/mL streptomycin (DMEM/F12) in a humidified 5% CO₂/95% air incubator at 37°C. Two days later, cells were treated with 3 µm cytosine arabinoside. After 4 d, the DMEM/F12 medium was replaced with Neurobasal medium containing 1× B27 supplement, 100 units/mL penicillin G, and 0.1 mg/mL streptomycin (Neurobasal/B27) and cortical neurons were maintained for 8–12 d in vitro (DIV) 8–12. The protocols using animals were approved by the Institutional Animal Care and Use Committee of Gifu Pharmaceutical University.

Neurotoxicity Assay

Toxicity assays were performed using neurons (DIV 8–12) cultured in a 24-well plate. Neurons were pretreated with various concentrations of Apo in Neurobasal/B27 for the indicated time. After the pretreatment, cortical neurons were exposed to various concentrations of ZnSO₄ in serum-free minimal essential medium (MEM) for 1 h. The exposure to Zn²⁺ was terminated by replacing Zn²⁺-containing MEM with fresh serum-free MEM and then cortical neurons were cultured for 15 h. Cell viability was measured using the Cell-Counting Kit 8 (Dojindo, Japan), which is a colorimetric assay to determine survival rate. The water-soluble tetrazolium salt, WST-8, is reduced by dehydrogenases in living cells, leading to generation of a yellow-color formazan dye. The absorbance at 490 nm was detected using a microplate reader. Reagents such as antagonists were added 30 min prior to pretreatment with Apo and were present in the medium during Apo treatment. The experiments of cell viability were carried out in triplicate.

Measurement of NAD⁺

Intracellular NAD⁺ levels were measured using the EnzyChrom NAD⁺/NADH assay kit (BioAssay Systems, Hayward, CA, U.S.A.). Treated neurons were washed with cold phosphate buffered saline (PBS), and then lysed with the supplied NAD extraction buffer. NAD⁺ was extracted from the lysate according to the manufacturer’s protocol. The measurement of NAD⁺ is based on an alcohol dehydrogenase cycling reaction. The change in absorbance at 565 nm for 15 min at room temperature was measured. The protein content in the lysate was determined using Bio-Rad protein assay reagent.

Measurement of ATP

Intracellular ATP levels were measured using the ENLITEN rLuciferase/Luciferin Reagent (Promega, Madison, WI, U.S.A.). Treated neurons were washed with cold PBS and then lysed by addition of 0.5 m perchloric acid. The lysate was neutralized by 1.5 m KOH and centrifuged. The supernatant was diluted with 10 mm Tris–HCl pH 7.8 (1 : 100), and then aliquots (10 µL) of diluted samples were subjected to ATP measurement. The luminescence was detected using a luminometer.

Zn²⁺ Imaging

Cortical neurons (DIV 8–12) were pretreated with Apo (30 µm) in Neurobasal/B27 for 1 or 3 h. Apo-containing medium was completely removed, and then pretreated neurons were exposed to ZnSO₄ (100 µm) for 1 h in serum-free MEM. After Zn²⁺ exposure, Zn²⁺-containing MEM was replaced with fresh serum-free MEM and then cortical neurons were treated with the Zn²⁺ fluorescence probe FluoZin-3 AM (1 µm) for 20 min. Intracellular Zn²⁺ levels were visualized using a fluorescence microscope and the images were quantified using the NIH Image J Software.

Polymerase Chain Reaction (PCR) Analysis

Cortical neurons maintained in a 6-cm-diameter dish were used. Total RNA was extracted from the treated neurons with TRIzol reagent (Invitrogen, Carlsbad, CA, U.S.A.). First-strand cDNA was synthesized from 4 µg of total RNA. Semi-quantitative reverse transcription (RT)-PCR was performed to determine expression of dopamine D1, D2, and D4 receptors. Amplification was carried out as follows: 2 min at 94°C, one cycle; 40 s at 94°C, 40 s at 58°C, 1 min at 72°C, 30 cycles. Quantitative real-time PCR was performed to determine expression levels of metallothionein (MT) and ZnT1 using the SYBR Premix Ex Taq (TaKaRa Bio Inc., Japan). mRNA levels of MT and ZnT1 were normalized relative to β-actin mRNA level in each sample. The primers used for PCR analysis were listed in Table 1.

