Sulphur Antioxidants Inhibit Oxidative Stress Induced Retinal Ganglion Cell Death by Scavenging Reactive Oxygen Species but Influence Nuclear Factor (Erythroid-Derived 2)-Like 2 Signalling Pathway Differently

Abstract

This study aimed to show if two different sulphur containing drugs sulbutiamine and acetylcysteine (NAC) could attenuate the effects of two different insults being serum deprivation and glutamate/buthionine sulfoximine (GB)-induced death to transformed retinal ganglion cell line (RGC-5) in culture. Cells were exposed to either 5 mM of GB for 24 h or serum deprivation for 48 h with inclusion of either NAC or sulbutiamine. Cell viability, microscopic evidence for apoptosis, caspase 3 activity, reactive oxygen species (ROS), glutathione (GSH), catalase and gluthathione-S-transferase (GST) were determined. The effects of NAC and sulbutiamine on the oxidative stress related transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf-2) levels and its dependent phase II enzyme haemeoxygenase-1 (HO-1) were carried out using Western blot and quantitative-polymerase chain reaction (PCR). NAC and sulbutiamine dose-dependently attenuated serum deprivation-induced cell death. However NAC but not sulbutiamine attenuated GB-induced cell death. NAC and sulbutiamine both independently stimulated the GSH and GST production but scavenged different types of ROS with different efficacy. Moreover only sulbutiamine stimulated catalase and significantly increased Nrf-2 and HO-1 levels. In addition, the pan caspase inhibitor, benzoylcarbonyl-Val-Ala-Asp-fluoromethyl ketone (z-VAD-fmk) attenuated the negative effect of serum deprivation while the necroptosis inhibitor (necrostatin-1) counteracted solely an insult of GB. The neuroprotective actions of NAC and sulbutiamine in GB or serum-deprivation insult are therefore different.

In a neurodegenerative disease like glaucoma, oxidative stress caused by reactive oxygen species (ROS) overproduction is thought to play an important role in causing retinal ganglion cells (RGCs) death.¹⁾ ROS over production also appears to play an important role in the pathogenesis of other progressive neurodegenerative disorders such as Alzheimer’s disease, Parkinson’s disease, amyotrophic lateral sclerosis and acute syndromes of neurodegeneration, such as ischemic and hemorrhagic stroke.^2,3)

One cause for an elevation of intracellular ROS is thought to stem from an elevation of extracellular glutamate.⁴⁾ Excess extracellular glutamate can affect the influx of cystine into cells so reducing the rate of intracellular glutathione (GSH) formation⁴⁾ and in the process undermining a major cellular defense mechanism to maintain homeostatic levels of ROS. Mitochondria are a major target of ROS attack and at the same time is a source for ROS production such as the superoxide anion.⁵⁾ Intracellular ROS levels in healthy cells therefore exist in a balanced redox state and over production as a consequence of an underlying pathogenic state leads to breakdown of homeostasis. Importantly, excess intracellular ROS can lead to a depletion of sulphur containing thiols.⁴⁾ In addition substances such as catalase, superoxide dismutase, the thiol redox systems GSH/GSSG (glutathione/oxidized glutathione) and thioredoxin are affected to minimize the harmful effect ROS might have on the cell.⁶⁾ The molecular mechanism of how endogenous cellular antioxidants are generated to combat any oxidative stress that results in neuronal death remains a matter of speculation.⁷⁾ However, a number of proteins have been implicated to be involved in the process. These include, for example, the transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf-2) which induces antioxidant enzymes and involves activation through the antioxidant-responsive element (ARE).⁸⁾ In this case, electrophilic agents including ROS induce a set of genes encoding Phase-II enzymes, including Haemeoxygenase-1 (HO-1), reduced nicotinamide adenine dinucleotide phosphate (NADPH) quinine oxidoreductase 1 and γ-glutamyl cysteine ligase (γ-GCL). These enzymes provide efficient cytoprotection, in part, by regulating the intracellular redox state.⁸⁾ For example, Sun et al. showed that elevation of HO-1 throughout the retina caused by cobalt protoporphyrin attenuated the negative effects of ischemia-reperfussion injury to the retina.⁹⁾ The enzyme catalase is another important enzyme that decomposes hydrogen peroxide (H₂O₂) to water and molecular oxygen and functions as a natural antioxidant by protecting cells against oxidative damage to proteins, lipids and nucleic acids.¹⁰⁾ This enzyme has also been studied especially in its response to ROS generation, gene expression and apoptosis.¹¹⁾ However, its exact physiological function and regulation is not yet fully understood.¹²⁾

The processes by which sulphur containing compounds overcome the negative effects of excess intracellular ROS remains poorly understood. Sulbutiamine and acetylcysteine (NAC) are both well known sulphur containing antioxidants and used for decades as adjuvants in the treatment of certain human diseases. NAC is a well known amino thiol molecule with clinical uses ranging from mucolytic therapy for patients with inspissated respiratory secretions to standard treatment of acetaminophen overdoses¹³⁾ and more recently for the prevention of contrast-induced nephropathy.¹⁴⁾ NAC partly acts as a free radical scavenger as well as a GSH precursor to increase intracellular antioxidant capacity and hence protect cells against ROS.¹⁵⁾ However, it is also thought to work through other mechanisms. It has also been studied especially in its response to ROS generation, gene expression and apoptosis and its efficacy may be secondary to detoxification of ROS, local vasoactive properties and/or interference with gene expression.¹⁶⁾ Furthermore, cysteine being part of NAC, along with methionine and homocysteine, act as important substrates for the enzymes cystathionine β-synthase (CBS) and cysthionine γ-lyase (CGL) in the transulfuration pathway which leads to the production of hydrogen sulfide gas (H₂S), a potent gaseous neuromodulator.¹⁷⁾ Importantly it has been shown that homocysteine is critically involved in the pathogenesis of certain neurodegenerative disorders.¹⁸⁾ This is believed partly to be due to its role in the generation of ROS including H₂O₂ and O₂^•−.¹⁹⁾ It has also been shown that methionine induced ROS production was effectively blocked by NAC in brain endothelial cells.²⁰⁾ Also when a H₂S donor was combined with substances like NAC, it synergistically increased their antioxidant effect to scavenge ROS and protect vascular endothelium from methionine induced cytotoxicity.²⁰⁾

NAC has also been shown to inhibit cortical neuronal injury independent of an effect on meningeal inflammation.²¹⁾ NAC thus has potential benefits as a neuroprotectant in acute brain injury caused by for example bacterial meningitis. It has also been reported that NAC modulates the gene expression of the vasoconstrictor endothelin-1 (ET-1) to enhance cerebral blood flow in acute brain injury as well as being able to reduce ROS.²²⁾ Conflicting data however show that NAC only poorly penetrates the blood–brain barrier²³⁾ and has been reported not to prevent the loss of cortical GSH in the infant rat model of pneumococcal meningitis.²⁴⁾ Various clinical studies show NAC to have a high safety profile and can be used for the treatment of various neurological conditions such as depression.²⁵⁾ Furthermore, in a controlled trial of patients with symptoms of Alzheimer’s disease and having had treatment with NAC for 3–6 months showed improvement on nearly every outcome of measure, although significant difference were obtained only for a subset of cognition tasks.²⁶⁾

Sulbutiamine also has beneficial effects in the treatment of Alzheimer’s disease as it enhances cholinergic and glutamatergic transmission, mainly in hippocampus and prefrontal cortex.²⁷⁾ In the multicentric, randomized and double-blind trial which evaluated the effects of the association of sulbutiamine to an anti-cholinesterasic drug showed that it can be an effective adjuvant to treatment in early stage and moderate Alzheimer’s disease by anticholinesterasic drugs.²⁷⁾ The challenge with using thiamine however is its poor lipophilicity. A synthetic derivative of thiamine, sulbutiamine was hence synthesized in order to overcome the poor oral bioavailability of thiamine. Sulbutiamine as opposed to thiamine is therefore able to readily cross the blood–brain barrier (BBB).²⁸⁾

Sulbutiamine also has been shown to elicit several neuro-modulating functions including memory improvement in mice and enhancing cognitive functions.²⁹⁾ Sulbutiamine is also used to treat asthenia³⁰⁾ and is the most bio-available anti-asthenic compound as it efficiently crosses the blood–brain barrier to act on certain regions of the brain which is thought to be affected by asthenia.³¹⁾ In addition to these beneficial effects, it has been also used in the treatment of erectile dysfunction.³²⁾ At therapeutic dosages, sulbutiamine has few reported adverse effects, though it may interfere with the therapeutic outcome of bipolar disorder.³³⁾ However the exact mechanism of sulbutiamine is still not clearly understood and its influence in oxidative stress conditions is not known. However thiamine deficiency is known to affect cellular metabolism via the oxidoreductase pathway by decreasing NADPH levels which eventually leads to GSH depletion.³⁴⁾ Thiamine has also been shown to stimulate GSH activity and attenuate oxidative insults in certain defined conditions.³⁵⁾

In the present study the effectiveness of sulbutiamine and NAC at attenuating the detrimental consequence of insults to transformed retinal ganglion cell line (RGC-5) in culture was investigated. The main aim of the present study was to deduce whether these two selected sulfurated compounds are able to reduce cellular oxidative stress and improve neuronal survival in vitro and the possible mechanisms involved in this potential neuroprotective action under conditions of serum deprivation and glutamate/BSO toxicity.

