Quercetin Potentiates Apoptosis by Inhibiting Nuclear Factor-kappaB Signaling in H460 Lung Cancer Cells

Abstract

The herbal flavonoid quercetin inhibits the growth of various cancer cells, but how it affects human cancer cells, particularly lung cancer cells, is unclear. We investigated the anticancer activity of quercetin and the underlying molecular mechanisms in non-small cell lung cancer (NSCLC) cells. Quercetin strongly inhibited cell proliferation, and increased sub-G1 and apoptotic cell populations regardless of p53 status. Quercetin-induced apoptosis was verified by caspase cleavage, Hoechst staining, trypan blue exclusion, and DNA fragmentation assays. Microarray analysis using H460 cells indicated that quercetin increased the expression of genes associated with death receptor signaling tumor necrosis factor-related apoptosis-inducing ligand receptor (TRAILR), caspase-10, interleukin (IL) 1R DNA fragmentation faotor 45 (DFF45), tumor necrosis factor receptor (TNFR) 1, FAS, inhibitor of kappaBalpha (IκBα)) and cell cycle inhibition growth arrest and DNA-damage inducible 45 (GADD45), p21^Cip1), but decreased the expression of genes involved in nuclear factor (NF)-kappaB activation (NF-κB, IKKα). Further validation assays confirmed that quercetin inhibited growth by suppressing NF-κB and by increasing the expression of death receptors and cell cycle inhibitors. Taken together, these findings suggest that quercetin may be useful in the prevention and therapy of NSCLC.

Lung cancer is the leading cause of cancer death in many developed countries because of its poor prognosis. Non-small cell lung cancer (NSCLC) accounts for 85% of lung cancer cases, of which 70% show advanced-stage disease at the time of diagnosis.^1,2) Although various chemical drugs have been developed,^3,4) frequent chemoresistance and side effects in patients with NSCLC require the development of new preventive and therapeutic agents. High intake of flavonoids from fruits and vegetables is associated with a low risk of various cancers,^5–10) including lung cancer.^11,12) Of these polyphenolic flavonoids, quercetin is readily found in fruits, vegetables, green and black tea, and various medical plants such as Euonymus alatus (Thunb.) Sieb. Quercetin can act as either an antioxidant or a prooxidant depending on its concentration (1–40 µm or 40–100 µm, respectively).^13,14) Numerous studies have reported a broad range of pharmacological properties of quercetin, including benefits for inflammation,¹⁵⁾ atherosclerosis,¹⁶⁾ hypertension,¹⁷⁾ and neurodegeneration.^18,19) In addition to these beneficial effects, quercetin plays preventive and therapeutic roles in various types of cancer and cancer cells.^20–25) However, the anticancer effect of quercetin in NSCLC cells has been rarely addressed, and the underlying molecular mechanism remains to be determined.

Here, we investigated the growth inhibitory role of quercetin in three NSCLC cell lines and found that its effect is p53-independent and triggered by apoptosis. Subsequent microarray analysis using H460 cells indicated that quercetin enhances the expression of genes associated with death receptor signaling and cell cycle inhibition, but decreases the expression of genes involved in nuclear factor (NF)-κB activation. In contrast to down-regulated NF-κB expression, its inhibitor of kappaBalpha (IκBα) was upregulated by quercetin at both the mRNA and protein levels. The inhibitory role of quercetin in the NF-κB pathway was further demonstrated by suppressed NF-κB nuclear translocation and reduced NF-κB transcriptional activity following quercetin treatment.

MATERIALS AND METHODS

Reagents and Chemicals

Quercetin, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT), propidium iodide (PI), Hoechst 33342, 7-amino-actinomycin D (7-AAD), trypan blue, and dimethyl sulfoxide (DMSO) were purchased from Sigma (St. Louis, MO, U.S.A.).

Cell Culture

The human NSCLC cell lines H460 (p53 wild-type (wt)), A549 (p53 wt), and H1299 (p53 null) were purchased from the American Type Culture Collection (Manassas, VA, U.S.A.) and maintained in RPMI-1640 medium supplemented with 10% heat-inactivated fetal bovine serum and an antibiotic-antimycotic mixture (all from Invitrogen, Carlsbad, CA, U.S.A.) in a 5% CO₂ atmosphere at 37°C. The cells were treated with quercetin for the indicated periods of time.

