Selective Androgen Receptor Modulator, YK11, Regulates Myogenic Differentiation of C2C12 Myoblasts by Follistatin Expression

Abstract

The myogenic differentiation of C2C12 myoblast cells is induced by the novel androgen receptor (AR) partial agonist, (17α,20E)-17,20-[(1-methoxyethylidene)bis-(oxy)]-3-oxo-19-norpregna-4,20-diene-21-carboxylic acid methyl ester (YK11), as well as by dihydrotestosterone (DHT). YK11 is a selective androgen receptor modulator (SARM), which activates AR without the N/C interaction. In this study, we further investigated the mechanism by which YK11 induces myogenic differentiation of C2C12 cells. The induction of key myogenic regulatory factors (MRFs), such as myogenic differentiation factor (MyoD), myogenic factor 5 (Myf5) and myogenin, was more significant in the presence of YK11 than in the presence of DHT. YK11 treatment of C2C12 cells, but not DHT, induced the expression of follistatin (Fst), and the YK11-mediated myogenic differentiation was reversed by anti-Fst antibody. These results suggest that the induction of Fst is important for the anabolic effect of YK11.

Androgens such as testosterone and 5-α-dihydrotestosterone (DHT) act as agonists of androgen receptor (AR), which is a member of the nuclear receptor (NR) superfamily of ligand-dependent transactivation factors. Because androgens show anabolic effects on skeletal muscles, androgen declining with age contributes to age-related bone and muscle loss and increase in fat mass.^1–3) Thus, the androgen anabolic effect is attractive for the maintenance of health. However, besides anabolic effects, various biological effects, such as development of male reproductive tissues, sexual development and spermatogenesis (androgenic effects), are mediated by AR.^4–7) Separation of anabolic effects from androgenic effects is critical for clinical usage of selective androgen receptor modulators (SARMs) in diseases such as sarcopenia, cancer cachexia and osteoporosis.^8,9) However, the detailed mechanism of selective anabolic action by SARMs in skeletal muscle still remains unclear.

Structurally characterized by an amino-terminal transactivation domain [NTD/activation function 1 (AF1)], a DNA binding domain (DBD), and a ligand binding domain (LBD) including a carboxy-terminal transactivation domain [activation function 2 (AF2)],^10,11) AR mediates the expression of androgen-regulated genes, such as prostate specific antigen (PSA)^12–14) and FK506-binding protein 51 (FKBP51).^15–17) AR is localized in the cytoplasm, where it forms a complex with chaperones. Upon ligand binding, AR translocates into the nucleus. Following nuclear translocation, AR binds as a homodimer to androgen responsive elements (ARE) in the promoter regions of its target genes. Full activation of AR requires physical interaction between the NTD/AF1 and LBD/AF2 (known as the N/C interaction).^18–21)

Follistatin (Fst) is essential for muscle fiber formation and growth. It is an extracellular protein that acts as an inhibitory binding partner of activins and selected transforming growth factor β (TGF-β) family members. As the TGF-β signaling cascade inhibits myogenic differentiation, inhibition of TGF-β signaling accelerates myogenic differentiation.

Previously, we have reported the AR partial agonistic nature of the novel steroidal compound, (17α,20E)-17,20-[(1-methoxyethylidene)bis-(oxy)]-3-oxo-19-norpregna-4,20-diene-21-carboxylic acid methyl ester (YK11), using the ARE-luciferase assay.²²⁾ YK11 did not induce the N/C interaction required for the AR full agonist function and was gene-selective in MDA-MB 453 cells. In the present study, we show the induction of myogenic differentiation of myoblast C2C12 cells by YK11 in comparison with DHT.

Materials and Methods

Chemicals

YK11 was prepared as previously reported.²²⁾ DHT and hydroxyflutamide (FLU) were obtained from Wako Pure Chemical Industries, Ltd. (Osaka, Japan) and Toronto Research Chemicals (Toronto, Canada), respectively. Anti-follistatin (Fst) antibody was purchased from GeneTex (San Antonio, TX, U.S.A.).

Cell Culture

Mouse myoblast C2C12 cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal bovine serum (FBS) at 37°C in a humidified atmosphere with 5% CO₂. C2C12 cells were seeded on plates and maintained in culture medium for 24 h. To induce myogenic differentiation, YK11 or DHT in DMEM supplemented with 2% horse serum (differentiation medium) was added to the cells on day 0. For the neutralization assay of Fst (also known as activin-binding protein), C2C12 cells were maintained in differentiation medium in the presence of anti-Fst antibody.

