The Coumarin Derivative Osthole Stimulates Adult Neural Stem Cells, Promotes Neurogenesis in the Hippocampus, and Ameliorates Cognitive Impairment in APP/PS1 Transgenic Mice

Abstract

It is believed that neuronal death caused by abnormal deposition of amyloid-beta peptide is the major cause of the cognitive decline in Alzheimer’s disease. Adult neurogenesis plays a key role in the rescue of impaired neurons and amelioration of cognitive impairment. In the present study, we demonstrated that osthole, a natural coumarin derivative, was capable of promoting neuronal stem cell (NSC) survival and inducing NSC proliferation in vitro. In osthole-treated APP/PS1 transgenic mice, a significant improvement in learning and memory function was seen, which was associated with a significant increase in the number of new neurons (Ki67⁺/NF-M⁺) and a decrease in apoptotic cells in the hippocampal region of the brain. These observations suggested that osthole promoted NSC proliferation, supported neurogenesis, and thus efficiently rescued impaired neurons in the hippocampus and ameliorated cognitive impairment. We also found that osthole treatment activated the Notch pathway and upregulated the expression of self-renewal genes Notch 1 and Hes 1 mRNA in NSCs. However, when Notch activity was blocked by the γ-secretase inhibitor DAPT, the augmentation of Notch 1 and Hes 1 protein was ameliorated, and the proliferation-inducing effect of osthole was abolished, suggesting that the effects of osthole are at least in part mediated by activation of the Notch pathway.

Alzheimer’s disease (AD) is an irreversible neurodegenerative disorder characterized by deterioration of synapses and neurons in the brain which are critical for learning and memory.^1,2) The abnormal deposition of amyloid-beta (Aβ) peptide is one of the most notable neuropathological hallmarks of AD. The loss of synaptic connections and the subsequent neuronal death induced by Aβ is believed to be the main cause for cognitive decline in AD.^3,4) Neural stem cells (NSCs) are regarded as a promising source of donor cells in transplantation-based therapies for neurodegenerative disorders, which possess the capacity of self-renewal and production of a large number of newly generated cells that can differentiate into different neural cell types.^5–7) However, poor survival and limited neuronal differentiation of the transplanted NSCs in central nervous system (CNS) remain critical limitations for developing therapeutic strategies.^7,8) The adult CNS, especially the injured CNS, may provide a relatively non-permissive environment for engrafted NSCs.^{7, 9–11)} Even under the best circumstances, the cell survival in injured CNS has been estimated to be near 10%,^12,13) and few cells differentiate into mature neuronal phenotypes.^14,15) One of the most important reasons why those cells could not survive in the injured CNS is probably due to the sustained inflammation and oxidation in the disease areas.^7,16) Therefore, developing a strategy targeted to improve the CNS environment and stimulate endogenous NSCs and promote neurogenesis is a vital goal for NSCs based therapies in neurological disorders.

The adult mammalian brain has long been regarded as an organ that is devoid of intrinsic repair capacity after injury.¹⁷⁾ Such a view, however, is now abandoned as studies have clearly demonstrated that de novo generation of neurons in adult CNS does occur,^18,19) and that self-repair via endogenous neurogenesis in response to CNS injury and disease is induced.^20,21) Stimulation of self-repair processes by manipulating endogenous precursor cell behaviors may be an ideal therapeutic approach for the functional recovery of damaged brains. However, this is impossible and will not likely be achievable until the critical self-repair mechanisms are clearly understood.

It has been shown that Notch signaling plays an important role in regulating biological characteristics of NSCs and promoting neurogenesis in both embryonic and adult brains.²²⁾ Activation of Notch pathway leads to maintenance of the neural stem cell population; whereas inactivation of Notch signaling induces neuronal differentiation and depletes the neural stem cell population^23–25); as a result, although neurogenesis was increased transiently, neural stem cells were depleted, and eventually neurogenesis was completely lost.²²⁾ These findings suggest an absolute requirement for Notch signaling for maintenance of neural stem cells in developing and adult brains.

There are two types of basic helix-loop-helix (bHLH) transcription factors which play a key role in Notch pathway, the repressor-type genes Hes1, Hes3 and Hes5, and the activator-type genes Mash1, Math and Neurogenin (Ngn). Induction of Hes genes expression regulates maintenance of neural stem cells while products of Mash1, Math and Ngn promote neuronal differentiation. Upon activation of Notch by its ligands (e.g., Delta1), the expression of repressor-type genes Hes is induced, which repress proneural gene expression and thereby inhibit neuronal differentiation.²⁶⁾