Cell Viability Assay

To determine the effect of quercetin on cell viability, IC₅₀ values were measured by MTT assay, as described previously.²⁶⁾ H460, H1299, and A549 cells were seeded in 96-well plates at a density of 3000/well for 24 h, and treated with different concentrations of quercetin (0–200 µm) for 72 h. Cells were then incubated with MTT reagent (2 mg/mL, 50 µL) for 4 h. The effect of quercetin on cell proliferation was measured by incubating cells with 50 µm quercetin at different time points. The fraction of living cells was measured using an enzyme-linked immunosorbent assay plate reader as the optical density at 540 nm. IC₅₀ values were calculated using SigmaPlot software.

Flow Cytometry

FACS analysis was employed to determine the fraction of apoptotic cells. Each NSCLC cell line was treated with quercetin (50 µm) for various periods of time (1, 2, or 4 d). Cell cycle fractions were assessed using 1×10⁶ cells, which were fixed in 80% ethanol, stained with PI solution, and analyzed in a FACSCalibur flow cytometer using CellQuest software (BD Biosciences, San Jose, CA, U.S.A.). Another apoptosis assay was conducted by dual-laser flow cytometry.²⁷⁾ Following quercetin treatment, cells were stained with Hoechst (1 µg/mL) and then with 7-AAD (1 µg/mL). The co-stained cells were then analyzed.

Western Blot Analysis

Each NSCLC cell line was treated with 50 µm quercetin for 2 d and lysed in lysis buffer (0.2 m ethylenediaminetetraacetic acid, 0.05 m Tris–Cl (pH 8.0), 5% Triton X-100) for 30 min on ice. For validation assays, H460 cells were treated with two different concentrations of quercetin (25, 50 µm). The lysates were resolved by electrophoresis on 8–12% sodium dodecyl sulfate-polyacrylamide gels, transferred to nitrocellulose membranes, and incubated with the following primary antibodies: anti-caspase-3 (235412; CalBiochem, San Diego, CA, U.S.A.), anti-caspase-8 (AM46; Oncogene, Cambridge, MA, U.S.A.), anti-poly(ADP-ribose) polymerase (PARP) (sc-7150; Santa Cruz Biotechnology, Santa Cruz, CA, U.S.A.), anti-NF-κB p50 (sc-7178), anti-IκBα (sc-1643), anti-FAS (sc-715), anti-growth arrest and DNA-damage inducible 45 (GADD45) (sc-797), anti-tumor necrosis factor-related apoptosis-inducing ligand receptor (TRAILR) (sc-11638), anti-p21^Cip1 (sc-6246), and anti-β-actin (sc-47778). The blots were then incubated with a horse-radish peroxidase-conjugated mouse (sc-2005) or rabbit (sc-2004) immunoglobulin G (IgG) secondary antibody. Protein bands were detected using the Enhanced WEST-ZOL System (iNtRON Biotechnology, SungNam, South Korea).

Hoechst Staining

H460 cells were seeded on coverslips and then treated with quercetin (0–100 µm) for 2 d. After two washes in phosphate-buffered saline (PBS), the cells were stained with Hoechst staining solution for 5 min at room temperature. Coverslips were washed, dried, and mounted on microscopic slides. Apoptotic nuclear morphology was imaged with a fluorescence microscope (model DM2500; Leica Microsystems, Wetzlar, Germany).

Trypan Blue Exclusion

H460 cells were treated with quercetin (0–100 µm) for 2 d and collected by centrifugation. After washing in PBS, cells were stained with 0.4% trypan blue solution at room temperature for 3 min, and populations were then counted using a hemocytometer and a light microscope. One thousand cells were observed and the percentages of unstained (viable) and stained (nonviable) cells were determined.

DNA Fragmentation Analysis

H460 cells were treated with quercetin (0–100 µm) for 2 d and collected by centrifugation. After washing in PBS, cells were lysed as described above and extracted with phenol. After ethanol precipitation, DNA was electrophoretically separated on a 1.5% agarose gel containing ethidium bromide (1 µg/mL) and visualized using the ChemiDoc XRS system (Bio-Rad, Hercules, CA, U.S.A.).