Materials and Methods

Materials

Transformed retinal ganglion cells (RGC-5 cells) are known to exhibit a number of biochemical characteristics associated with retinal ganglion cells³⁶⁾ were a kind gift from Dr. N. Agarwal (UNT Health Science Centre, Texas, U.S.A.). Resazurin-Reduction Assay (RRA) was carried out using a kit bought from Promega. APOPercentage™ apoptosis assay was from Biocolor Ltd. (Belfast, North Ireland). 2′,7′-Dihydroethidium (DHE) was from Roche Diagnostics (Lewes, U.K.). TransAM™ Nrf-2 DNA-binding enzyme-linked immunosorbent assay (ELISA) for activated Nrf-2 transcription factor is from Active Motif® (Carlsbad, California, U.S.A.). Mouse Heme Oxygenase-1 (HO-1) EIA Kit was from TaKaRa Bio Inc. (Otsu, Shiga, Japan). All other chemicals and reagents were from Sigma-Aldrich (St. Louis, MO, U.S.A.).

Treatment of Cultures

RGC-5 cells were maintained in Dulbecco’s modified Eagle’s medium (D-MEM; Sigma-Aldrich) supplemented with 10% foetal bovine serum (FBS; Invitrogen, Paisley, U.K.), 25 mM glucose, 100 U/mL penicillin (Invitrogen, Paisley, U.K.), and 100 µg/mL streptomycin (Invitrogen, Paisley, U.K.) in a humidified atmosphere of 95% air and 5% CO₂ at 37°C. Doubling time of these cells are approximately 24 h. Confluent cultures of RGC-5 cells from 75 cm² filter-capped cell culture flasks were generally passaged at a ratio of approximately 1 : 8 to give a cell density of approximately 4–5×10⁴ cells/mL. One hundred microliter of these cells were placed in individual CellPlus™ 96-well plates or alternatively 500 µL of cells placed in individual 24-well plates that contained sterilised borosilicate glass coverslips. Cells were also cultured in 6-well plates and analyzed for protein by electrophoresis/Western blotting and mRNA by real time polymerase chain reaction (PCR).

After approximately 24 h to allow the cells to settle, cultures were pre-treated for 1 h with sulbutiamine or NAC and then exposed to 5 mM glutamate plus BSO for 24 h before analysis. For serum deprivation, cultures grown over 24 h in normal medium (10% FBS) were then incubated with NAC or sulbutiamine. After 1 h incubation, the whole plate containing10% FBS was replaced with 0% FBS and re-incubated with NAC or sulbutiamine for 48 h before analysis.

Cell Viability Determined by Resazurin-Reduction Assay (RRA)

This assay involved using a commercial kit (from Promega) and was conducted on cells in 96-well plates. The assay is based on the ability of living cells to convert the redox dye, resazurin, into a fluorescent product (excitation 530 nm, emission 590 nm), resorufin.³⁷⁾

Identification of Cell Death by Use of the Fluorescein Diacetate (FDA)/Propidium Iodide (PI) Double Staining

Microscopic analysis for live and dead cells caused by BSO plus glutamate and serum deprivation were characterized by staining cells with FDA and PI staining.³⁸⁾ Cells incubated with 5 µM FDA for 2 min and 3 µM PI for 30 min at room temperature. And then washed once with phosphate buffered saline (PBS) and examined under fluorescence microscopy.

Localising Apoptotic Cells with Hoechst and APOPercentage™ Kit

Cells were fixed in 4% paraformaldehyde and incubated with Hoechst 33258 dye (2.5 µg/mL dissolved in distilled water) for 30 min at room temperature. Cells with intensely stained nuclei caused by Hoechst affinity for fragmented DNA were defined as cells in the process of apoptosis. The APOPercentage™ procedure detects membrane exposed phosphatidylserine which is known to occur when cells undergo apoptosis.³⁹⁾ Briefly, fresh culture medium containing 5 µL APOPercentage™ dye was added to each well followed by incubation for 40 min at 37°C. After removal of the culture medium, cells were gently washed with PBS and then immediately viewed under light microscope.

Assessment of ROS

Cells were assessed for the production of ROS using the dye DHE according to previous methods.⁴⁰⁾ DHE is a reduced form of ethidium bromide, which is non-fluorescent and can passively cross the membrane of live cells. DHE can be oxidized in the cell by superoxide anions or hydrogen peroxide to ethidium bromide, which binds to DNA and, when excited, emits red fluorescence that is proportional to the intracellular superoxide anion and H₂O₂ level. After different treatments, cells on coverslips were stained with DHE (10 µg/mL) by incubating for 30 min at 37°C in culture medium in a humidified chamber and then fixed with 4% paraformaldehyde for 20 min. After washing in PBS-T, coverslips were mounted in PBS containing 1% glycerol and red fluorescence was detected using a Zeiss epifluorescence microscope.

Intracellular ROS level was measured by the 2′,7′ -dichlorodihydrofluorescein (DCFH) method.⁴¹⁾ RGC-5 cells (5×10³) were seeded in 96 well plates and cultured for 24 h before a 1-h pretreatment with different concentrations of sulbutiamine or NAC and subsequent exposure to either 5 mM of GB for 24 h or serum deprivation for 48 h. After the treatment, cells were incubated with DCFH diacetate for 15 min in the dark. Then the fluorescence of liberated DCF was quantified, using a fluorescence plate reader (Fluoroskan Ascent, Thermo Scientific, Waltham, MA, U.S.A.) (Ex/Em=485/535 nm).

Antioxidant-Capacity Assay

Antioxidant-capacity assay was used to examine intracellular ROS. This assay measured the radicals induced in RGC-5 by the application of ROS (H₂O₂, O₂^•−, and HO⁻). The cells were seeded at a density of 2×10³ cells per well into 96-well plates, and then incubated in a humidified atmosphere of 95% air and 5% CO₂ at 37°C. Twenty-four hours later, the cell-culture medium was replaced, before any treatment with drugs or their vehicle (DMEM containing 1% FBS). After pre-treatment with sulbutiamine or NAC at different concentrations or its vehicle for 1h, the radical probe, 5-(and -6)-chloromethyl-2′,7′-dichlorodihydrofluorescein diacetate, acetyl ester (CM-H₂DCFDA) (Molecular Probes, Eugene, OR, U.S.A.) at 10 µM was added and incubated for 20 min at 37°C.⁴²⁾ Then, the cell culture medium was replaced to remove the surplus probe. CM-H₂DCFDA (inactive for ROS) is converted to DCFH (active for ROS) by being taken into the cell and acted upon by an intracellular enzyme (esterase). The H₂O₂ or O₂^•′ oxidizes intracellular DCFH (non-fluorescent) to DCF (fluorescent). To generate the ROS H₂O₂ at 1 mM (H₂O₂) or KO₂ at 1 mM (O₂^•′) as the radical probe was added to the loading-medium. Fluorescence was measured, after the ROS-generating compounds had been present for various time-periods, using a fluorescence plate reader (Fluoroskan Ascent, Thermo Scientific, Waltham, MA, U.S.A.) (Ex/Em=485/535 nm). In addition, to detect the HO^• formed in the Fenton reaction, 2-[6-(4′-amino)phenoxy-3H-xanthen-3-on-9-yl] benzoic acid (APF) (Enzo Life Sciences, U.K., Ltd.) was used.⁴³⁾ Briefly, cells were loaded with APF by incubation for 20 min at 37°C in Hanks/Hepes buffer solution containing APF (10 µM). To perform the Fenton reaction, H₂O₂ was added to the Hanks/Hepes buffer solution of APF, and then iron(II) perchlorate hexahydrate was added. Fluorescence was measured at excitation/emission wavelengths of 490/515 nm. Total fluorescence intensity was measured at 20 min after treatment with ROS-generating compounds.

Assessment of Glutathione-S-Transferase (GST) Activity

GST activity was measured using the Marker Gene™ live cell glutathione transferase activity kit (Marker Gene Technologies, Inc., OR, U.S.A.). Briefly, RGC-5 cells (1×10⁶) were collected by centrifugation at 700×g for 10 min at 4°C. The supernatant was removed and the cell pellet was resuspended in 1 mL ice-cold D-PBS. The suspension was then transferred into a 1.5 mL micro-centrifuge tube, and centrifuged at 700×g for 5 min at 4°C. The supernatant was then removed and the cells resuspended in 100 µL ice-cold cell lysis buffer. This was then incubated on ice for 10 min, and then centrifuged at high speed (10000×g) in an Eppendorf centrifuge for 10 min. The supernatant was stored on ice and used for the assay. Sample Assay: For background or non-enzymatic controls, 178 µL of cell lysis buffer was added and 20 µL of GSH solution were added to three wells of a 96-well plate. For positive controls, 176 µL of cell lysis buffer, 20 µL of GSH solution, and 2 µL of GST solution were added to three wells. For sample wells, 158 µL of cell lysis buffer was added plus 20 µL of GSH solution, and 20 µL of sample. Finally 2 µL of monochlorobimane (mCB) solution was added to each 96-well with gentle shaking to mix the reaction mixture. Fluorescence intensities were measured at different time intervals for kinetic assessment using a fluorescence plate reader (Fluoroskan Ascent, Thermo Scientific, U.S.A.) (Ex/Em=380/460 nm).