Various factors,²⁷⁾ including insulin-like growth factor-1,²⁸⁾ and the active compounds in Chinese Medicine^29,30) can regulate the biological features of NSCs and affect neurogenesis. In search for new therapeutic drugs for neurodegenerative diseases, herbs used in traditional medicines for neurogenesis are promising candidates. Salvianolic Acid B, for example, maintains self-renewal of NSCs and attenuates cognitive damage after experimental stroke in rats.³¹⁾ Additionally, with biological activity of enhancing plasticity and repair, the effect of curcumin stimulating developmental neurogenesis in hippocampus has been proved.³²⁾

Osthole (Ost) (7-methoxy-8-isopentenoxycoumarin, C₁₅H₁₆O₃, 244.39 Da; Fig. 1) is one of the predominant natural coumarin derivative isolated from many medicinal plants such as Angelicae Pubescentis Radix, which has activities relevant to many pathological events of AD, including anti-apoptosis, anti-oxidative stress, anti-inflammation and neurotrophic effects.³³⁾ Our previous studies have demonstrated that Ost possessed the ability to protect cortical neurons and SH-SY5Y cells against Aβ injury in vitro, improved survival environment for engrafted NSCs and promoted remyelination and axonal growth, thus attenuated clinical severity in EAE mice.³⁴⁾

Fig. 1. The Chemical Structure of the Coumarin-Derivative Ost

Based on the known activities of Ost, we hypothesized that Ost might be a potential drug for improving CNS environment, stimulating adult NSCs proliferation and promoting neurogenesis, thus facilitating structural and functional reconstruction of damaged neural tissues in AD. In the present study, we generated NSCs firstly and assessed the effects of Ost on survival and proliferation of the NSCs in vitro, then investigated its impact on hippocampal neurogenesis and hippocampus-dependent cognitive functions in APP/PS1 double transgenic (Tg) mice.

MATERIALS AND METHODS

Preparation of Ost

Ost (C₁₅H₁₆O₃, 244.39 Da, >98% purity; Fig. 1) was purchased from the National Institute for the Control of Pharmaceutical and Biological products (No. 110822-200305; Beijing, China), dissolved in 0.05% carboxymethyl cellulose sodium (CMC-Na) and stored at 4°C.^34–36)

Generation and Characterization of Adult NSCs

Adult NSCs were isolated and expanded from the SVZ region of adult naïve C57BL/6 mice and cultured in NSC proliferation media as described in our laboratory.⁷⁾ Briefly, C57BL/6 mice at 4–6 weeks of age were euthanized; the SVZ regions of the fresh brain were harvested and cut into 1 mm³ pieces, then suspended in 2 mL 0.25% Trypsin with ethylenediaminetetraacetic acid (EDTA) (Invitrogen), mechanically dissociated for 2 min and incubated at 37°C for 30 min. After filtration through a 70 µm cell strainer (BD Falcon), the cell suspension was washed twice and resuspended in serum-free Dulbecco’s modified Eagle’s medium (DMEM)/F-12 (Gibco, Grand Island, U.S.A.) supplied with 2% B27 (Gibco), 20 ng/mL epidermal growth factor (EGF, Peprotech, Rocky Hill, NJ, U.S.A.) and 20 ng/mL basic fibroblast growth factor (b-FGF, Peprotech), along with 100 IU/mL penicillin and 100 µg/mL Streptomycin (Sigma). Cells were then transferred to poly-L-lysine coated 6-well plates (BD Bioscience, San Jose, CA, U.S.A.) at a density of 0.25×10⁶ cells/mL and maintained in culture at 37°C. Neurospheres were formed after 3–5 d of culture. For passaging, free-floating neurospheres were collected and mechanically dissociated into small neurospheres or single cells and re-seeded at a density of 0.5×10⁵ cells/mL in the same medium. NSCs at passage 4–10 were used in the following experiments. The expression of neural specific marker nestin and Sox2 was determined by immunocytochemistry staining.

To determine neural differentiation potential of NSCs, dissociated single NSCs at 5th passage were plated on chamber slides at a density of 1.0× 10⁵/mL, and cultured in stem cell differentiation medium (NeuroCults NSC Basal Medium plus 10% NeuroCults NSC Differentiation Supplements, Stem cell Technologies). Differentiation of NSCs was induced by withdrawing the mitogen bFGF from the media. After 7–14 d of culture, NSCs changed morphology and developed markers of neurons, astrocytes and oligodendroglia as verified by immunocytochemistry staining.^7,10)