Microarray and Data Analysis

Total RNA was extracted from H460 cells treated with quercetin (50 µm) for 2 d. Qualified RNA samples with an RNA integrity number of >9 were used for further analysis in a two-color microarray experiment using human 44k 4plex arrays (Agilent, Santa Clara, CA, U.S.A.), according to the manufacturer’s instructions. Equal amounts of total RNA were amplified, labeled, hybridized, washed, and scanned. The locally weighted linear regression curve fit and dye-swap normalization methods were applied to the ratio (Cy5/Cy3) of the signal intensities generated in the microarrays. Results were filtered, and the cutoff was set at p<0.05. Genes exhibiting significant differences in expression were classified into gene ontology-based functional categories (http://www.geneontology.org) using the KEGG (http://www.genome.jp/kegg/) and DAVID (http://david.abcc.ncifcrf.gov/) bioinformatics resources.

RNA Extraction and Real-Time Quantitative Reverse Transcription-Polymerase Chain Reaction (RT-PCR)

Total RNA was extracted from H460 cells treated with quercetin (50 µm) for 2 d, and 2 µg of total RNA was reverse-transcribed using MMLV reverse transcriptase and random oligo(dT) primers (Invitrogen). Real-Time PCR was conducted using primer pairs (Table 1), iQ™ SYBR Green Supermix, and the iCycler CFX96 Real-Time PCR Detection System (Bio-Rad). All gene expression levels in each well were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as an internal standard. Fold-expression was defined as the fold-increase relative to controls.

Table 1. Primer Sequences Used for qPCR

Name	Forward primer (5′→3′)	Reverse primer (5′→3′)
FAS	GGAATCATCAAGGAATGCAC	GTGGAATTGGCAAAAGAAGA
TRAILR	GCACAGAGGGTGTGGATTAC	TGGTCGTGGTACAGGAACTT
IκBα	CAGCAGACTCCACTCCACTT	GGGGTATTTCCTCGAAAGTC
NF-κB (p50)	GAGATTTTTCCCCCACAGAT	AAGCTGGACAAACACAGAGG
p21Cip1	CTGGAGACTCTCAGGGTCGAA	TTAGGGCTTCCTCTTGGAGA
GADD45	ACTGTCGGGGTGTACGAAG	AGAGCCACATCTCTGTCGTC
GAPDH	CTGCACCACCAACTGCTTAGC	GGGCCATCCACAGTCTTCTGG

Fluorescence Microscopy

H460 cells seeded on cover slides were treated with DMSO (control) or quercetin (50 µm) for 2 d. The cells were fixed and permeabilized as described previously.²⁸⁾ After washing, the cells were incubated with anti-NF-κB p50 subunit (sc-7178) and anti-IκBα (sc-1643) antibodies in 3% bovine serum albumin blocking solution for 1 h and then incubated with goat anti-rabbit IgG-Texas Red (sc-2780) and goat anti-mouse IgG-fluorescein isothiocyanate (sc-2010). After washing, the cells were visualized under a confocal microscope (model TCS SP5; Leica Microsystems). Hoechst (Sigma) was used to visualize chromosomal DNA.

Luciferase Reporter Gene Assays

H460 cells were seeded in 12-well plates and co-transfected with luciferase reporter genes, the NF-κB-responsive Bcl2 gene reporter with the NF-κB binding element (Bcl2-NF-κB wt-Luc) or the NF-κB mutant binding element (Bcl2-NF-κB mt-Luc), and SV-40-driven β-galactosidase expression vectors using LipofectAMINE (Invitrogen). H460 cells were co-transfected with the NF-κB expression vector as a positive control. After transfection overnight, the cells were treated with DMSO (control) or quercetin (50 µm). Luciferase activity was measured as described previously.²⁸⁾

Plasmids and Cloning

NF-κB (p50) cDNA was constructed according to standard methods and verified by sequencing. The p50 cDNA weas amplified by PCR and subcloned into Flag (2×)-tagged pcDNA3 vectors for over-expression, and pSilencer 2.1-U6 Hygro (Applied Biosystems/Ambion, Austin, TX, U.S.A.) for depletion of endogenous NF-κB (p50). DNA sequence used for small hairpin (sh) RNA (shp50) construction is 5′-GAT CCG CCA GAG TTT ACA TCT GAT GAT CTCAA GAG AAT CAT CAG ATG TAA ACT CTG GTT TTG GAA A-3′.