Assessment of Total Intracellular GSH

The assay is based on glutathione-S-transferase reacting with GSH with mCB to form the fluorescent product bimaneglutathione. Briefly, after maintaining cell cultures in 40 mm wells in the presence of different substances for 24 h or serum deprivation for 48 h approximately 1×10⁶ RGC-5 cells (collected from two 40 mm wells) were collected and centrifuged at 700×g for 10 min at 4°C. The pelleted cells were then resuspended in cell lysis buffer (100 µL) and after 10 min centrifuged at 10000×g for 10 min. Twenty microliters supernatant samples were transferred to a microplate and to each sample 2 µL 20 mM mCB and 4 µL of GST 25 U/mL was added. After incubation at 37°C for 15 min, fluorescence was measured in a plate reader where the excitation and emission spectra were 380 and 460 nm, respectively.

Caspase 3 Colorimetric Assay

This assay is based on the hydrolysis of the peptide substrate acetyl-Asp-Glu-Val-Asp p-nitroanilide (Ac-DEVD-pNA) by caspase 3, resulting in the release of the p-nitroaniline (pNA) moiety. p-Nitroaniline has a high absorbance at 405 nm. The concentration of the pNA released from the substrate is calculated from the absorbance values at 405 nm.⁴⁴⁾ This assay was conducted on cell lysates in 96-well plates.

Catalase Quantification

The catalase activity was measured by use of the Amplex Red Catalase Assay Kit (A22180). In the first step of the assay, catalase reacts with H₂O₂, producing water and oxygen (O₂).⁴⁵⁾ In the second step, an agent called the Amplex Red Reagent (ARR) reacts with any un-reacted H₂O₂ in the presence of horseradish peroxidase (HRP) and this generates the highly fluorescent oxidation product resorufin.⁴⁶⁾ This means that the higher catalase activity in the test, the weaker the resorufin signal gets.

Briefly after RGC-5 cells were incubated with different treatments for 24 h or 48 h for serum deprivation experiments, the microplate was emptied by placing Kleenex on top of it then turning it upside-down. Amplex Red Catalase Assay procedure was then carried out according to the Amplex Red Catalase Assay Kit protocol (Molecular Probes). All additions in the catalase assay were pipetted horizontally into the microplate wells. The 37°C incubation time chosen was 35 min, and the excitation and emission detection levels chosen for the fluorescence measuring were set to 530 nm and 590 nm, respectively.

The fluorescence intensity was measured at 8 time points, each separated by 15 min. The first measurement was done 15 min after placing of the microplate in the Fluoroskan Ascent (Thermo Fisher Scientific, MA, U.S.A.).

The Quantification of Hemeoxygenase (HO-1)

The quantification of Hemeoxygenase-1 was determined by use of an enzyme immunoassay kit according to the manufacturer’s specifications (TaKaRa Bio Inc., Japan). Briefly, 100 µL of Standard or sample was added to appropriate wells, and incubated for 1 h at room temperature (20°C). After 1h the sample solution was removed and the wells were washed 3 times with 400 µL of PBS containing 0.1% Tween 20. One hundred microliters of Antibody-peroxidase (POD) conjugate solution was then added into wells and incubated at room temperature for 1 h. Post incubation the Antibody-POD conjugate solution was removed and washed 4 times with 400 µL of PBS per wells. One hundred microliters of Substrate Solution was added to each well and incubated for 15 min at room temperature. One hundred microliters of Stop Solution was then added to all wells, mixed gently and read at 450 nm.

The Quantification of Nrf-2

The quantification of Nrf-2 was determined by use of an enzyme immunoassay kit according to the manufacturer’s specifications (Active Motif, Carlsbad, CA, U.S.A.). Briefly, the transcriptional factor of nuclear extracts, which were prepared by Nuclear Extract kit (Active Motif, Carlsbad, CA, U.S.A.), were captured by binding to a consensus oligonucleotide containing the ARE consensus binding site (5′-GTC ACA GTG ACT CAG CAG AAT CTG -3′) immobilized on a 96-well plate. The primary antibody used to detect Nrf-2 recognizes and epitope on Nrf-2 protein upon DNA binding. The Nrf-2 subunit was determined in a colorimetric reaction using specific primary antibody and a secondary horseradish peroxidase-conjugated antibody. Cos-7 Nrf-2-transfected nuclear extracts was used as a positive control (provided in the kit). Spectrophotometric data were expressed as a % ratio of absorbance of each experimental condition compared with control cells exposed to vehicle alone.

Immunocytochemistry

RGC-5 cells on coverslips were fixed with 4% paraformaldehyde for 25 min, washed in PBST and then blocked with BSA (0.5%, w/v in PBST) for 30 min. For single labelling experiments, cells were incubated overnight at 4°C with rabbit anti-Nrf-2 (1 : 200; Abcam, U.K.) or rabbit anti-HO-1 (1 : 100; Abcam, U.K.). They were washed next day and subsequently exposed to appropriate secondary antibodies conjugated to Alexa Fluor 488 (1 : 200; Invitrogen Molecular Probes) for 1 h and then washed with PBST and mounted in ProLong Gold™ anti-fade reagent with DAPI. Images were obtained under 40× magnification with a fluorescence microscope (Nikon, Melville, NY, U.S.A.).

Electrophoresis and Western Blotting

RGC-5 cells were harvested from 6-well plates by scraping into PBS and then cell pellets sonicated in freshly prepared 20 mM Tris–HCl buffer (pH 7.4) containing 2 mM ethylenediamine tetraacetic acid (EDTA), 0.5 mM ethyleneglycol-tetraacetic acid, 1 mM dithiothreitol, and the protease inhibitors: 0.1 mM phenylmethyl-sulphonyl fluoride (PMSF), 501 g/mL leupeptin, 501 g/mL aprotinin, and 501 g/mL pepstatin A. An equal volume of sample buffer (62.5 mM Tris–HCl, pH 7.4, plus 4% sodium dodecyl sulfate, 10% glycerol, 10% β-mercaptoethanol, and 0.002% bromophenol blue) was added, and samples were boiled for 3 min. Proteins were fractionated by electrophoresis using 10% polyacrylamide gels containing 0.1% sodium dodecyl sulfate (SDS), as described by Laemmli.⁴⁷⁾ After that, proteins were transferred to nitrocellulose and blots were incubated overnight at 4°C with rabbit anti-Nrf-2 (1 : 500; Santa Cruz Biotechnology, U.S.A.) or rabbit anti HO-1 (1 : 500; Assay Designs, U.S.A.). Detection was then performed with appropriate biotinylated secondary antibodies. The final nitrocellulose blots were developed with a 0.016% w/v solution of 3-amino-9-ethylcarbazole (AEC) in 50 mM sodium acetate (pH 5.0) containing 0.05% (v/v) Tween-20 and 0.03% (v/v) H₂O₂. The colourimetric reaction was stopped with 0.05% sodium azide solution and the blot was scanned at 800 dpi using an Epson Perfection 1200u scanner. Quantitative analysis of the detected proteins was performed using Labworks software (UVP Products, CA, U.S.A.).

Quantitative Real-Time Polymerase Chain Reaction (PCR)

RGC-5 cells were harvested from 6-well plates. Total RNA was then extracted in TriReagent according to the manufacturer’s instructions (Qiagen RNeasy® Kit). Afterwards, RNA was resuspended in 35 µL RNase-free water. RNA concentration was determined by Nanodrop 1000 spectrophotometer (Thermo Scientific, U.S.A.). RNA then was reverse transcribed with Oligo dT using reverse transcriptase-Superscript III (Invitrogen). Once synthesised, cDNA fidelity was tested by PCR and samples were then stored at −20°C. The information of primers for quantitative real-time PCR is shown in Table 1. Real-time PCR was conducted using Sybr Green I Mastermix (Applied Biosystems). Each reaction was run in triplicate and contained 1 µL of cDNA template along with 500 nM primers in a final reaction volume of 20 µL. Cycling parameters were 95°C for 10 min to activate DNA polymerase, then 40 cycles of 95°C for 15 s and 60°C for 1 min, with a final recording step of 78°C for 20 s to prevent any primer-dimer formation. Melting curves were performed using Dissociation Curves software (Applied Biosystems) to ensure only a single product was amplified. Relative quantitations of mRNA were analysed using the 2^−ΔΔCT method. Amplification of housekeeping gene acid ribosamal protein (ARP) from each sample was used for normalization of the quantitative PCR data.