Table 1. Primer Sequences for PCR Analysis

Target	Primer sequence(5′→3′)		Product size (bp)
Dopamine D1 R	Forward	TCCTGATTAGCGTAGCATGG	380
	Reverse	CTCCCTCTTGAAGGACATCT
Dopamine D2 R	Forward	GCCTACATAGCAACCCTGAC	302
	Reverse	CCATGTGAAGGCGCTGTAGA
Dopamine D4 R	Forward	TGTCCGCTCATGCTACTGCT	331
	Reverse	GCTCCCTTCCAGTGATCTTG
MT	Forward	ATGGACCCCAACTGCTCCTG	179
	Reverse	CAGCAGGTGCACTTGTCCGA
ZnT1	Forward	CCCACTGCTCAAGGAGTCCGCTCT	120
	Reverse	TGTAACTCATGGACTTCCTCCACT
β-Actin	Forward	AAGCTGTGCTATGTTGCCCT	117
	Reverse	CTTGCCGATAGTGATGACC

Measurement of Reactive Oxygen Species (ROS)

Cortical neurons (DIV 8–12) were treated with Apo (30 µm) in serum-free MEM for 3 h. Dihydroethidium (DHE; 3 µm), which is a fluorescence probe for the detection of intracellular ROS, was added to the cultures at the point of 2.5 h, and neurons were incubated during the last 30 min in the presence of it. After washing twice with PBS, the fluorescence of DHE was detected using a fluorescence microscope. Quantifying the image was done using the NIH Image J Software.

Statistics

Data were analyzed using ANOVA followed by post hoc Bonferroni tests or Student’s t-test. A p value less than 0.05 was considered significant.

Results

Effects of Pretreatment with Apo on Zn²⁺ Neurotoxicity

It has been reported that exposure to excessive Zn²⁺ causes neuronal cell death.^2–4,15) First, to examine whether Zn²⁺ exposure affects viability of cultured cortical neurons under our experimental conditions, cortical neurons were exposed to various concentrations of ZnSO₄ for 1 h. As shown in Fig. 1A, Zn²⁺ dose-dependently induced neuronal cell death. Next, to investigate whether pretreatment with Apo exerts protective effects against Zn²⁺-induced neurotoxicity, cortical neurons were pretreated with Apo (20 µm) for 3 h, followed by exposure to various concentrations of ZnSO₄ for 1 h in the absence of Apo. As shown in Fig. 1A, pretreatment with Apo rescued cortical neurons from Zn²⁺ neurotoxicity. Even when neurons were exposed to Zn²⁺, the morphological changes were hardly observed in Apo-pretreated cortical neurons (Fig. 1B). Therefore, a ZnSO₄ concentration of 100 µm was employed to induce Zn²⁺ neurotoxicity in the following experiments. Pretreatment of cortical neurons with Apo suppressed Zn²⁺ neurotoxicity in a dose- and time-dependent manner (Figs. 1C, D).

Fig. 1. Protective Effects of Apo against Zn²⁺ Neurotoxicity

(A) Cortical neurons were pretreated with or without Apo (20 µm) for 3 h. Apo was completely removed from the culture, and then neurons were exposed to various concentrations of Zn²⁺ (100, 150, or 200 µm) for 1 h in serum-free MEM. ** p<0.01 (vs. untreated neurons). ^## p<0.01. (B) Phase-contrast micrographs. Bar=50 µm. (C) Apo-dose dependence study. Cortical neurons were pretreated with Apo (10, 20, or 30 µm) for 3 h. Apo was completely removed from the culture, and then neurons were exposed to Zn²⁺ (100 µm) for 1 h in serum-free MEM. ** p<0.01 (vs. untreated neurons). ^## p<0.01 (vs. neurons treated with Zn²⁺ alone). (D) Time course study. Cortical neurons were pretreated with Apo (20 µm) for the indicated times. Apo was completely removed from the culture, and then neurons were exposed to Zn²⁺ (100 µm) for 1 h in serum-free MEM. ** p<0.01 (vs. untreated neurons). ^# p<0.05; ^## p<0.01 (vs. neurons treated with Zn²⁺ alone).