RESULTS AND DISCUSSION

Cytotoxic Effect of Quercetin on Lung Cancer Cells

To compare the inhibitory effects of quercetin on the growth of three lung cancer cells, we measured IC₅₀ values following MTT assays. The IC₅₀ values for quercetin were 106.3 (A549 cells), 58.3 (H1299 cells), and 92.2 (H460 cells) μM (Fig. 1A). This effect of quercetin appears to be independent of p53 status because both A549 and H460 cells harbor wild-type p53, while H1299 cells are p53-deficient. The effect of quercetin was substantiated by additional MTT assays at various time points (Figs. 1B–D). Cells were treated with DMSO (as a control; gray line) or quercetin (50 µm; black line) for 5 d. No growth was observed in quercetin-treated cells, unlike in control cells.

Fig. 1. Cytotoxic Effect of Quercetin on the Growth of NSCLC Cells

(A) Cytotoxicity of quercetin. IC₅₀ values in A549 (■), H1299 (●), and H460 (○) cells were determined by MTT assays in the presence of various concentrations of quercetin (1–200 µm). (B–D) Effects of quercetin on cell proliferation. A549 (B), H1299 (C), and H460 (D) cells were incubated with 50 µm quercetin or DMSO for the indicated periods of time. Cell growth was monitored by MTT assay. Data are the mean±standard deviation (S.D.) of three independent experiments. Asterisks indicate significant differences between DMSO- and quercetin-treated cells (* p<0.05).

Apoptotic Effect of Quercetin on Lung Cancer Cells

Two sequential FACS analyses were conducted to determine whether the growth inhibitory effect of quercetin was due to the induction of apoptosis, a form of programmed cell death. Cells were treated with quercetin (50 µm) for 2 d and then subjected to flow cytometric analysis followed by PI staining. The sub-G1 fraction (representing apoptotic cells) increased in response to quercetin treatment (Fig. 2A). The proportion of cells in the sub-G1 fraction at day 4 following treatment with quercetin (A549-Q) was lower for A549 cells (31%) than for H1299 cells (H1299-Q) (47%) and H460 cells (H460-Q) (88%). A second FACS analysis using Hoechst and 7-AAD was performed to distinguish live cells, and early and late apoptotic cells. The early and late apoptotic populations greatly increased in quercetin-treated H1299 and H460 cells compared to A549 cells (Fig. 2B). The apoptotic potential of quercetin in the three NSCLC cell lines was compared by Western blotting of three apoptosis-related proteins: caspase-3, caspase-8, and PARP. As shown in Fig. 2C, quercetin significantly increased cleavage of caspase-3 and caspase-8 in H1299 and H460 cells, but not in A549 cells. A similar pattern for PARP cleavage was observed. Taken together, these data suggest that quercetin induces apoptosis in the three NSCLC cell lines, and that H460 cells were slightly more sensitive than H1299 cells.

Fig. 2. Apoptotic Potential of Quercetin in NSCLC Cells

(A) FACS analysis using propidium iodine (PI) staining. The indicated lung cancer cell lines were incubated with 50 µm quercetin (Q) for 1, 2, and 4 d and subjected to FACS analysis after PI staining. Each twenty thousand cells were analyzed by FACS, and then the percentage of the sub-G1 fractions of A549 (light gray), H1299 (dark gray), and H460 (black) cells was calculated using CellQuest software (* p<0.05). (B) Dual-laser flow cytometry by Hoechst and 7-amino-actinomycin D (7-AAD) double staining. The populations of live, early apoptotic, and late-apoptotic cells were assessed using CellQuest software. (* p<0.05). (C) Western blotting. Lung cancer cells were incubated with DMSO (D) or 50 µm quercetin (Q) for 2 d, and the cell extracts were subjected to Western blotting using the indicated antibodies. (D) Fluorescence microscopy of quercetin-treated H460 cells. H460 cells were treated with various quercetin concentrations for 2 d. Treated cells were stained with Hoechst. ‘H460’ and ‘0 µm Q’ indicate mock and DMSO, respectively. Fragmented chromatin and nuclei are indicated by arrows (↓) and arrowheads (△), respectively. (E) DNA fragmentation. H460 cells were treated quercetin as indicated. DNA was extracted and resolved by agarose gel electrophoresis. (F) Trypan blue exclusion. H460 cells treated with quercetin were stained with trypan blue. Then, 1000 cells were counted under a light microscope, and the percentage of unstained (viable) and stained (nonviable) cells were estimated. Data are the means±S.D. of three independent experiments (* p<0.05).