Table 1. Sequences and Melting Temperature of Primers

Primers	Sequences	Melting temp. (°C)
ARP	Fwd: CGACCTGGAAGTCCAACTAC	76.1
	Rev: ATCTGCTGCATCTGCTTG
Nrf-2	Fwd: TTCTTTCAGCAGCATCCTCTCCAC	79.9
	Rev: ACAGCCTTCAATAGTCCCGTCCAG
HO-1	Fwd: CAAGCCGAGAATGCTGAGTTCATG	81.7
	Rev: GCAAGGGATGATTTCCTGCCAG

Statistical Analysis

Data were analysed using Sigma Plot.12 for one-way analysis of variance (ANOVA) followed by a Bonferroni test and are expressed as a mean percentage of the control value plus S.E.M. p<0.05 was considered significant.

Results

Cell Viability Results and Apoptosis Detection Show Sulbutiamine Is More Effective than NAC in Attenuating Serum Deprivation-Induced Cell Death However Is Ineffective in GB-Induced Cell Death

By use of Resazurin Reduction Assay (RRA), it was shown that 48 h serum deprivation reduced the viability of RGC-5 cells by 40% (Fig. 1A) and 24 h of 5 mM glutamate plus 5 mM BSO (GB) resulted in an approximate 45% decrease in cell viability (Fig. 1B).

Fig. 1. Cell Viability Study Was Determined by Use of Resazurin Reduction Assay (RRA)

(A) Serum deprivation caused a time-dependent reduction in cell viability and reduced the cell viability by 40% after 48 h. (B) GB caused a dose-dependent reduction in cell viability and resulted in an approximate 45% decrease in cell viability at concentration of 5 mM. (C) The negative effect of serum deprivation (48 h) was attenuated by sulbutiamine (50–100 µM) and NAC 5 mM. (D) The detrimental effect of 5 mM GB (24 h) was blunted by NAC (1, 5 mM) but not by sulbutiamine (10–100 µM). Data are expressed as mean±S.E.M. (n=5), ^# p<0.001 vs. control, * p<0.05 and ** p<0.01 vs. no drug group, Bonferroni test.

The effect of 5 mM GB was significantly nullified by inclusion of NAC (1 mM and 5 mM) (Fig. 1D). Moreover, NAC at 5 mM, but not at 1 mM nullified the detrimental effect of 48 h serum deprivation (Fig. 1C). Sulbutiamine (Sulb) at both 50 µM and 100 µM significantly increased cell viability by approximately 18% and 28% respectively relative to serum deprivation (Fig. 1C) but did not influence cultures exposed to 5 mM GB (Fig. 1D).

Following exposure of RGC-5 cells to 5 mM GB for 24 h or serum deprivation for 48 h, cell death was revealed by FDA/PI staining where live cells appear green and dead cells appeared red (Figs. 2E–H, Q–T). The death process by apoptosis was revealed by use of the APOPercentage™ dye (Figs. 2A–D, M–P) and Hoechst staining (Figs. 2I–L, U–X). The negative effect on cell survival induced by 5 mM GB in terms of cell death (F), apoptosis (B, G) was unaffected by the inclusion of 100 µM sulbutiamine (C, G, K) while NAC (5 mM) significantly blunted the negative effects of GB (D, H, L). Moreover, the detrimental effect of serum deprivation for 48 h in terms of cell death (R), apoptosis (N, V) was more efficaciously blunted by the inclusion of 100 µM sulbutiamine (O, S, W) than 5 mM NAC (P, T, X).

Fig. 2. Apoptotic Cell Death Was Detected by Use of APOPercentage™ Dye (A–D, M–P), FDA/PI Staining (E–H, Q–T) and Hoechst Staining (I–L, U–X)

The negative effect on cell survival induced by 5 mM of GB in terms of cell death (F), apoptosis (B, G) was unaffected by the inclusion of 100 µM of sulbutiamine (C, G, K) while NAC (5 mM) significantly blunted the negative effects of GB (D, H, L). Moreover, the detrimental effect of serum deprivation for 48 h in terms of cell death (R), apoptosis (N, V) was more efficaciously blunted by the inclusion of 100 µM sulbutiamine (O, S, W) than 5 mM NAC (P, T, X). These experiments were repeated in three separate experiments. Scale bars=20 µm.

The Effect of Sulbutiamine and NAC on the Antioxidant Defense Process

To further evaluate the beneficial effects of sulbutiamine and NAC, their influence on key intracellular antioxidant components were investigated. The relative fluorescent intensity which corresponds to reduced glutathione levels in RGC-5 cells was measured after 24 h exposure to 5 mM GB and 48 h exposure to serum deprivation. Both 5 mM GB for 24 h and serum deprivation for 48h resulted in significant depletion of GSH levels compared to control (Fig. 3A). The GSH levels treated with defined concentrations of sulbutiamine (50, 100 µM) and NAC (1, 5 mM) over 24 h were significantly increased (Fig. 3A). The GSH levels deceased by 5 mM GB for 24 h and serum deprivation for 48 h were significantly enhanced when RGC-5 cells were pre-treated with sulbutiamine (100 µM) and NAC (5 mM). (Fig. 3A).

Fig. 3. The Effect of Sulbutiamine and NAC on the Antioxidant Defence Process

(A) Relative GSH fluorescence intensity compared to control in cultures treated with either sulbutiamine or NAC for 24 h. Incubation with GB 5 mM over 24 h or serum deprivation 48 h decreased GSH significantly. Cells incubated with different concentrations of sulbutiamine (50, 100 µM) and NAC (1, 5 mM) showed a dose dependent increase in reduced glutathione (GSH) levels. The GSH levels deceased by 5 mM GB for 24 h and serum deprivation for 48 h were significantly enhanced when RGC-5 cells were pre-treated with sulbutiamine (100 µM) and NAC (5 mM). (B) GST levels compared to control in cultures treated with different substances. Post incubation, GST levels were measured over 60 min at three different time intervals (15, 30, 60 min). Sulbutiamine (50, 100 µM) was effective in increasing GST levels at 30 and 60 min. NAC 1 mM stimulated GST at 30 and 60 min whereas 5 mM stimulated GST from 15 to 60 min. Both GB and serum deprivation significantly decreased GST levels at 30 and 60 min. (C) The influence of different substances on catalase levels measured over 60 min. Following serum deprivation for 48 h or GB 5 mM exposure over 24 h, catalase levels decreased significantly at 60 min. Sulbutiamine (100 µM) significantly increased catalse above control levels. NAC 5 mM caused no significant change in catalase levels relative to control at 60 min. Data are expressed as mean±S.E.M. (n=5), * p<0.05, ** p<0.01 and *** p<0.001 vs. control, ^# p<0.05, ^## p<0.01; ⁺⁺ p<0.01 and ⁺⁺⁺ p<0.001 vs. no drug group, Bonferroni test.

Figure 3B shows the levels of GST following exposure to sulbutiamine (50, 100 µM), NAC (1, 5 mM) and 5 mM GB for 24 h or serum deprivation for 48 h. Post-incubation sulbutiamine (50, 100 µM) at 30 and 60 min significantly stimulated the formation of GST. NAC 1 mM also stimulated GST at 30 and 60 min. NAC at 5 mM stimulated GST not only at 30 and 60 min but also in as little as 15 min (Fig. 3B). Cells incubated with either serum deprivation for 48 h or GB 5 mM for 24 h also significantly reduced GST levels at 30 and 60 min.

The relative levels of catalase were measured over 1 h after exposure to sulbutiamine (100 µM), NAC (5 mM) and 5 mM GB for 24 h or serum deprivation for 48 h. Catalase levels significantly decreased over 1 h period subjected to serum deprivation for 48 h or GB 5 mM for 24 h (Fig. 3C). NAC 5 mM caused no significant change however sulbutiamine 100 µM significantly increased catalase levels at 60 min (Fig. 3C).

NAC Is More Effective than Sulbutiamine in Scavenging Different Types of ROS

The antioxidant capacity was subsequently determined where NAC was more effective than sulbutiamine at scavenging different types of ROS. ROS activity relative fluorescence units (RFU) was significantly increased when 1 mM H₂O₂ or KO₂ were added to cells. Both sulbutiamine (50, 100 µM) and NAC (1, 5 mM) significantly scavenged the H₂O₂ induced hydrogen peroxide (Fig. 4A) and KO₂ induced O₂^•− radicals (Fig. 4B). Hydroxyl radicals produced by adding 1 mM H₂O₂ plus 100 µM Ferrous(II) perchlorate. It was seen that only NAC at 5 mM was able to scavenge H₂O₂ plus Ferrous(II) perchlorate induced HO⁻ (Fig. 4C).