Immunoblotting

Cells were harvested and lysed in sodium dodecyl sulfate (SDS) sample buffer containing 125 mM Tris–HCI, pH 6.8, 4% SDS, 10% sucrose, 10 mM dithiothreitol and 0.01% bromophenol blue. Whole-cell lysates were resolved by SDS-polyachylamide gel electrophoresis (PAGE) and immunoblotting was performed using anti-myosin heavy chain (MyHC, eBioscience, San Diego, CA, U.S.A.), anti-androgen receptor (Epitomics, Burlingame, CA, U.S.A.) and anti-tubulin antibodies (MBL, Nagoya, Japan) as primary antibodies. Horseradish peroxidase-conjugated anti-mouse or rabbit immunoglobulin G (IgG) antibody (Cell Signaling Technology, Danvers, MA, U.S.A.) was used as secondary antibody.

Knockdown Experiments

Cells were transfected with AR small interfering RNA (SASI_Mm01_00027673; Sigma-Aldrich, St. Louis, MO, U.S.A.) or control siRNA using Lipofectamine RNAiMAX reagent (Invitrogen, Carlsbad, CA, U.S.A.) according to the manufacturer’s instructions.

Real-Time Quantitative Reverse Transcription-Polymerase Chain Rection (qRT-PCR)

Total RNA was isolated using ISOGEN II (Nippon Gene Co., Ltd., Toyama, Japan). cDNA was synthesized using the ReverTra Ace® qPCR RT Kit (TOYOBO, Osaka, Japan). qRT-PCR was conducted using THUNDERBIRD™ SYBR qPCR Mix (TOYOBO) in a final volume of 25 µL according to the manufacturer’s protocol, and analyzed with the Applied Biosystems 7500 Fast System SDS software. The primer pairs used are described in Table 1.

Table 1. Primers for the Target Genes (5′→3′)

Myogenin	FW	AGCTGTATGAGACATCCCCC
	Rev	TTCTTGAGCCTGCGCTTCTC
MyoD	FW	ACTACAGCGGCGACTCCGACGCGTCCAG
	Rev	GGTGGAGATGCGCTCCACGATGCTGGACAG
Myf5	FW	AGCATTGTGGATCGGATCACGTCT
	Rev	CTGGAGGGTCCCGGGGTAGC
Follistatin	FW	AGAGGAAATGTCTGCTTCCG
	Rev	CACCTCTCTTCAGTCTCCTG
AR	FW	TACCAGCTCACCAAGCTCCT
	Rev	GATGGGCTTGACTTTCCCAG
β-Actin	FW	TCCTCCTGAGCGCAAGTACTC
	Rev	CTGCTTGCTGATCCACATCTG

Statistical Analysis

Statistically significant differences were determined using the Student’s t-test, and differences were considered statistically significant at p<0.05.

Results

YK11 and DHT Induce Myogenic Differentiation of C2C12 Cells

Firstly, we examined whether AR is expressed in C2C12 myoblast cells. AR expression was detected in C2C12 cells during cell differentiation by immunoblot assay (Fig. 1A). To investigate the effect of YK11 on C2C12 cells, the expression of the differentiation marker, myosin heavy chain (MyHC), was examined. C2C12 cells were cultured with YK11, DHT or solvent in differentiation medium. The MyHC protein level on Day 7 was enhanced by both YK11 and DHT treatments (Fig. 1B), suggesting that like DHT, YK11 can induce myogenic differentiation of C2C12 cells.

Fig. 1. Induction of Myogenic Differentiation by YK11 and DHT

(A) C2C12 cells were treated with YK11 (500 nM), DHT (500 nM) or solvent control (EtOH) in differentiation medium for 2 d. Whole-cell lysates were resolved by SDS-PAGE, and proteins were detected by immunoblotting using antibodies against androgen receptor and tubulin as a loading control. (B) C2C12 cells were treated with YK11 (500 nM), DHT (500 nM) or solvent control (EtOH) in differentiation medium for 7 d. Whole-cell lysates were resolved by SDS-PAGE, and proteins were detected by immunoblotting using antibodies against myosin heavy chain (MyHC) and tubulin as a loading control. (C–H) C2C12 cells were treated with YK11 (C–E: 500 nM, F–H: 1–500 nM), DHT (C–E: 500 nM, F–H: 1–500 nM) or solvent control (EtOH) in differentiation medium for 2 or 4 d. The mRNA expression of Myf5 (C, F), MyoD (D, G) and myogenin (E, H) was measured by qRT-PCR. The results were normalized against β-actin and are expressed as mean±S.D. (#, p<0.05 compared with DHT-treated cells; *, p<0.05 and **, p<0.01 compared with the solvent control; n=3).