Pretreatment with Apo Prevents Zn²⁺-Induced Depletion of Intracellular NAD⁺ and ATP

Zn²⁺ overload in neurons has been shown to cause reduction of intracellular NAD⁺ and ATP. Therefore, to examine the effects of Apo on Zn²⁺-induced NAD⁺ and ATP depletion, cortical neurons were pretreated with Apo (20 µm) for 3 h, followed by exposure to ZnSO₄ (100 or 200 µm) for 1 h in the absence of Apo. One and a half hours after Zn²⁺ exposure, intracellular NAD⁺ levels were measured. As shown in Fig. 2A, Zn²⁺ markedly decreased intracellular NAD⁺ levels. Pretreatment with Apo partially but significantly prevented NAD⁺ depletion caused by 100 µm Zn²⁺ exposure. Five hours after Zn²⁺ exposure, we measured intracellular ATP levels. Zn²⁺ drastically suppressed intracellular ATP levels (Fig. 2B). As expectedly, however, pretreatment with Apo also partially attenuated Zn²⁺-induced ATP depletion (Fig. 2B).

Fig. 2. Effects of Apo on Zn²⁺-Induced NAD⁺ Depletion (A) and ATP Depletion (B)

(A) Cortical neurons were pretreated with Apo (20 µm) for 3 h. Apo was completely removed from the culture, and then neurons were exposed to Zn²⁺ (100 or 200 µm) for 1 h in serum-free MEM. One and a half hours after Zn²⁺ exposure, intracellular NAD⁺ contents were measured. ** p<0.01 (vs. untreated neurons). ^# p<0.05. (B) Cortical neurons were pretreated with or without Apo (20 µm) for 3 h. Apo was completely removed from the culture, and then neurons were exposed to various concentrations of Zn²⁺ (100 or 200 µm) for 1 h in serum-free MEM. Five hours after Zn²⁺ exposure, intracellular ATP contents were measured. ** p<0.01 (vs. untreated neurons). ^#, ## p<0.05 and p<0.01, respectively.

Apo Protection Is Independent of Dopamine Receptors

Since Apo is a dopamine receptor agonist, we investigated whether protective effects of Apo are mediated via dopamine receptors. Dopamine D1 and D2 receptors were expressed in cultured cortical neurons, but the expression level of dopamine D4 receptor was very low (Fig. 3A). Cortical neurons were pretreated with Apo (20 µm) for 3 h in the presence or absence of each dopamine receptor antagonist SCH 23390 (D1 receptor antagonist; 30 µm), sulpiride (D2-like receptor antagonist; 30 µm), or spiperone (D2-like, especially D4, antagonist; 30 µm), followed by exposure to ZnSO₄ (100 µm) for 1 h. As shown in Fig. 3B, these dopamine receptor antagonists had no effect on Apo protection against Zn²⁺ neurotoxicity. These findings indicate that dopamine receptors are not responsible for the protective effects of Apo.

Fig. 3. Effects of Dopamine Receptor Antagonists on Apo Protection

(A) Expression of dopamine receptors in cultured cortical neurons. (B) Effects of dopamine antagonists on Apo protection. Cortical neurons were pretreated with Apo (20 µm) for 3 h in the presence of each dopamine antagonist. Antagonists (30 µm) were present in the medium 30 min prior to and during treatment with Apo. Apo and antagonists were completely removed from the culture, and then neurons were exposed to Zn²⁺ (100 µm) for 1 h in serum-free MEM. ** p<0.01 (vs. untreated neurons). ^## p<0.01 (vs. neurons treated with Zn²⁺ alone). NS, not significant. SCH, SCH23390; Sul, sulpiride; Spi, spiperone.