Fig. 4. Radical Scavenging Capacities of Sulbutiamine and NAC on Various Radical Species (H₂O₂, O₂^•− and HO⁻)

(A) Sulbutiamine (50, 100 µM) and NAC (1, 5 mM) significantly scavenged 1 mM H₂O₂-induced ROS. (B) Sulbutiamine (50, 100 µM) and NAC (1, 5 mM) significantly scavenged 1 mM KO₂-induced ROS. (C) Only NAC at 5 mM significantly scavenged 1 mM H₂O₂ plus 100 µM ferrous perchlorate(II)-induced ROS. (D) Microscopic analysis of cell cultures processed for the localization of ROS showed that 5 mM of NAC significantly scavenged ROS produced by both GB (5 mM) and serum deprivation (48 h) and 100 µM sulbutiamine slightly scavenged ROS produced by serum deprivation (48 h) but not GB (5 mM). (E) Quantification of ROS also showed that NAC at 5 mM significantly reduced ROS induced by 5 mM of GB and 48 h of serum deprivation and sulbutiamine at 100 µM only significantly reduced ROS induced by 48h of serum deprivation. Data are expressed as mean±S.E.M. (n=5), ^# p<0.001 vs. control, * p<0.05 and ** p<0.01 vs. no drug group, Bonferroni test. Scale bars=50 µm.

Moreover, microscopic analysis of cell cultures processed for the localization of ROS (Fig. 4D) and quantification of ROS (Fig. 4E) provided confirmatory data to support the view that NAC is more effective than sulbutiamine at counteracting the effect of ROS production induced by 5 mM GB for 24 h and serum deprivation for 48 h.

The Effect of Necrostatin-1 (Necroptosis Inhibitor) and z-VAD-fmk (Pan-Caspase Inhibitor) on GB and Serum Deprivation Treatment

Cell viability analysis (RRA) demonstrated the neuroprotective effect of Necrostatin-1 and z-VAD-fmk on RGC-5 cells exposed to either GB 5 mM over 24 h (Fig. 5A) or serum deprivation for 48 h (Fig. 5B). Necrostatin-1 (50, 100 µM) significantly blunted the effect of 5 mM GB over 24 h but not the effect of serum deprivation for 48 h. Necrostatin-1 inactive was used as negative control. In contrast, z-VAD-fmk (25, 50 µM) attenuated the detrimental effect of serum deprivation for 48 h but not 5 mM GB over 24 h. Moreover, this was confirmed by microscopic analysis using the APOPercentage™ method (Fig. 5C). Consistent with these findings is the observation that caspase-3 activity was elevated by serum deprivation over 48 h but not by 5 mM GB for 24 h. And the increased caspase-3 activity was significantly inhibited by 100 µM sulbutiamine and 5 mM NAC. Staurosporine was used for positive control (Fig. 5D).

Fig. 5. The Effect of Pan-Caspase Inhibitor (z-VAD-fmk) and Necroptosis Inhibitor (Necrostatin-1) on 5 mM of GB and 48 h of Serum Deprivation Treatment

(A) Necrostatin-1 (50, 100 µM) but not z-VAD-fmk attenuated the negative effects of GB (5 mM). Necrostatin-1 inactive used as negative control. (B) z-VAD-fmk (25, 50 µM) but not Necrostatin-1 blunted the detrimental effects of serum deprivation (48 h). Necrostatin-1 inactive used as negative control. (C) Microscopic analysis determined by use of APOPercentage™ kit also showed that Necrostatin-1 at 100 µM nullified the negative effects of GB (5 mM) and z-VAD-fmk at 50 µM significantly reduced the apoptotic cells induced by serum deprivation (48 h). No attempt was made to quantify the number of apoptotic-positive cells. (D) The caspase-3 activity showed that 48h of serum deprivation and 0.5 µM of staurosporine caused a significant up-regulation of caspase-3 activity while 5 mM of GB was ineffective and the increased caspase-3 activity caused by 48 h of serum deprivation was significantly inhibited by 100 µM sulbutiamine and 5 mM NAC. Data are expressed as mean±S.E.M. (n=5), ^# p<0.001 vs. control, * p<0.05, ⁺ p<0.05, ** p<0.01 and *** p<0.001 vs. no drug group, Bonferroni test. Scale bars=20 µm.

The Effect of GB, Serum Deprivation, Sulbutiamine and NAC on Protein and mRNA Levels of Nrf-2 and HO-1

RGC-5 cells were exposed to GB (5 mM), sulbutiamine (100 µM), NAC (5 mM) for 24 h or serum deprivation for 48h and processed for the localization of Nrf-2 immunoreactivity. Nrf-2 immunoreactivity was obviously increased by 5 mM of GB or 100 µM sulbutiamine and decreased by 48 h of serum deprivation. There was no significant difference between NAC (5 mM) and control. The decreased Nrf-2 immunoreactivity caused by 48 h of serum deprivation was significantly increased after adding 100 µM sulbutiamine (Fig. 6A). Western blot and qPCR studies provided support for the idea that GB (5 mM) or sulbutiamine (50, 100 µM) increased (Figs. 6B, C) and serum deprivation (48 h) decreased both Nrf-2 protein and mRNA contents (Fig. 6B). In contrast, NAC (1, 5 mM) did not significantly affect Nrf-2 on mRNA and protein levels (Fig. 6C).

Fig. 6. The Changes of Nrf-2 at Protein and mRNA Levels Exposed to Different Substances

(A) Immunocytochemistry staining showed that Nrf-2 immunoreactivity was obviously increased by 5 mM of GB or 100 µM sulbutiamine and decreased by 48 h of serum deprivation. There was no significant difference between NAC (5 mM) and control. The decreased Nrf-2 immunoreactivity caused by 48 h of serum deprivation was significantly increased after adding 100 µM sulbutiamine. No attempt was made to quantify the relative fluorescent intensity. (B) The bands intensity corresponding to the levels of Nrf-2 (57 kDa) relative to β-actin (42 kDa) and the mRNA levels relative to acid ribosomal phosphoprotein (ARP). It can be seen that serum deprivation decreased protein and mRNA levels of Nrf-2 whereas sulbutiamine at 50 and 100 µM increased the levels. (C) Western blot and qPCR results showed that 5 mM of GB significantly increased protein and mRNA levels of Nrf-2 whereas NAC at 1 and 5 mM had no effect on the levels. These experiments were repeated in four separate experiments. Data are expressed as mean±S.E.M., * p<0.05, ** p<0.01 and *** p<0.001 vs. control, Bonferroni test. Scale bars=60 µm.

HO-1 immunoreactivity was obviously increased by 5 mM of GB or 100 µM sulbutiamine and decreased by 48 h of serum deprivation. There was no significant difference between NAC (5 mM) and control. The decreased HO-1 immunoreactivity caused by 48 h of serum deprivation was significantly increased after adding 100 µM sulbutiamine (Fig. 7A). Western blot and qPCR studies provided support for the idea that GB (5 mM) or sulbutiamine (50, 100 µM) increased (Figs. 7B, C) and serum deprivation (48 h) decreased (Fig. 7B) both HO-1 protein and mRNA contents. In contrast, NAC (1, 5 mM) did not significantly affect HO-1 on mRNA and protein levels (Fig. 7C).

Fig. 7. The Changes of HO-1 at Protein and mRNA Levels Exposed to Different Substances

(A) Immunocytochemistry staining showed that HO-1 immunoreactivity was obviously increased by 5 mM of GB or 100 µM sulbutiamine and decreased by 48 h of serum deprivation. There was no significant difference between NAC (5 mM) and control. The decreased HO-1 immunoreactivity caused by 48 h of serum deprivation was significantly increased after adding 100 µM sulbutiamine. No attempt was made to quantify the relative fluorescent intensity. (B) The bands intensity corresponding to the levels of HO-1 (37 kDa) relative to β-actin (42 kDa) and the mRNA levels relative to acid ribosomal phosphoprotein (ARP). It can be seen that serum deprivation decreased protein and mRNA levels of HO-1 whereas sulbutiamine at 50 and 100 µM increased the levels. (C) Western blot and qPCR results showed that 5 mM of GB significantly increased protein and mRNA levels of HO-1 whereas NAC at 1 and 5 mM had no effect on the levels. These experiments were repeated in four separate experiments. Data are expressed as mean±S.E.M., * p<0.05, ** p<0.01 and *** p<0.001 vs. control, Bonferroni test. Scale bars=60 µm.

Quantitative determination of Nrf-2 and HO-1 was conducted by use of an enzyme immunoassay kit. ELISA studies also showed a similar trend with western blot and qPCR studies i.e. an increase of Nrf-2 and HO-1 levels with GB (5 mM) or sulbutiamine (50, 100 µM) treatment but a decrease with serum deprivation (48 h) treatment. NAC (1, 5 mM) showed no significant change relative to control. The decreased Nrf-2 and HO-1 levels caused by 48 h of serum deprivation were significantly increased after adding 100 µM sulbutiamine (Figs. 8A, B). As a positive control, Cos-7 Nrf-2-transfected nuclear extracts and Cadmium (20 µM) were used for Nrf-2 and HO-1 quantification, respectively.