YK11 and DHT Upregulate the mRNA Expression of MRFs

Next, we analyzed the mRNA expression of the MRFs, Myf5, MyoD and myogenin. Cells were treated with YK11, DHT or solvent, and the expression of Myf5, MyoD and myogenin was analyzed by qRT-PCR on Day 2 and 4. Myf5 and myogenin mRNA expression on Day 4 was more significantly enhanced by YK11 treatment than by DHT treatment (Figs. 1C, E). Interestingly, upregulation of Myf5 and myogenin mRNA on Day 4 by YK11 treatment required high YK11 concentrations (100 nM or 500 nM; Figs. 1F–H), whereas DHT increased the expression of these genes at lower concentrations.

Co-treatment with the AR antagonist, FLU, suppressed this upregulation, suggesting that YK11-induced MRFs expression may be mediated by AR (Figs. 2A–C).

Fig. 2. Effect of the AR Antagonist, FLU, on the YK11-Induced Upregulation of MRFs (A–C)

C2C12 cells were treated with YK11 (500 nM) or solvent control (EtOH) in the presence or absence of FLU (10 µM) in differentiation medium for 4 d. The mRNA expression of Myf5 (A), MyoD (B) and myogenin (C) was measured by qRT-PCR. The results were normalized against β-actin and are expressed as mean±S.D. (*, p<0.05 compared with solvent control or FLU alone; n=3).

YK11 Induces Myf5 mRNA Expression via Fst mRNA Upregulation by AR

It has been reported that androgen-induced myogenic differentiation is regulated by Fst, which stimulates Myf5 expression.^23,24) Fst modulates the function of a number of TGF-β family members, such as myostatin, which is a negative regulator of myogenic differentiation, by directly binding to them. We speculated that the AR-dependent Fst induction may be responsible for the functional difference between YK11 and DHT. To verify this hypothesis, Fst expression was measured on Day 2 and Day 4 after the addition of YK11 or DHT. Fst mRNA expression was significantly induced by YK11 treatment, whereas it was not affected by DHT treatment (Fig. 3A). The YK11-induced upregulation of Fst mRNA was significantly reduced by co-treatment with FLU, supporting the AR-dependence of the YK11-mediated upregulation of Fst expression (Fig. 3B). Furthermore, we carried out an AR knockdown experiment. Similarly to the FLU treatment, the YK11-induced upregulation of Fst mRNA was significantly reduced by knockdown of AR (Fig. 3C).

Fig. 3. YK11-Induced Myogenic Differentiation Is Mediated by Induction of Fst Expression via AR in C2C12 Cells

(A) C2C12 cells were cultured with YK11, DHT (500 nM each) or solvent control (EtOH) in differentiation medium for 2 or 4 d. (**, p<0.01 compared with each solvent control on Day 2. (B) C2C12 cells were cultured in differentiation medium for 24 h. After 30 min of pretreatment with FLU (10 µM), cells were treated with YK11, DHT (500 nM each) or solvent control (EtOH) for 6 h. (*, p<0.05). (C) C2C12 cells were treated with siRNA against AR or negative control siRNA. After 24 h the medium was changed to differentiation medium. After another 24 h, cells were treated with YK11 or solvent for an additional 6 h. (**, p<0.01). The mRNA expression of Fst was measured by qRT-PCR. The results were normalized against β-actin and are expressed as mean±S.D. (n=3).

To see whether the YK11-induced Fst upregulation is responsible for the induction of Myf5 mRNA expression, C2C12 cells were treated with YK11 in the presence of neutralizing anti-Fst antibody for 2 d in differentiation medium. The increase in Myf5 mRNA level induced by YK11 treatment was abolished when cells were treated with the antibody against Fst (Fig. 4).