Involvement of Redox Reaction of Apo in Apo Protection

Apo is reported to be autoxidized to produce ROS and its oxidized derivatives such as quinines.¹⁶⁾ Therefore, we examined the possibility that these products modulate Apo protection. First, to test effect of N-acetylcysteine (NAC), a thiol compound, on Apo protection, cortical neurons were pretreated with Apo (20 µm) in the presence or absence of NAC (1 mm), followed by exposure to Zn²⁺. As shown in Fig. 4A, NAC partially but significantly abolished protective effects of Apo, while NAC alone failed to protect neurons from Zn²⁺ toxicity. Thus, it is unlikely that NAC sequesters Zn²⁺ and decreases intracellular Zn²⁺ level. In addition, treatment with Apo (30 µm) promoted generation of ROS and NAC (1 mm) significantly suppressed Apo-induced ROS production (Fig. 4B). We also examined effects of other antioxidants such as superoxide dismutase (SOD), catalase, and trolox, a derivative of vitamin E, on Apo protection. However, they did not influence Apo protection (Fig. 4C).

Fig. 4. Involvement of Redox Reaction of Apo in Protective Effects of Apo

(A) Effect of NAC on Apo protection. Cortical neurons were pretreated with Apo (20 µm) for 3 h. NAC (1 mm) was present during treatment with Apo. Apo was completely removed from the culture, and then neurons were exposed to Zn²⁺ (100 µm) for 1 h in serum-free MEM. ** p<0.01 (vs. neurons treated with Zn²⁺ alone). ^## p<0.01. (B) Effect of NAC on Apo-induced ROS generation. Cortical neurons were treated with Apo (30 µm) for 3 h in the presence or absence of NAC (1 mm). ** p<0.01 (vs. control). ^## p<0.01. (C) Effects of antioxidants on Apo protection. Cortical neurons were pretreated with Apo (20 µm) for 3 h. SOD (300 U/mL), catalase (Cat; 100 U/mL), and trolox (Tro; 300 µm) were present during treatment with Apo. Apo and antioxidants were completely removed from the culture, and then neurons were exposed to Zn²⁺ (100 µm) for 1 h in serum-free MEM. ** p<0.01 (vs. neurons treated with Zn²⁺ alone), NS, not significant.

Effect of Apo on Zn²⁺ Entry into Cortical Neurons

Several reports have demonstrated that toxic Zn²⁺ influx into neurons is mediated through various ion channels including VGCCs and NMDA receptor.⁵⁾ Entry of Zn²⁺ into neurons is thought to be a critical step of Zn²⁺ neurotoxicity. Therefore, we examined whether Apo affects entry of Zn²⁺ into neurons. Cultured cortical neurons were pretreated with Apo (30 µm) for 1 or 3 h, followed by exposure to Zn²⁺. One hour after Zn²⁺ exposure, intracellular Zn²⁺ imaging was performed using the Zn²⁺ fluorescence probe, FluoZin-3 AM. As shown in Fig. 5A, Zn²⁺ exposure caused elevation of intracellular Zn²⁺ levels. When cortical neurons were pretreated with Apo, the rise in intracellular Zn²⁺ levels was suppressed in a time-dependent manner on Apo treatment (Fig. 5A). This result indicates that pretreatment with Apo reduces intracellular accumulation of Zn²⁺ after Zn²⁺ exposure.

Fig. 5. Effects of Apo on Zn²⁺ Accumulation after Zn²⁺ Exposure (A) and Expression of MT and ZnT1 mRNAs (B)

(A) Cortical neurons were pretreated with Apo (30 µm) for 1 or 3 h. Apo was completely removed from the culture, and then neurons were exposed to Zn²⁺ (100 µm) for 1 h in serum-free MEM. After Zn²⁺ exposure, intracellular Zn²⁺ was visualized using a fluorescence microscope. The number shown in parentheses is the time of pretreatment with Apo. Bar=50 µm. ** p<0.01 (vs. control). ^#, ## p<0.05 and p<0.01, respectively (vs. neurons treated with Zn²⁺ alone). (B) Cortical neurons were treated with (gray bar) or without (open bar) Apo (20 µm) for 2, 4, and 8 h. After the treatment, quantitative real-time PCR was performed. ** p<0.01 (vs. Apo-untreated neurons).