Fig. 8. The Activity of Nrf-2 and HO-1 Were Determined by Use of ELISA

(A) GB at 5 mM or sulbutiamine at 50 and 100 µM significantly increased and serum deprivation for 48 h significantly decreased the Nrf-2 activity. NAC at 1 and 5 mM showed no significant changes relative to control. Cos-7 Nrf-2-transfected nuclear extracts was used as a positive control. (B) GB (5 mM) and sulbutiamine (50, 100 µM) significantly increased and serum deprivation (48 h) significantly decreased the HO-1 activity. NAC (1, 5 mM) showed no significant changes relative to control. The decreased Nrf-2 and HO-1 levels caused by 48 h of serum deprivation were significantly increased after adding 100 µM sulbutiamine. Cadmium (20 µM) was used as a positive control. Data are expressed as mean±S.E.M. (n=5), * p<0.05, ** p<0.01 and *** p<0.001 vs. control, ^# p<0.05 vs. no drug group, Bonferroni test.

Discussion

Neuronal damage in glaucoma has been linked to increased free radical production and to a low concentration of endogenous antioxidant defense.⁴⁸⁾ NAC and sulbutiamine are relatively safe sulphur compounds which are both currently used as adjuvant therapeutic agents for several clinical conditions.^13,27) Both are also known to have cytoprotective properties such as ROS scavenging and anti-apoptotic properties in several different cell lines.^16,49) However, both in vivo and in vitro studies to support their potential use in the treatment of neurodegenerative diseases are still lacking. Additionally the molecular mechanism underlying their potential neuroprotective effects still remains unclear.

To further understand by which mechanism of NAC and sulbutiamine could potentially mediate neuroprotection at the cellular level, this paper examined the effect of these compounds on two insults to RGC-5 cells. Thus the efficacy of NAC and sulbutiamine as ROS scavengers in oxidative stress conditions, their effects on cellular antioxidants, stress proteins and several anti-apoptotic proteins were investigated. NAC attenuated the detrimental effects of GB and although significant its protective effect is less dramatic in serum deprivation conditions. Sulbutiamine however significantly attenuated the effects of serum deprivation but not the effects of GB (Figs. 1, 2). Both sulfur compounds prevented cell death by modulating certain cellular defense mechanisms differently.

NAC and sulbutiamine both had positive effects on the antioxidants GSH and GST levels but only sulbutiamine showed significant stimulation of the antioxidant enzyme catalase (Fig. 3). NAC is thought to enhance the biosynthesis of GSH under conditions when the demand for GSH is increased,⁵⁰⁾ such as in some pathological conditions where excessive oxidative stress is implicated. GSH homeostasis is regulated by de novo synthesis as well as GSH redox state. It is possible that the differences observed between these two drugs in the stimulation of Nrf-2 is due to the differential effects of each drug in maintaining GSH levels since cellular GSH status has also been found to be important in modulating apoptosis in other cell types.⁵¹⁾ Furthermore Nrf-2 activity also regulates the sensitivity of death receptor signals by means of regulating intracellular GSH levels.⁵²⁾ The importance of GSH depletion in promoting apoptosis has been amply demonstrated in that apoptosis is prevented by replenishing intracellular GSH concentrations in several models of apoptosis.⁵³⁾

Nrf-2 is the primary transcription factor protecting cells from oxidative stress by regulating cytoprotective genes, including the antioxidant GSH pathway. The expression of the transcription factor Nrf-2 induces antioxidant enzymes involves transcriptional activation through the antioxidant-responsive element (ARE).⁸⁾ In this case, electrophilic agents including ROS induce a set of genes encoding Phase II enzymes, including HO-1, NADPH quinine oxidoreductase 1, and γ-glutamyl cysteine ligase (γ-GCL). These enzymes provide efficient cytoprotection, in part by regulating the intracellular redox state.⁸⁾ In the current study, sulbutiamine significantly caused a stimulation of Nrf-2 and the Phase II-dependent enzymes HO-1, while NAC had no significant effect (Figs. 6–8). Interestingly⁵⁴⁾ reported that co-incubation with NAC significantly attenuated HO-1 induction by SNP and SNAP, and a reduction in HO-1 activity was also observed when bovine endothelial cells were pre-incubated with NAC for 16 h prior to exposure to NO donors. Since HO-1 induction involves Nrf-2 activation, NAC may be inhibiting HO-1 via a negative feedback mechanism on Nrf-2. The different effect of these sulphur compounds on the endogenous cellular antioxidant architecture thus varies. The differences in Nrf-2 stimulation may partly explain the observed variation in their degree of neuroprotection. Sulbutiamine stimulated Nrf-2 but did not significantly attenuate the effects of GB which decreases GSH significantly compared to serum deprivation. Since NAC is more efficacious than sulbutiamine in stimulating GSH, this could explain why these substances do not equally attenuate the detrimental effects of GB. Also neuroprotection via Nrf-2 induction may be more specific or important in a particular cell death mechanism, stage or cell type. It is interesting to note that GB caused a significant increase in both Nrf-2 and HO-1 levels but still resulted in significant cell death. Hence there may be a threshold level where Nrf-2 induction can be beneficial. Furthermore, NAC at 5 mM is more efficacious than sulbutiamine in scavenging ROS which may play a more important role in GB induced cell death. NAC stimulated the enzyme GST, which is thought to be induced by the Nrf-2 pathway. However it is also possible that NAC may be acting on the ARE directly independent of Nrf-2 stimulation or by indirectly modulating GST and possibly other antioxidant enzymes.

Studies on the effects of the two sulphur compounds on different types of ROS showed NAC at high concentrations scavenged OH⁻, H₂O₂ and O₂^•−. Sulbutiamine at effective concentrations was not as efficacious in scavenging OH⁻. H₂O₂ can give rise to the formation of OH⁻ which is the most reactive species among the three radicals, a process markedly accelerated in the presence of ferric ions via the Fenton reaction.⁵⁵⁾ H₂O₂ can be removed when GSH is oxidized to GSSG via the action of glutathione peroxidase.⁵⁶⁾ In the present study the effective concentration of NAC (5 mM) caused greater stimulation of GSH than sulbutiamine (100 µM) (Fig. 3). High GSH levels can be readily oxidized to GSSG in the presence of ROS such as OH⁻ and therefore could be one reason why NAC was more effective in scavenging OH⁻. Futhermore, it can not be excluded whether sulbutiamine acts on low concentrations of hydroxyl radicals. Although this method has been used previously to cause stimulation of different radical species,⁴¹⁾ its sensitivity in detecting different types of ROS is a factor that also needs to be considered.

In this study, NAC showed no effect on catalase stimulation at 60 min whereas sulbutiamine has a significantly stimulatory effect. GB and serum deprivation both caused a drastic decrease in catalase levels compared to control (Fig. 3). The differences between NAC and sulbutiamine in stimulating catalase could be related to differences in chemical properties. Cetinkaya et al. 2005 evaluated the protective effects of NAC against acetic acid induced colitis in a rat model which showed no influence of NAC on catalase activity.⁵⁷⁾ However in another study which examined the effects of NAC on the age associated oxidative stress related parameters in different rat brain regions. The results showed that supplementation with NAC caused decreased lipid peroxidation, enhanced GSH levels, along with enhanced SOD and catalase activity.⁵⁸⁾ Currently there are no specific studies on the effects of sulbutiamine on catalase although a study carried out in thiamine deficient cell-free rat-liver extracts showed a decrease of catalase concentration and activity.⁵⁹⁾ Furthermore a study which looked at the biochemical activities and protein expression of catalase in isolated rats hearts submitted to thiamine deprivation, it was shown that catalase activity increased 2.1 times.⁶⁰⁾

Interestingly in a study which evaluated the antioxidative effect of several types of antioxidants on catalase activity at a physiological H₂O₂ concentration. The research showed that certain antioxidants can partially suppress catalase activity.¹¹⁾ The study demonstrated that catalase activity increase depending on the structure of antioxidative flavonoids and their derivatives. A combination of many factors such as the position of functional groups on the flavonoid structure and their interaction with catalase, including that of the ferriprotoporphyrin group, also contribute to this effect. The authors also did not find a clear relationship between the apparent IC₅₀ values for scavenging H₂O₂ and the enhancing effects on catalase activity.¹¹⁾ The complex physicochemical relationships between drug and enzyme activities thus may also apply to thiol antioxidants such as NAC and sulbutiamine.