Quercetin-induced apoptosis in H460 cells was further confirmed by three independent experiments. First, DNA-binding Hoechst dye was used to examine the nuclear morphology of dead cells. Quercetin-treated cells displayed typical morphological features of apoptotic cells, with condensed and fragmented nuclei (Fig. 2D). Second, a DNA fragmentation assay was conducted. DNA laddering, a hallmark of apoptosis, was detected in cells treated with higher concentrations of quercetin (50, 100 µm) (Fig. 2E). Finally, the trypan blue exclusion test was performed to determine the proportion of viable cells. Quercetin reduced the percentage of unstained (viable) cells in a dose-dependent manner (Fig. 2F). Overall, these data support the conclusion that quercetin is a potent inducer of apoptosis in H460 cells.

Microarray Analysis of Quercetin-Regulated Genes in H460 Cells

To determine the molecular mechanism underlying quercetin-induced apoptosis in H460 cells, we performed microarray assays using cDNA from H460 cells treated with quercetin or DMSO (control) for 2 d. We identified 6620 genes that were more than twofold differentially expressed: 3150 were upregulated and 3470 down-regulated. Gene sets (>1.5-fold difference) associated with apoptosis and the cell cycle were used in a cluster analysis. As shown in Fig. 3, quercetin upregulated genes associated with death pathways, including death receptors (TRAILR, FAS, TNFR1), the c-Jun N-terminal kinase (JNK) pathway (MEKK1, MKK4, JNK), the interleukin-1 receptor pathway (IL1, IL1R, IRAK), the caspase cascade (caspase-10, DFF45), and the NF-κB pathway (IκBα), while it down-regulated genes involved in cell survival (NF-κB, IKK, AKT). In addition, quercetin increased the expression of GADD45, which is associated with cell cycle arrest, but decreased the expression of genes related to cell proliferation (SCF, SKP2, CDKs, cyclins).

Fig. 3. Effect of Quercetin on Gene Expression Profiles in H460 Cells

H460 cells were treated with DMSO (control) or quercetin (50 µm) for 2 d. Purified RNA was then subjected to microarray analysis using Agilent human 44k 4plex arrays. Clustering analysis was performed using gene sets associated with apoptosis and the cell cycle: 1.5-fold upregulated (red) and down-regulated (green) genes are indicated. Genes highlighted in bold are included in the pathways in Fig. 5. (Color images were converted into gray scale.)

Validation of Microarray Data

Some of the quercetin-regulated genes were validated by quantitative RT-PCR and Western blotting analysis. Quantitative RT-PCR assays indicated that quercetin augmented the expression of apoptosis-related genes (FAS, TRAILR), the NF-κB repressor IκBα, and genes involved in cell cycle arrest (p21^Cip1, GADD45) (Fig. 4A). In contrast, quercetin repressed the expression of NF-κB, a transcription factor required for cancer cell survival. The protein expression of these regulated genes was subsequently monitored by Western blotting (Fig. 4B). Overall, the Western blotting data were fairly consistent with the microarray data, with little difference in magnitude.

Fig. 4. Validation of Microarray Data

(A) Validation of mRNA expression by quantitative reverse transcription-polymerase chain reaction (qRT-PCR). Total RNA was purified and reverse-transcribed. cDNA was amplified by real-time qPCR using the indicated primers (Table 1). Data are the mean±S.D. of three independent experiments (* p<0.05). (B) Validation of protein expression by Western blotting using the indicated antibodies. H460 cells were treated with 25 and 50 µm quercetin. (C) Localization of endogenous IκBα and NF-κB. Fluorescence microscopy was used to localize IκBα (red) and NF-κB (green). Hoechst staining was used to visualize chromosomal DNA. (Color images were converted into gray scale.) (D) Effect of quercetin on NF-κB-driven transcriptional activity. H460 cells were transfected with an NF-κB-responsive or binding defective Bcl2 promoter luciferase reporter gene in the presence of quercetin (50 µm; light gray bar) or overexpressed NF-κB (1 µg; black bar). Data are the mean±S.D. of three independent experiments (* p<0.05).