Fig. 4. Neutralization of Fst Inhibits YK11-Induced Myogenic Differentiation of C2C12 Cells

C2C12 cells were treated with YK11 (500 nM) or solvent control (EtOH) in differentiation medium for 4 d in the presence or absence of anti-Fst antibody. The mRNA expression of Myf5 was measured by qRT-PCR. The results were normalized against β-actin and are expressed as mean±S.D. (*, p<0.05; n=3).

Discussion

In this study, we showed that the AR partial agonist, YK11, induced myogenic differentiation of C2C12 myoblast cells. Key MRFs such as MyoD, Myf5 and myogenin are known to be required for myogenic differentiation. MyoD and Myf5 are important for myogenic determination, whereas myogenin is important for terminal differentiation and lineage maintenance.²⁵⁾ Here, we demonstrated that YK11 significantly increased the mRNA levels of these MRFs compared with DHT, an AR full agonist. Based on these findings, YK11 may be more potent in inducing myogenic differentiation than DHT.

Recent reports have shown that testosterone treatment upregulates Fst expression and promotes myogenic differentiation in mesenchymal multipotent C3H 10T1/2 cells²⁴⁾ and in isolated satellite cells.²⁶⁾ We found that the Fst mRNA level was enhanced by YK11 treatment in C2C12 cells in an AR-dependent manner, as this effect was significantly reduced by co-treatment with an AR antagonist. The differentiation state may be involved in the agonist-specific Fst mRNA regulation, as unlike C3H 10T1/2 and isolated satellite cells, which are poorly differentiated compared with C2C12 cells, we did not observe a DHT induction of Fst mRNA in C2C12 cells. Recent reports have suggested that testosterone induces Fst expression via the non-canonical Wnt signaling.^24,26) Testosterone promotes nuclear translocation of the AR/β-catenin complex, which interacts with the Wnt pathway downstream factor, T-cell factor 4 (TCF-4). The Fst promoter has a TCF binding site and Fst mRNA is induced by Wnt.²⁷⁾ These reports have shown crosstalk between AR and Wnt signaling, however the molecular mechanism is not clear. In contrast, the Wnt3a-induced canonical Wnt signal decreases myogenic differentiation²⁸⁾ and promotes osteoblastic differentiation through upregulation of inhibitor of differentiation-3 (Id3) in C2C12 cells.²⁹⁾ Using various N/C interaction deficient mutants, it has been shown that the N/C interaction of AR is important for AR-dependent gene regulation. The N/C interaction contributes to selective gene activation by cofactor recruitment and chromatin binding.^19,30) Previously, we have shown by ARE-luciferase reporter assay that YK11 acts as a partial AR agonist without inducing N/C interaction, whereas DHT strongly induced N/C interaction. In fact, a different regulation of AR target genes has been observed between YK11 and DHT treatment in MDA-MB453 cells.²²⁾ Furthermore, mutations of AR, which impair the N/C interaction, were found in incompletely virilized patients with partial androgen insensitivity.^31–33) In Fig. 2, a slight upregulation of MRFs mRNA was observed by treatment of FLU alone. Since FLU inhibits N/C interaction of AR, FLU may increase MRFs expression. A recent report has demonstrated that the SARM, S-101479, which shows low N/C interaction, induced recruitment of fewer cofactors than DHT.³⁴⁾ This observation suggests that the difference in Fst mRNA regulation between YK11 and DHT stems from cofactor recruitment differences.

In conclusion, YK11 induces myogenic differentiation via AR-dependent induction of Fst expression. Although DHT did not increase Fst mRNA, both YK11 and DHT elevated the expression of MyHC protein and MRFs’ mRNA, implying that DHT enhances myogenic differentiation through an Fst-independent pathway. In addition to the Fst pathway, YK11 may share this Fst-independent pathway with DHT.

In this report, YK11 was shown to be an appropriate anabolic SARM. However, further investigation is required to elucidate the mechanisms of the differential activation of the Fst pathway by YK11 and DHT.

Acknowledgment

This study was partially supported by the Ministry of Education, Culture, Sports, Science and Technology of Japan, a Grant-in-Aid for Young Scientists (B), and the “Open Research Center” Project.