Zinc transporter families, ZnT and Zip, and metal binding proteins such as MT play important roles in Zn²⁺ homeostasis in the brain.¹⁷⁾ ZnT1, a zinc exporter, is located on the plasma membrane and is responsible for transport of cytosolic Zn²⁺ to the extracellular space. Ectopic expression of ZnT1 and MT genes has been shown to rescue Zn²⁺ neurotoxicity provoked by excessive Zn²⁺ exposure.^18,19) To examine whether Apo influences expression of ZnT1 and MT mRNAs under our experimental conditions, cortical neurons were treated with Apo (20 µm) for the indicated time, and then quantitative real time-PCR was carried out. Interestingly, Apo time-dependently induced expression of ZnT1 and MT mRNAs (Fig. 5B).

Discussion

We demonstrated here that Apo protects cultured cortical neurons from Zn²⁺ neurotoxicity. It has been reported that Zn²⁺ chelating agents such as glutathione have protective effects against Zn²⁺ neurotoxicity in cultured cortical neurons.²⁰⁾ Since Apo has a catechol structure, this raises the possibility that Apo acts as a Zn²⁺ chelator. In our experimental protocol, however, Apo was completely removed from the culture, and then the pretreated neurons were exposed to Zn²⁺ in the absence of Apo. We also confirmed that pretreatment with Apo failed to protect differentiated SH-SY5Y and PC12 cells from Zn²⁺ neurotoxicity (data not shown). Therefore, it is unlikely that direct chelation of Zn²⁺ by Apo contributes to the protective effects of Apo. Moreover, the finding that the protective effect of Apo is specific to cortical neurons suggests that Apo protection might be mediated via unknown neuron-specific target molecule(s).

Zn²⁺ overload in neurons has been shown to cause reduction of cellular NAD⁺ and inhibition of GAPDH.^6,7) Zn²⁺ also directly inhibits the mitochondrial respiratory chain, resulting in mitochondrial depolarization and dysfunctions.⁸⁾ These events provoke a progressive decline of ATP level and energy failure. Additionally, intracellular NAD⁺ level is known to be a critical determinant of neuronal survival. It was reported that addition of exogenous NAD⁺ reduces Zn²⁺ neurotoxicity. We demonstrate here that pretreatment with Apo ameliorated a decrease in intracellular NAD⁺ and ATP levels caused by Zn²⁺ exposure. These results may be due to Apo-induced reduction in intracellular Zn²⁺ accumulation after Zn²⁺ exposure.

Recently, cellular functions have been shown to be regulated through redox modification of various proteins such as transcription factors and protein kinases.²¹⁾ Apo having a catechol structure is easily autoxidized to generate ROS and its oxidized products such as semiquinones and quinones, resulting in modification of proteins.¹⁶⁾ The thiol compound, l-cysteine, prevents the formation of Apo-protein conjugates.²²⁾ Previously, we have also demonstrated that Apo promoted activation of the transcription factor Nrf2, which is known as a redox sensor, and NAC completely suppressed the activation in SH-SY5Y cells¹¹⁾ and cortical neurons (unpublished data). In addition, NAC, but not SOD and catalase, reduced Apo protection against Zn²⁺ neurotoxicity. It has been demonstrated that antioxidants such as SOD and catalase have no effects on Nrf2 activation induced by oxidized catechol derivatives.²³⁾ Because NAC effectively traps quinones, these results suggest that the protective effect of Apo might be regulated by the oxidized products (e.g. 8-oxo-apomorphine-semiquinone) rather than ROS produced by autoxidization of Apo.