Quercetin treatment decreased the expression of p50, a subunit of NF-κB, but increased the expression of its inhibitor, IκBα. To determine the biological significance of this opposite regulation, we first performed immunofluorescence microscopy. Following quercetin treatment, the nuclear level of NF-κB (p50) decreased greatly, whereas IκBα expression increased slightly (Fig. 4C). Then, luciferase reporter gene assays were employed. Quercetin significantly inhibited luciferase activity in H460 cells in transfection experiments using an NF-κB-responsive Bcl2 promoter fused to a luciferase reporter (Fig. 4D). In contrast, a mutant reporter carrying a mutation in the NF-κB binding site was unaffected by quercetin and NF-κB. To determine whether the quercetin effect on cell fate is closely dependent on the NF-κB expression, regardless of IκBα, we measured the effect of NF-κB on the quercetin-regulated cell growth and cell death in three NSCLS cells. With finding on down-regulation of NF-κB (p50) by quercetin, we observed that the proliferation potential of quercetin-treated and NF-κB (p50)-transfected cells (Q+F-p50) is higher than that of untransfected- and quercetin-treated cells (Q+F-emp). This effect was observed in all three lung cancer cell lines, A549, H1299, and H460 cells (Fig. 5). Quercetin-induced cell death (shown by increased subG1 population) was also rescued by NF-κB (p50) overexpression in all three NSCLC cells (Supplementary Fig. 1). The role of NF-κB in cell survival was demonstrated by similar assays using NF-κB (p50)-depleted cells. These data support that quercetin induces apoptosis/cell death by inhibiting NF-κB signaling through the down-regulation of NF-κB (p50). Based on independent role of NF-κB, we expect that quercetin-induced up-regulation of IκB could be addictive in mediating cell death in NSCLS cells.

Fig. 5. Effect of NF-κB Expression on Quercetin-Induced Cytotoxicity in NSCLC Cells

(A) Expression of NF-κB p50 subunit in A549, H1299, and H460 under various conditions. (B–C) Effect of NF-κB expression level on proliferation of A549 (B), H1299 (C), and H460 (D) cells. Each cell line was incubated with 50 µm quercetin (Q) or DMSO (D) under overexpression (F-p50) or depletion condition (shp50) of NF-κB p50 for the indicated times. Flag tagged-empty vector (FE) and shRNA for Luciferase (shLuc) were used as controls. Cell growth was monitored by MTT assay. Data are the mean±standard deviation (S.D.) of three independent experiments. Asterisks indicate significant differences between DMSO-treated cells (D+FE) and other treated cells (* p<0.05).

In this study, we investigated the anticancer effect of quercetin and the underlying molecular mechanism in NSCLC cells. Our cytotoxicity assay data indicate that quercetin strongly inhibited the growth of all three tested NSCLC cell lines (A549 [p53 wt]), H1299 [p53 null], and H460 [p53 wt]), suggesting that quercetin-triggered cytotoxicity is independent of p53. However, in terms of apoptosis, these cells responded differently to quercetin: only H460 and H1299 cells were affected, with H460 cells being slightly more sensitive. Further microarray analysis using quercetin-treated H460 cells and cluster analyses revealed that quercetin regulated numerous genes associated with apoptosis and the cell cycle. As shown in Fig. 5A, quercetin upregulated genes associated with death pathways, including death receptors, the JNK pathway, the interleukin-1 receptor pathway, the caspase cascade, and NF-κB inhibition, but down-regulated genes involved in cell survival. In addition, quercetin increased the expression of GADD45, which is associated with cell cycle arrest, but decreased the expression of genes related to cell proliferation (Fig. 5B). For selected quercetin-regulated genes (FAS, TRAILR, IκBα, NF-κB, p21^CIP1, GADD45), we demonstrated differential regulation of mRNA and protein expression. Notably, our attention was drawn to the fact that NF-κB was down-regulated and IκBα upregulated because they are involved in cell survival²⁹⁾ and NF-κB inhibition,^30,31) respectively. Next, we explored the biological significance of this opposite regulation and concluded that quercetin mediates growth inhibition in H460 cells by suppressing the cell survival factor NF-κB and increasing the expression of death receptors and cell cycle inhibitors. Although its efficacy in mouse lung cancer models remains to be determined, our findings support the conclusion that quercetin may potentially be used to prevent and treat human NSCLC.