Cell Viability and Proliferation Assays

Single NSCs at 5th passage were seeded at 5.0×10⁴ cells/mL in proliferation media and exposed to various concentrations of Ost (0, 10, 50, and 100 µM) (34–36). After 3 d of co-culture, cell viability was determined by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) (Sigma) assay as previously described.⁸⁾ Briefly, NSCs were incubated with 0.5 mg/mL MTT (Invitrogen) at 37°C for 4 h following treatment with Ost, then media was removed and 100 µL of dimethyl sulfoxide (DMSO) was added to dissolve the formed formazan product. The amount of MTT formazan product was determined by measuring optical density (OD) value with a microplate reader (Thermo Fisher Scientific Inc., U.S.A.) at 580 nm. Each measurement was performed in triplicate and repeated at least once. The intensity of the product color is directly proportional to the number of viable cells in a given culture. Cell proliferation potential was determined by measurement of neurospheres diameters at days 3, 5, and 7, respectively after seeding using the ImageJ software (NIH; Bethesda, MD, U.S.A.).³⁷⁾ The self-renewal capacity of NSCs was further determined using immunofluorescence staining for proliferation marker Ki67^38–40) after 3 d incubation with Ost. Briefly, neurospheres were dissociated into single cells and plated onto the poly-L-lysine coated chamber slides at a density of 1.0×10⁵/mL in proliferation medium, immunostaining was then performed with anti-Ki67 and anti-Nestin antibodies 24 h post incubation. Cells triple positive to Ki67⁺/nestin⁺/4′,6-diamidino-2-phenylindole (DAPI)⁺ were identified as proliferated NSCs.

Immunofluorescence Labeling

Mice were anesthetized and transcardially perfused with 4% paraformaldehyde in cold phosphate buffered saline (PBS), the brains were immediately harvested, and snap-frozen in cold isopentane on dry ice and stored at −80°C until sectioning. Seven micrometers frozen sections were prepared using a cryostat microtome (Leica, Nussloch, Germany).^7,10) Cryosections of the brain and NSCs maintained in growth medium or differentiation medium in vitro were fixed with 4% paraformaldyhyde plus 0.5% glutaraldehyde for 15 min, then washed twice with PBS. Sections were incubated with 10% goat serum in PBS for 30 min, after which primary antibodies were added and incubated at 4°C overnight. The following primary antibodies were used: anti-Ki67 (1 : 100, Millipore), anti-Nestin (1 : 150, Millipore), anti-Sox2 (1 : 200, Invitrogen), anti-NeuN (1 : 150, Stem Cell Technologies), anti-glial fibrillary acidic protein (GFAP) (1 : 150, Stem-Cell Technologies), anti-NF-M (1 : 150, Stem-Cell Technologies), anti-cleaved Caspase 3 (1 : 200, Invitrogen) and anti-NG2 (1 : 200, Chemicon). Primary antibodies were washed out with PBS three times after overnight incubation. Sections were then incubated with fluorescein isothiocyanate (FITC)- or Cy3-conjugated species-specific secondary antibodies (all from Jackson ImmunoResearch Lab, West Grove, PA, U.S.A. at 1 : 200 dilution) for 60 min at room temperature, followed by washing with PBS three times. Immunofluorescence controls were routinely performed with incubations in which primary antibodies were not included. Slides were covered with mounting medium (Vector Laboratories, Burlingame, CA, U.S.A.) and viewed using an inverted fluorescence microscope (Nikon Eclipse E600). ImageJ software was used for quantitative analysis of fluorescence images.^7,10)

Reverse Transcription-Polymerase Chain Reaction (RT-PCR)

NSCs treated with Ost in proliferation medium for 3 d were collected, and total RNA was extracted with TriZol and converted to cDNA by reverse transcriptase using a RevertAid™ First Strand cDNA Synthesis Kit (Thermo, Vilnius, Lithuania).⁴¹⁾ The PCR reaction was for 35 cycles using a DreamTaq™ Green PCR Master Mix Kit (Thermo). β-Actin served as the control. RT-PCR products were resolved in 1.5% agarose gels stained with ethidium bromide. OD analysis was performed using ImageJ. The RT-PCR primers used in this study were as described in Table 1.

Table 1. Mouse Primers for RT-PCR

Genes	Sense (5´→3´)	Anti-sense (5´→3´)
Notch 1	TCGTGTGTCAAGCTGATGAGGA	GTTCGGCAGCTACAGGTCACAA
Hes 1	GCAGACATTCTGGAAATGACTGTGA	GAGTGCGCACCTCGGTGTTTA
Mash1	AAGAGCTGCTGGACTTTACCAACTG	ATTTGACGTCGTTGGCGAGA
β-Actin	GGGAAATCGTGCGTGACCT	TCAGGAGGAGCAATGATCCTG