In the present study, necroptosis which has characteristics of apoptosis, necrosis and also autophagy⁶¹⁾ was inhibited by Necrostatin-1 in GB exposed RGC-5 cells (Fig. 5A). Necrostatin-1 targets a serine/threonine kinase receptor that interacts with protein kinase-1 (RIP1) that is specifically involved in necroptosis.⁶²⁾ Cell death inhibition by Necrostatin-1 is thought to differentiate between apoptotic cell death and necroptosis.⁶¹⁾ The death mechanism involving serum free for 48 h appears to be more like apoptosis as evidenced by increase of caspase-3 activity. Moreover, caspase-3 activity was not elevated in GB exposure (Fig. 5D). A similar study also did not show any evidence of caspase-3 activation in RGC-5 cells exposed to GB.⁴⁾ It is possible that sulbutiamine protects the culture exposed to serum deprivation by decreasing caspase-3 levels and NAC protects GB induced cell death by inhibiting necroptotic pathway. Shin et al. showed that thiamine has a cytoprotective effect on cultured neonatal rat cardiomyocytes under hypoxic insult, and also protects the cardiomyocytes against hypoxia-induced apoptosis. Their findings also showed that caspase-3 activation, PARP cleavage and DNA fragmentation were all inhibited by thiamine.⁴⁹⁾ Furthermore, it has been shown that the hemoglobin oxidation by-product, hemin-induced necroptotic cell death in cortical astrocytes can be attenuated by NAC.⁶³⁾

In conclusion, GSH depletion may be a pivotal mechanism in several insults such as GB which inhibits its synthesis to cause a type of cell death, however serum deprivation induced oxidative stress and cellular damage to RGC-5 cells may have a lesser dependence on GSH and ROS and induces a different mechanism of cell death. Both NAC and sulbutiamine contributed to prevent the exhaustion of GSH in order to preserve the thiol antioxidant pool and also to decrease intracellular ROS accumulation and cell death. They also showed significant effect and variation on the modulation of crucial antioxidant enzymes, stress proteins which may contribute to their differences in cyptoprotective effects. It appears that NAC’s stimulation of GSH and ROS scavenging is the main mechanism by which it attenuated the negative effects of GB. Also the stimulation of Nrf-2 and its dependent enzymes may underlie sulbutiamine’s specificity in attenuating the negative effects of serum deprivation. However further experiments are needed to provide the necessary additional information to understand more precisely the mechanism by which NAC and sulbutiamine act as neuroprotectants. Also compared to sulbutiamine, the high concentrations required for NAC to act as a neuroprotectant could be a problem for use in a chronic manageable disease like glaucoma but might find a use in an acute disease affecting ganglion cells, such as ischemic optic neuropathy.