Fig. 6. Hypothetical Pathways of Apoptosis (A) and Cell Cycle Arrest (B) Regulated by Quercetin in H460 Cells

Major points affected by quercetin are indicated. Activation is indicated by arrows, whereas blunt lines indicate inhibitory ways. For further explanation, see the text. Abbreviations: TRAILR, tumor necrosis factor-related apoptosis-inducing ligand receptor; TNFR, tumor necrosis factor receptor; IL1R, interleukin-1 receptor; IKK, IκB kinase; IκB, inhibitor of κB; NF-κB, nuclear factor-κB; MEKK1, mitogen-activated protein kinase kinase kinase 1; MKK4, mitogen-activated protein kinase kinase 4; JNK, c-Jun N-terminal kinase; GADD45, growth arrest and DNA-damage-inducible 45; DFF45, DNA fragmentation factor 45; SCF, Skp/Cullin/F-box-containing complex; SKP2, S-phase kinase-associated protein 2; p27, p27^Kip1; p21, p21^Cip1; CDK, cyclin-dependent kinase.

Acknowledgment

This work was supported by a Grant of the Korean Health Technology R&D Project (A111658: E.-J. Kim) from the Ministry of Health, Welfare, and Family Affairs, Republic of Korea.

REFERENCES

• 1)  Herbst RS, Heymach JV, Lippman SM. Lung cancer. N. Engl. J. Med., 359, 1367–1380 (2008).
• 2)  Saintigny P, Burger JA. Recent advances in non-small cell lung cancer biology and clinical management. Discov. Med., 13, 287–297 (2012).
• 3)  Gettinger S, Lynch T. A decade of advances in treatment for advanced non-small cell lung cancer. Clin. Chest Med., 32, 839–851 (2011).
• 4)  Paoletti L, Pastis NJ, Denlinger CE, Silvestri GA. A decade of advances in treatment of early-stage lung cancer. Clin. Chest Med., 32, 827–838 (2011).
• 5)  Block G, Patterson B, Subar A. Fruit, vegetables, and cancer prevention: a review of the epidemiological evidence. Nutr. Cancer, 18, 1–29 (1992).
• 6)  Hertog MG. Epidemiological evidence on potential health properties of flavonoids. Proc. Nutr. Soc., 55 (1B), 385–397 (1996).
• 7)  Sarkar FH, Li Y. The role of isoflavones in cancer chemoprevention. Front. Biosci., 9, 2714–2724 (2004).
• 8)  Neuhouser ML. Dietary flavonoids and cancer risk: evidence from human population studies. Nutr. Cancer, 50, 1–7 (2004).
• 9)  Graf BA, Milbury PE, Blumberg JB. Flavonols, flavones, flavanones, and human health: epidemiological evidence. J. Med. Food, 8, 281–290 (2005).
• 10)  Nishiumi S, Miyamoto S, Kawabata K, Ohnishi K, Mukai R, Murakami A, Ashida H, Terao J. Dietary flavonoids as cancer-preventive and therapeutic biofactors. Front Biosci (Schol Ed), 3, 1332–1362 (2011).
• 11)  Le Marchand L, Murphy SP, Hankin JH, Wilkens LR, Kolonel LN. Intake of flavonoids and lung cancer. J. Natl. Cancer Inst., 92, 154–160 (2000).
• 12)  Arts IC. A review of the epidemiological evidence on tea, flavonoids, and lung cancer. J. Nutr., 138, 1561S–1566S (2008).
• 13)  Wätjen W, Michels G, Steffan B, Niering P, Chovolou Y, Kampkötter A, Tran-Thi QH, Proksch P, Kahl R. Low concentrations of flavonoids are protective in rat H4IIE cells whereas high concentrations cause DNA damage and apoptosis. J. Nutr., 135, 525–531 (2005).