In this study, we found that Apo decreased the elevation of intracellular Zn²⁺ levels after Zn²⁺ exposure and induced expression of ZnT1 and MT mRNAs in cultured cortical neurons. The effect of Apo on the suppression of Zn²⁺ accumulation was enhanced in a time-dependent manner on Apo treatment. Therefore, Apo protection is likely to be, at least in part, due to promotion of Zn²⁺ efflux through ZnT1 and sequestration of Zn²⁺ by MT. Expression of these genes is regulated through the metal-response transcription factor 1 (MTF-1). MTF-1 binds to and activates the metal-responsive element (MRE) located in the regulatory regions of target genes. However, luciferase assay using the MRE-reporter plasmid revealed that Apo failed to activate the MRE in cultured neurons (data not shown). Unfortunately, the mechanism underlying Apo-induced ZnT-1 expression remains unclear at present. On the other hand, even when neurons were treated with Apo for 1 h, Apo partially prevented Zn²⁺ accumulation and Zn²⁺ neurotoxicity. This observation suggests that the protection against Zn²⁺ neurotoxicity induced by short-time treatment with Apo might be mediated through mechanisms other than ZnT1 and MT induction. To date, Zn²⁺ transport into or out of neurons has been reported to be regulated by various molecules including VGCCs,⁵⁾ zinc transporters,¹⁷⁾ transient receptor potential metastain 7 channels,²⁴⁾ and Na⁺/Zn²⁺ exchanger.²⁵⁾ Therefore, it is possible that Apo or its oxidized products might directly or indirectly modify these molecules involved in Zn²⁺ transport and alter their functions. Further studies are needed to understand the detailed mechanism of Apo protection.

In conclusion, we provide evidence that pretreatment with Apo has protective effects against Zn²⁺ neurotoxicity. It is commonly thought that posttreatment with drug(s) is important for the therapeutics of cerebral ischemia. However, perturbation of Zn²⁺ homeostasis as well as excessive ROS production has been reported to be closely related to neurodegeneration following cerebral ischemia.²⁶⁾ We also demonstrate the possibility that Apo may ameliorate Zn²⁺ perturbation in cortical neurons. Therefore, our findings may shed new light on for the development of therapeutic drugs of cerebral ischemia.

Acknowledgment

This work was supported by a Grant-in-Aid for Scientific Research (C) from the Japan Society for the Promotion of Science (to HH: No. 23590644) and the Shimabara Science Promotion Foundation (to HH).