REFERENCES

• 1)  Bhasin S, Tenover JS. Age-associated sarcopenia—issues in the use of testosterone as an anabolic agent in older men. J. Clin. Endocrinol. Metab., 82, 1659–1660 (1997).
• 2)  Bhasin S, Storer TW, Berman N, Yarasheski KE, Clevenger B, Phillips J, Lee WP, Bunnell TJ, Casaburi R. Testosterone replacement increases fat-free mass and muscle size in hypogonadal men. J. Clin. Endocrinol. Metab., 82, 407–413 (1997).
• 3)  Sattler FR, Castaneda-Sceppa C, Binder EF, Schroeder ET, Wang Y, Bhasin S, Kawakubo M, Stewart Y, Yarasheski KE, Ulloor J, Colletti P, Roubenoff R, Azen SP. Testosterone and growth hormone improve body composition and muscle performance in older men. J. Clin. Endocrinol. Metab., 94, 1991–2001 (2009).
• 4)  Matsumoto T, Takeyama K, Sato T, Kato S. Study of androgen receptor functions by genetic models. J. Biochem., 138, 105–110 (2005).
• 5)  Matsumoto T, Shiina H, Kawano H, Sato T, Kato S. Androgen receptor functions in male and female physiology. J. Steroid Biochem. Mol. Biol., 109, 236–241 (2008).
• 6)  Matsumoto T, Takeyama K, Sato T, Kato S. Androgen receptor functions from reverse genetic models. J. Steroid Biochem. Mol. Biol., 85, 95–99 (2003).
• 7)  Lee DK, Chang C. Endocrine mechanisms of disease: Expression and degradation of androgen receptor: mechanism and clinical implication. J. Clin. Endocrinol. Metab., 88, 4043–4054 (2003).
• 8)  Narayanan R, Mohler ML, Bohl CE, Miller DD, Dalton JT. Selective androgen receptor modulators in preclinical and clinical development. Nucl. Recept. Signal., 6, e010 (2008).
• 9)  Bhasin S, Jasuja R. Selective androgen receptor modulators as function promoting therapies. Curr. Opin. Clin. Nutr. Metab. Care, 12, 232–240 (2009).
• 10)  Robinson Rechavi M, Escriva Garcia H, Laudet V. The nuclear receptor superfamily. J. Cell Sci., 116, 585–586 (2003).
• 11)  Simental JA, Sar M, Lane MV, French FS, Wilson EM. Transcriptional activation and nuclear targeting signals of the human androgen receptor. J. Biol. Chem., 266, 510–518 (1991).
• 12)  Cleutjens KB, van Eekelen CC, van der Korput HA, Brinkmann AO, Trapman J. Two androgen response regions cooperate in steroid hormone regulated activity of the prostate-specific antigen promoter. J. Biol. Chem., 271, 6379–6388 (1996).
• 13)  Henttu P, Liao SS, Vihko P. Androgens up-regulate the human prostate-specific antigen messenger ribonucleic acid (mRNA), but down-regulate the prostatic acid phosphatase mRNA in the LNCaP cell line. Endocrinology, 130, 766–772 (1992).
• 14)  Wolf DA, Schulz P, Fittler F. Transcriptional regulation of prostate kallikrein-like genes by androgen. Mol. Endocrinol., 6, 753–762 (1992).
• 15)  Magee JA, Chang LW, Stormo GD, Milbrandt J. Direct, androgen receptor-mediated regulation of the FKBP5 gene via a distal enhancer element. Endocrinology, 147, 590–598 (2006).
• 16)  Makkonen H, Kauhanen M, Paakinaho V, Jaaskelainen T, Palvimo JJ. Long-range activation of FKBP51 transcription by the androgen receptor via distal intronic enhancers. Nucleic Acids Res., 37, 4135–4148 (2009).
• 17)  Febbo PG, Lowenberg M, Thorner AR, Brown M, Loda M, Golub TR. Androgen mediated regulation and functional implications of fkbp51 expression in prostate cancer. J. Urol., 173, 1772–1777 (2005).
• 18)  Doesburg P, Kuil CW, Berrevoets CA, Steketee K, Faber PW, Mulder E, Brinkmann AO, Trapman J. Functional in vivo interaction between the amino-terminal, transactivation domain and the ligand binding domain of the androgen receptor. Biochemistry, 36, 1052–1064 (1997).
• 19)  Li J, Fu J, Toumazou C, Yoon HG, Wong J. A role of the amino-terminal (N) and carboxyl-terminal (C) interaction in binding of androgen receptor to chromatin. Mol. Endocrinol., 20, 776–785 (2006).