• 14)  Vargas AJ, Burd R. Hormesis and synergy: pathways and mechanisms of quercetin in cancer prevention and management. Nutr. Rev., 68, 418–428 (2010).
• 15)  Chirumbolo S. The role of quercetin, flavonols and flavones in modulating inflammatory cell function. Inflamm. Allergy Drug Targets, 9, 263–285 (2010).
• 16)  Ishizawa K, Yoshizumi M, Kawai Y, Terao J, Kihira Y, Ikeda Y, Tomita S, Minakuchi K, Tsuchiya K, Tamaki T. Pharmacology in health food: metabolism of quercetin in vivo and its protective effect against arteriosclerosis. J. Pharmacol. Sci., 115, 466–470 (2011).
• 17)  Perez-Vizcaino F, Duarte J, Jimenez R, Santos-Buelga C, Osuna A. Antihypertensive effects of the flavonoid quercetin. Pharmacol. Rep., 61, 67–75 (2009).
• 18)  Ossola B, Kääriäinen TM, Männistö PT. The multiple faces of quercetin in neuroprotection. Expert Opin. Drug Saf., 8, 397–409 (2009).
• 19)  Kelsey NA, Wilkins HM, Linseman DA. Nutraceutical antioxidants as novel neuroprotective agents. Molecules, 15, 7792–7814 (2010).
• 20)  Murakami A, Ashida H, Terao J. Multitargeted cancer prevention by quercetin. Cancer Lett., 269, 315–325 (2008).
• 21)  Seufi AM, Ibrahim SS, Elmaghraby TK, Hafez EE. Preventive effect of the flavonoid, quercetin, on hepatic cancer in rats via oxidant/antioxidant activity: molecular and histological evidences. J. Exp. Clin. Cancer Res., 28, 80–87 (2009).
• 22)  Priyadarsini RV, Vinothini G, Murugan RS, Manikandan P, Nagini S. The flavonoid quercetin modulates the hallmark capabilities of hamster buccal pouch tumors. Nutr. Cancer, 63, 218–226 (2011).
• 23)  Camargo CA, da Silva ME, da Silva RA, Justo GZ, Gomes-Marcondes MC, Aoyama H. Inhibition of tumor growth by quercetin with increase of survival and prevention of cachexia in Walker 256 tumor-bearing rats. Biochem. Biophys. Res. Commun., 406, 638–642 (2011).
• 24)  Mendoza EE, Burd R. Quercetin as a systemic chemopreventative agent: structural and functional mechanisms. Mini Rev. Med. Chem., 11, 1216–1221 (2011).
• 25)  Djuric Z, Severson RK, Kato I. Association of dietary quercetin with reduced risk of proximal colon cancer. Nutr. Cancer, 64, 351–360 (2012).
• 26)  Park UH, Jeong JC, Jang JS, Sung MR, Youn H, Lee SJ, Kim EJ, Um SJ. Negative regulation of adipogenesis by kaempferol, a component of Rhizoma Polygonati falcatum in 3T3-L1 cells. Biol. Pharm. Bull., 35, 1525–1533 (2012).
• 27)  Schmid I, Uittenbogaart C, Jamieson BD. Live-cell assay for detection of apoptosis by dual-laser flow cytometry using Hoechst 33342 and 7-amino-actinomycin D. Nat. Protoc., 2, 187–190 (2007).
• 28)  Lee HK, Park UH, Kim EJ, Um SJ. MED25 is distinct from TRAP220/MED1 in cooperating with CBP for retinoid receptor activation. EMBO J., 26, 3545–3557 (2007).
• 29)  Perkins ND. The diverse and complex roles of NF-κB subunits in cancer. Nat. Rev. Cancer, 12, 121–132 (2012).
• 30)  Dyson HJ, Komives EA. Role of disorder in IκB-NFκB interaction. IUBMB Life, 64, 499–505 (2012).
• 31)  Hinz M, Arslan SÇ, Scheidereit C. It takes two to tango: IκBs, the multifunctional partners of NF-κB. Immunol. Rev., 246, 59–76 (2012).