References

• 1)  Peters S, Koh J, Choi DW. Zinc selectively blocks the action of N-methyl-D-aspartate on cortical neurons. Science, 236, 589–593 (1987).
• 2)  Lobner D, Canzoniero LM, Manzerra P, Gottron F, Ying H, Knudson M, Tian M, Dugan LL, Kerchner GA, Sheline CT, Korsmeyer SJ, Choi DW. Zinc-induced neuronal death in cortical neurons. Cell. Mol. Biol. (Noisy-le-grand), 46, 797–806 (2000).
• 3)  Weiss JH, Hartley DM, Koh JY, Choi DW. AMPA receptor activation potentiates zinc neurotoxicity. Neuron, 10, 43–49 (1993).
• 4)  Koh JY, Suh SW, Gwag BJ, He YY, Hsu CY, Choi DW. The role of zinc in selective neuronal death after transient global cerebral ischemia. Science, 272, 1013–1016 (1996).
• 5)  Sensi SL, Canzoniero LM, Yu SP, Ying HS, Koh JY, Kerchner GA, Choi DW. Measurement of intracellular free zinc in living cortical neurons: routes of entry. J. Neurosci., 17, 9554–9564 (1997).
• 6)  Sheline CT, Behrens MM, Choi DW. Zinc-induced cortical neuronal death: contribution of energy failure attributable to loss of NAD⁺ and inhibition of glycolysis. J. Neurosci., 20, 3139–3146 (2000).
• 7)  Cai AL, Zipfel GJ, Sheline CT. Zinc neurotoxicity is dependent on intracellular NAD levels and the sirtuin pathway. Eur. J. Neurosci., 24, 2169–2176 (2006).
• 8)  Dineley KE, Votyakova TV, Reynolds IJ. Zinc inhibition of cellular energy production: implications for mitochondria and neurodegeneration. J. Neurochem., 85, 563–570 (2003).
• 9)  Lees AJ. Dopamine agonists in Parkinson’s disease: a look at apomorphine. Fundam. Clin. Pharmacol., 7, 121–128 (1993).
• 10)  Gassen M, Gross A, Youdim MB. Apomorphine enantiomers protect cultured pheochromocytoma (PC12) cells from oxidative stress induced by H₂O₂ and 6-hydroxydopamine. Mov. Disord., 13, 661–667 (1998).
• 11)  Hara H, Ohta M, Adachi T. Apomorphine protects against 6-hydroxydopamine-induced neuronal cell death through activation of the Nrf2-ARE pathway. J. Neurosci. Res., 84, 860–866 (2006).
• 12)  Ohta M, Mizuta I, Ohta K, Nishimura M, Mizuta E, Hayashi K, Kuno S. Apomorphine up-regulates NGF and GDNF synthesis in cultured mouse astrocytes. Biochem. Biophys. Res. Commun., 272, 18–22 (2000).
• 13)  Himeno E, Ohyagi Y, Ma L, Nakamura N, Miyoshi K, Sakae N, Motomura K, Soejima N, Yamasaki R, Hashimoto T, Tabira T, LaFerla FM, Kira J. Apomorphine treatment in Alzheimer mice promoting amyloid-β degradation. Ann. Neurol., 69, 248–256 (2011).
• 14)  McLaughlin B, Hartnett KA, Erhardt JA, Legos JJ, White RF, Barone FC, Aizenman E. Caspase 3 activation is essential for neuroprotection in preconditioning. Proc. Natl. Acad. Sci. U.S.A., 100, 715–720 (2003).
• 15)  Kim EY, Koh JY, Kim YH, Sohn S, Joe E, Gwag BJ. Zn²⁺ entry produces oxidative neuronal necrosis in cortical cell cultures. Eur. J. Neurosci., 11, 327–334 (1999).
• 16)  dos Santos El-Bachá R, Daval J, Koziel V, Netter P, Minn A. Toxic effects of apomorphine on rat cultured neurons and glial C6 cells, and protection with antioxidants. Biochem. Pharmacol., 61, 73–85 (2001).
• 17)  Colvin RA, Fontaine CP, Laskowski M, Thomas D. Zn²⁺ transporters and Zn²⁺ homeostasis in neurons. Eur. J. Pharmacol., 479, 171–185 (2003).
• 18)  Palmiter RD. Protection against zinc toxicity by metallothionein and zinc transporter 1. Proc. Natl. Acad. Sci. U.S.A., 101, 4918–4923 (2004).
• 19)  Tsuda M, Imaizumi K, Katayama T, Kitagawa K, Wanaka A, Tohyama M, Takagi T. Expression of zinc transporter gene, ZnT-1, is induced after transient forebrain ischemia in the gerbil. J. Neurosci., 17, 6678–6684 (1997).
• 20)  Chen CJ, Liao SL. Zinc toxicity on neonatal cortical neurons: involvement of glutathione chelation. J. Neurochem., 85, 443–453 (2003).
• 21)  Trachootham D, Lu W, Ogasawara MA, Nilsa RD, Huang P. Redox regulation of cell survival. Antioxid. Redox Signal., 10, 1343–1374 (2008).
• 22)  El-Bachá RS, Netter P, Minn A. Mechanisms of apomorphine cytoxicity towards rat glioma C6 cells: protection by bovine serum albumin and formation of apomorphine-protein conjugates. Neurosci. Lett., 263, 25–28 (1999).
• 23)  Lee JM, Anderson PC, Padgitt JK, Hanson JM, Waters CM, Johnson JA. Nrf2, not the estrogen receptor, mediates catechol estrogen-induced activation of the antioxidant responsive element. Biochim. Biophys. Acta, 1629, 92–101 (2003).
• 24)  Inoue K, Branigan D, Xiong ZG. Zinc-induced neurotoxicity mediated by transient receptor potential melastatin 7 channels. J. Biol. Chem., 285, 7430–7439 (2010).
• 25)  Ohana E, Segal D, Palty R, Ton-That D, Moran A, Sensi SL, Weiss JH, Hershfinkel M, Sekler I. A sodium zinc exchange mechanism is mediating extrusion of zinc in mammalian cells. J. Biol. Chem., 279, 4278–4284 (2004).
• 26)  Liu PK, Grossman RG, Hsu CY, Robertson CS. Ischemic injury and faulty gene transcripts in the brain. Trends Neurosci., 24, 581–588 (2001).