• 20)  Schaufele F, Carbonell X, Guerbadot M, Borngraeber S, Chapman MS, Ma AA, Miner JN, Diamond MI. The structural basis of androgen receptor activation: intramolecular and intermolecular amino-carboxy interactions. Proc. Natl. Acad. Sci. U.S.A., 102, 9802–9807 (2005).
• 21)  He B, Lee LW, Minges JT, Wilson EM. Dependence of selective gene activation on the androgen receptor NH2- and COOH-terminal interaction. J. Biol. Chem., 277, 25631–25639 (2002).
• 22)  Kanno Y, Hikosaka R, Zhang SY, Inoue Y, Nakahama T, Kato K, Yamaguchi A, Tominaga N, Kohra S, Arizono K, Inouye Y. (17alpha,20E)-17,20-[(1-Methoxyethylidene)bis(oxy)]-3-oxo-19-norpregna-4,20-diene-21-carboxylic acid methyl ester (YK11) is a partial agonist of the androgen receptor. Biol. Pharm. Bull., 34, 318–323 (2011).
• 23)  Zhu J, Li Y, Lu A, Gharaibeh B, Ma J, Kobayashi T, Quintero AJ, Huard J. Follistatin improves skeletal muscle healing after injury and disease through an interaction with muscle regeneration, angiogenesis, and fibrosis. Am. J. Pathol., 179, 915–930 (2011).
• 24)  Singh R, Bhasin S, Braga M, Artaza JN, Pervin S, Taylor WE, Krishnan V, Sinha SK, Rajavashisth TB, Jasuja R. Regulation of myogenic differentiation by androgens: cross talk between androgen receptor/beta-catenin and follistatin/transforming growth factor-beta signaling pathways. Endocrinology, 150, 1259–1268 (2009).
• 25)  Perry RL, Rudnick MA. Molecular mechanisms regulating myogenic determination and differentiation. Front. Biosci., 5, D750–D767 (2000).
• 26)  Braga M, Bhasin S, Jasuja R, Pervin S, Singh R. Testosterone inhibits transforming growth factor-beta signaling during myogenic differentiation and proliferation of mouse satellite cells: potential role of follistatin in mediating testosterone action. Mol. Cell. Endocrinol., 350, 39–52 (2012).
• 27)  Willert J, Epping M, Pollack JR, Brown PO, Nusse R. A transcriptional response to Wnt protein in human embryonic carcinoma cells. BMC Dev. Biol., 2, 8 (2002).
• 28)  Tanaka S, Terada K, Nohno T. Canonical Wnt signaling is involved in switching from cell proliferation to myogenic differentiation of mouse myoblast cells. J. Mol. Signal., 6, 12 (2011).
• 29)  Zhang L, Shi S, Zhang J, Zhou F, ten Dijke P. Wnt/beta-catenin signaling changes C2C12 myoblast proliferation and differentiation by inducing Id3 expression. Biochem. Biophys. Res. Commun., 419, 83–88 (2012).
• 30)  He B, Minges JT, Lee LW, Wilson EM. The FXXLF motif mediates androgen receptor-specific interactions with coregulators. J. Biol. Chem., 277, 10226–10235 (2002).
• 31)  Quigley CA, Tan JA, He B, Zhou ZX, Mebarki F, Morel Y, Forest MG, Chatelain P, Ritzen EM, French FS, Wilson EM. Partial androgen insensitivity with phenotypic variation caused by androgen receptor mutations that disrupt activation function 2 and the NH(2)- and carboxyl-terminal interaction. Mech. Ageing Dev., 125, 683–695 (2004).
• 32)  Langley E, Kemppainen JA, Wilson EM. Intermolecular NH2-/carboxyl-terminal interactions in androgen receptor dimerization revealed by mutations that cause androgen insensitivity. J. Biol. Chem., 273, 92–101 (1998).
• 33)  Thompson J, Saatcioglu F, Janne OA, Palvimo JJ. Disrupted amino- and carboxyl-terminal interactions of the androgen receptor are linked to androgen insensitivity. Mol. Endocrinol., 15, 923–935 (2001).
• 34)  Furuya K, Yamamoto N, Ohyabu Y, Morikyu T, Ishige H, Albers M, Endo Y. Mechanism of the tissue-specific action of the selective androgen receptor modulator S-101479. Biol. Pharm. Bull., 36, 442–451 (2013).