REFERENCES

• 1)  Quigley HA. Neuronal death in glaucoma. Prog. Retin. Eye Res., 18, 39–57 (1999).
• 2)  Sen CK. Redox signaling and the emerging therapeutic potential of thiol antioxidants. Biochem. Pharmacol., 55, 1747–1758 (1998).
• 3)  Butterfield DA, Drake J, Pocernich C, Castegna A. Evidence of oxidative damage in Alzheimer’s disease brain: central role for amyloid β-peptide. Trends Mol. Med., 7, 548–554 (2001).
• 4)  Maher P, Hanneken A. The molecular basis of oxidative stress-induced cell death in an immortalized retinal ganglion cell line. Invest. Ophthalmol. Vis. Sci., 46, 749–757 (2005).
• 5)  Brand MD, Affourtit C, Esteves TC, Green K, Lambert AJ, Miwa S, Pakay JL, Parker N. Mitochondrial superoxide: production, biological effects, and activation of uncoupling proteins. Free Radic. Biol. Med., 37, 755–767 (2004).
• 6)  Powers SK, Jackson MJ. Exercise-induced oxidative stress: cellular mechanisms and impact on muscle force production. Physiol. Rev., 88, 1243–1276 (2008).
• 7)  Ikonomidou C, Kaindl AM. Neuronal death and oxidative stress in the developing brain. Antioxid. Redox Signal., 14, 1535–1550 (2011).
• 8)  Lim JH, Park HS, Choi JK, Lee IS, Choi HJ. Isoorientin induces Nrf2 pathway-driven antioxidant response through phosphatidylinositol 3-kinase signaling. Arch. Pharm. Res., 30, 1590–1598 (2007).
• 9)  Sun MH, Pang JH, Chen SL, Han WH, Ho TC, Chen KJ, Kao LY, Lin KK, Tsao YP. Retinal protection from acute glaucoma-induced ischemia-reperfusion injury through pharmacologic induction of heme oxygenase-1. Invest. Ophthalmol. Vis. Sci., 51, 4798–4808 (2010).
• 10)  Greenwald RA. Superoxide dismutase and catalase as therapeutic agents for human diseases. A critical review. Free Radic. Biol. Med., 8, 201–209 (1990).
• 11)  Islam KN, Kayanoki Y, Kaneto H, Suzuki K, Asahi M, Fujii J, Taniguchi N. TGF-β1 triggers oxidative modifications and enhances apoptosis in HIT cells through accumulation of reactive oxygen species by suppression of catalase and glutathione peroxidase. Free Radic. Biol. Med., 22, 1007–1017 (1997).
• 12)  Doronicheva N, Yasui H, Sakurai H. Chemical structure-dependent differential effects of flavonoids on the catalase activity as evaluated by a chemiluminescent method. Biol. Pharm. Bull., 30, 213–217 (2007).
• 13)  Perry HE, Shannon MW. Efficacy of oral versus intravenous N-acetylcysteine in acetaminophen overdose: results of an open-label, clinical trial. J. Pediatr., 132, 149–152 (1998).
• 14)  Walker PD, Brokering KL, Theobald JC. Fenoldopam and N-acetylcysteine for the prevention of radiographic contrast material-induced nephropathy: a review. Pharmacotherapy, 23, 1617–1626 (2003).
• 15)  Zafarullah M, Li WQ, Sylvester J, Ahmad M. Molecular mechanisms of N-acetylcysteine actions. Cell. Mol. Life Sci., 60, 6–20 (2003).
• 16)  Malorni W, Rivabene R, Santini MT, Donelli G. N-Acetylcysteine inhibits apoptosis and decreases viral particles in HIV-chronically infected U937 cells. FEBS Lett., 327, 75–78 (1993).
• 17)  Levonen AL, Lapatto R, Saksela M, Raivio KO. Human cystathionine gamma-lyase: developmental and in vitro expression of two isoforms. Biochem. J., 347, 291–295 (2000).
• 18)  Ho PI, Collins SC, Dhitavat S, Ortiz D, Ashline D, Rogers E, Shea TB. Homocysteine potentiates β-amyloid neurotoxicity: role of oxidative stress. J. Neurochem., 78, 249–253 (2001).
• 19)  Heinecke JW, Rosen H, Suzuki LA, Chait A. The role of sulfur-containing amino acids in superoxide production and modification of low density lipoprotein by arterial smooth muscle cells. J. Biol. Chem., 262, 10098–10103 (1987).
• 20)  Tyagi N, Moshal KS, Sen U, Vacek TP, Kumar M, Hughes WM Jr, Kundu S, Tyagi SC. H2S protects against methionine-induced oxidative stress in brain endothelial cells. Antioxid. Redox Signal., 11, 25–33 (2009).
• 21)  Auer M, Pfister LA, Leppert D, Täuber MG, Leib SL. Effects of clinically used antioxidants in experimental pneumococcal meningitis. J. Infect. Dis., 182, 347–350 (2000).
• 22)  Sury MD, Frese-Schaper M, Mühlemann MK, Schulthess FT, Blasig IE, Täuber MG, Shaw SG, Christen S. Evidence that N-acetylcysteine inhibits TNF-alpha-induced cerebrovascular endothelin-1 upregulation via inhibition of mitogen- and stress-activated protein kinase. Free Radic. Biol. Med., 41, 1372–1383 (2006).
• 23)  McLellan LI, Lewis AD, Hall DJ, Ansell JD, Wolf CR. Uptake and distribution of N-acetylcysteine in mice: tissue-specific effects on glutathione concentrations. Carcinogenesis, 16, 2099–2106 (1995).
• 24)  Christen S, Schaper M, Lykkesfeldt J, Siegenthaler C, Bifrare YD, Banic S, Leib SL, Täuber MG. Oxidative stress in brain during experimental bacterial meningitis: differential effects of alpha-phenyl-tert-butyl nitrone and N-acetylcysteine treatment. Free Radic. Biol. Med., 31, 754–762 (2001).
• 25)  Berk M, Copolov DL, Dean O, Lu K, Jeavons S, Schapkaitz I, Anderson-Hunt M, Bush AI. N-Acetyl cysteine for depressive symptoms in bipolar disorder—A double-blind randomized placebo-controlled trial. Biol. Psychiatry, 64, 468–475 (2008).
• 26)  Adair JC, Knoefel JE, Morgan N. Controlled trial of N-acetylcysteine for patients with probable Alzheimer’s disease. Neurology, 57, 1515–1517 (2001).
• 27)  Ollat H, Laurent B, Bakchine S, Michel BF, Touchon J, Dubois B. Effects of the association of sulbutiamine with an acetylcholinesterase inhibitor in early stage and moderate Alzheimer disease. Encephale, 33, 211–215 (2007).
• 28)  Bettendorff L, Weekers L, Wins P, Schoffeniels E. Injection of sulbutiamine induces an increase in thiamine triphosphate in rat tissues. Biochem. Pharmacol., 40, 2557–2560 (1990).
• 29)  Micheau J, Durkin TP, Destrade C, Rolland Y, Jaffard R. Chronic administration of sulbutiamine improves long term memory formation in mice: possible cholinergic mediation. Pharmacol. Biochem. Behav., 23, 195–198 (1985).
• 30)  Shah SN, Sulbutiamine Study Group. Adjuvant role of vitamin B analogue (sulbutiamine) with anti-infective treatment in infection associated asthenia. J. Assoc. Physicians India, 51, 891–895 (2003).
• 31)  Van Reeth O. Pharmacologic and therapeutic features of sulbutiamine. Drugs Today (Barc.), 35, 187–192 (1999).
• 32)  Dmitriev DG, Gamidov SI, Permiakova OV. Clinical efficacy of the drug enerion in the treatment of patients with psychogenic (functional) erectile dysfunction. Urologiia, 1, 32–35 (2005).
• 33)  Douzenis A, Michopoulos I, Lykouras L. Sulbutiamine, an ‘innocent’ over the counter drug, interferes with therapeutic outcome of bipolar disorder. World J. Biol. Psychiatry, 7, 183–185 (2006).
• 34)  Bruce WR, Furrer R, Shangari N, O’Brien PJ, Medline A, Wang Y. Marginal dietary thiamin deficiency induces the formation of colonic aberrant crypt foci (ACF) in rats. Cancer Lett., 202, 125–129 (2003).
• 35)  Portari GV, Marchini JS, Vannucchi H, Jordao AA. Antioxidant effect of thiamine on acutely alcoholized rats and lack of efficacy using thiamine or glucose to reduce blood alcohol content. Basic Clin. Pharmacol. Toxicol., 103, 482–486 (2008).
• 36)  Krishnamoorthy RR, Agarwal P, Prasanna G, Vopat K, Lambert W, Sheedlo HJ, Pang IH, Shade D, Wordinger RJ, Yorio T, Clark AF, Agarwal N. Characterization of a transformed rat retinal ganglion cell line. Brain Res. Mol. Brain Res., 86, 1–12 (2001).
• 37)  Ahmed SA, Gogal RM Jr, Walsh JE. A new rapid and simple non-radioactive assay to monitor and determine the proliferation of lymphocytes: an alternative to [3H]thymidine incorporation assay. J. Immunol. Methods, 170, 211–224 (1994).
• 38)  Jones KH, Senft JA. An improved method to determine cell viability by simultaneous staining with fluorescein diacetate-propidium iodide. J. Histochem. Cytochem., 33, 77–79 (1985).
• 39)  Fadok VA, Daleke DL, Henson PM, Bratton DL, Bratton DL; de Cathelineau A. Loss of phospholipid asymmetry and surface exposure of phosphatidylserine is required for phagocytosis of apoptotic cells by macrophages and fibroblasts. J. Biol. Chem., 276, 1071–1077 (2001).
• 40)  Carter WO, Narayanan PK, Robinson JP. Intracellular hydrogen peroxide and superoxide anion detection in endothelial cells. J. Leukoc. Biol., 55, 253–258 (1994).
• 41)  Shimazawa M, Nakajima Y, Mashima Y, Hara H. Docosahexaenoic acid (DHA) has neuroprotective effects against oxidative stress in retinal ganglion cells. Brain Res., 1251, 269–275 (2009).
• 42)  Adom KK, Liu RH. Rapid peroxyl radical scavenging capacity (PSC) assay for assessing both hydrophilic and lipophilic antioxidants. J. Agric. Food Chem., 53, 6572–6580 (2005).
• 43)  Setsukinai K, Urano Y, Kakinuma K, Majima HJ, Nagano T. Development of novel fluorescence probes that can reliably detect reactive oxygen species and distinguish specific species. J. Biol. Chem., 278, 3170–3175 (2003).
• 44)  Nicholson DW, Ali A, Thornberry NA, Vaillancourt JP, Ding CK, Gallant M, Gareau Y, Griffin PR, Labelle M, Lazebnik YA, Munday NA, Raju SM, Smulson ME, Yamin T-T, Yu VL, Miller DK. Identification and inhibition of the ICE/CED-3 protease necessary for mammalian apoptosis. Nature, 376, 37–43 (1995).
• 45)  Mueller S, Riedel DH, Stremmel W. Determination of catalase activity at physiological H₂O₂ concentrations. Anal. Biochem., 245, 55–60 (1997).
• 46)  Zhou M, Diwu Z, Panchuk-Voloshina N, Haugland RPA. A stable nonfluorescent derivative of resorufin for the fluorometric determination of trace hydrogen peroxide: applications in detecting the activity of phagocyte NADPH oxidase and other oxidases. Anal. Biochem., 253, 162–168 (1997).
• 47)  Laemmli UK. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature, 227, 680–685 (1970).
• 48)  Izzotti A, Bagnis A, Saccà SC. The role of oxidative stress in glaucoma. Mutat. Res., 612, 105–114 (2006).
• 49)  Shin BH, Choi SH, Cho EY, Shin MJ, Hwang KC, Cho HK, Chung JH, Jang Y. Thiamine attenuates hypoxia-induced cell death in cultured neonatal rat cardiomyocytes. Mol. Cells, 18, 133–140 (2004).
• 50)  De Vries N, De Flora S. N-Acetyl-L-cysteine. J. Cell. Biochem., 53 (S17F), 270–277 (1993).
• 51)  Beaver JP, Waring P. A decrease in intracellular glutathione concentration precedes the onset of apoptosis in murine thymocytes. Eur. J. Cell Biol., 68, 47–54 (1995).
• 52)  Morito N, Yoh K, Itoh K, Hirayama A, Koyama A, Yamamoto M, Takahashi S. Nrf2 regulates the sensitivity of death receptor signals by affecting intracellular glutathione levels. Oncogene, 22, 9275–9281 (2003).
• 53)  Bojes HK, Datta K, Xu J, Chin A, Simonian P, Nuñez G, Kehrer JP. Bcl-x_L overexpression attenuates glutathione depletion in FL5.12 cells following interleukin-3 withdrawal. Biochem. J., 325, 315–319 (1997).
• 54)  Foresti R, Clark JE, Green CJ, Motterlini R. Thiol compounds interact with nitric oxide in regulating heme oxygenase-1 induction in endothelial cells. Involvement of superoxide and peroxynitrite anions. J. Biol. Chem., 272, 18411–18417 (1997).
• 55)  Gutteridge JM, Richmond R, Halliwell B. Inhibition of the iron-catalysed formation of hydroxyl radicals from superoxide and of lipid peroxidation by desferrioxamine. Biochem. J., 184, 469–472 (1979).
• 56)  Meister A, Anderson ME. Glutathione. Annu. Rev. Biochem., 52, 711–760 (1983).
• 57)  Cetinkaya A, Bulbuloglu E, Kurutas EB, Ciralik H, Kantarceken B, Buyukbese MA. Beneficial effects of N-acetylcysteine on acetic acid-induced colitis in rats. Tohoku J. Exp. Med., 206, 131–139 (2005).
• 58)  Kanwar SS, Nehru B. Modulatory effects of N-acetylcysteine on cerebral cortex and cerebellum regions of ageing rat brain. Nutr. Hosp., 22, 95–100 (2007).
• 59)  Hauschildt S. The influence of thiamine deficiency on porphyrin synthesis and porphyrin proteins. J. Nutr. Sci. Vitaminol. (Tokyo), 21, 403–410 (1975).
• 60)  Gioda CR, de Oliveira Barreto T, Prímola-Gomes TN, de Lima DC, Campos PP, Capettini LS, Lauton-Santos S, Vasconcelos AC, Coimbra CC, Lemos VS, Pesquero JL, Cruz JS. Cardiac oxidative stress is involved in heart failure induced by thiamine deprivation in rats. Am. J. Physiol. Heart Circ. Physiol., 298, H2039–H2045 (2010).
• 61)  Degterev A, Huang Z, Boyce M, Li Y, Jagtap P, Mizushima N, Cuny GD, Mitchison TJ, Moskowitz MA, Yuan J. Chemical inhibitor of nonapoptotic cell death with therapeutic potential for ischemic brain injury. Nat. Chem. Biol., 1, 112–119 (2005).
• 62)  Kroemer G, Galluzzi L, Vandenabeele P, Abrams J, Alnemri ES, Baehrecke EH, Blagosklonny MV, El-Deiry WS, Golstein P, Green DR, Hengartner M, Knight RA, Kumar S, Lipton SA, Malorni W, Nuñez G, Peter ME, Tschopp J, Yuan J, Piacentini M, Zhivotovsky B, Melino G, Nomenclature Committee on Cell Death 2009. Classification of cell death: recommendations of the Nomenclature Committee on Cell Death 2009. Cell Death Differ., 16, 3–11 (2009).
• 63)  Laird MD, Wakade C, Alleyne CH Jr, Dhandapani KM. Hemin-induced necroptosis involves glutathione depletion in mouse astrocytes. Free Radic. Biol. Med., 45, 1103–1114 (2008).