Real-Time Polymerase Chain Reaction

Real-time PCR was performed on an ABI 7500 Real-Time PCR System (Applied Biosystems). Amplification reaction mixture (20 µL) contained 2 µL of diluted cDNA, 0.4 µL of forward and reverse primers, 10 µL of TransStart Top Green qPCR SuperMix, 0.4 µL of Passive Reference Dye, and 6.8 µL of RNase-free water. All reactions/negative controls were performed in triplicate reactions using TransStart Top Green qPCR SuperMix (TransGen Biotech, Beijing, China). The PCR conditions were as follows: denaturation at 94°C for 30 s, annealing at 94°C for 5 s and extension at 60°C for 30 s, total 45 cycles. The results were expressed as Ct values.⁴²⁾ Relative changes in gene expression were determined using ΔΔCt method, and β-actin was used as the internal control.^43,44)

Western Blotting Analysis

Samples were prepared from NSCs after Ost treatment for 3 d, or from brain hippocampus of the mice treated with Ost for 6 weeks. The Western blotting was performed as previously described.⁴⁵⁾ Briefly, Protein was extracted with a ReadyPrep protein extraction kit according to the manufacturer’s instructions (R&D, Emeryville, CA, U.S.A.). An equal amount of protein was fractionated by 8% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred onto polyvinylidene difluoride (PVDF) membranes. After blocking with 5% bovine serum albumin (BSA) in TBST, the membrane was probed with mouse anti-β-actin (1 : 2000, Santa Cruz), mouse anti-Aβ (1: 1500, Abcam), goat anti-Notch 1 and anti-Hes 1 (1 : 1000, Santa Cruz) primary antibodies in a blocking solution of nonfat milk (5%). Secondary horseradish peroxidase (HRP)-conjugated mouse anti-goat and goat anti-mouse antibody in nonfat milk blocking solution (5%) was then applied. The immunoreactivity was visualized with ECL Western blotting detection reagents (Millipore). The total protein content was normalized using mouse anti-actin antibodies.

Ost Treatment of APP_swe/PS1_∆E9 AD Mice

APP/PS1 double Tg mice with a C57BL/6 background overexpressing human mutated APP and PS1 (APP_swe/PS1_∆E9) were purchased from the Model Animal Resource Information Platform (Nanjing, China),^46,47) which could effectively simulate the pathological features of AD patients. The Tg mice were housed under a 12-h light/dark cycle, with food and water freely available. Cognitive impairment first appears in 7-month-old Tg mice, and Aβ deposits in the hippocampus and cortex could be detected in 10-month-old Tg mice.^48,49) In the present study, Tg mice at age of 9 months were used and randomly divided into two groups: an Ost-treated group (Tg+Ost), were intragastrically (i.g.) treated with Ost (20 mg/kg, dissolved in 0.05%CMC-Na) daily for 6 weeks; an control group (Tg), were given 0.05% CMC-Na i.g. daily for 6 weeks. Wild-type (WT) C57BL/6 mice at the same age served as controls. n=15 for each group. All experimental procedures were performed in accordance with the guidelines of the Institutional Animal Care and Committee of Liaoning University of Traditional Chinese Medicine (TCM).

Morris Water Maze Test

After 6 weeks treatment with Ost, Morris water maze (Chengdu TME Technology Co., Ltd., Chengdu, China) was used to evaluate learning and memory capacity of the mice following methods previously described.^47,49,50) The apparatus consisted of a circular pool (120 cm diameter ×60 cm height) with a black inner wall, which was subdivided into four equal quadrants and filled with water (25°C) to the depth of 30 cm. An escape platform (10 cm diameter) was placed in one of the quadrants (the target quadrant) and submerged approximately 2 cm below the surface of the water. The test contained a platform trial that measured the animal’s spatial acquisition ability and a spatial probe test that assessed memory. All the data, including the swim path and the swim time, were measured by a camera and automated analyzing system.

Acquisition Phase

Mice were released into the water facing the wall of the pool. Four points equally spaced along the circumference of the pool (North, South, East, West) served as the starting position respectively. If animals were unable to reach the platform in 120 s, they were guided to the platform where it had to remain for 30 s, before being returned to its home cage. Two training trails per day were conducted for four consecutive days, with an intertribal interval of 15 min to adapt the mice to the environment. The training adaptation phase was followed by formal experiments for 5 d. The path length and escape latencies were recorded by camera.

Probe Trial

After a 24 h delay, the probe trial was performed. The fixed platform was removed and the animals were allowed to freely swim for 120 s. Spatial learning was expressed as the latency of time spent on finding the escape platform. The swimming path and the time spent of crossing the platform were recorded by camera.

Cell Counts and Statistical Analysis

To determine the number of cultured cells expressing specific antigen, five random visual areas of each chamber slide were taken, and a total of 6 chamber slides from 3 experiments were assessed. To account the specific neural cells in the brain section, six non-adjacent brain sections from each mouse were assessed, five digital photographs were taken in random areas of the brain hippocampus from each section, 6 mice per group were evaluated.³⁴⁾ The proportion of cells labeling with specific neural marker (as determined by immunostaining) in total number of DAPI⁺ cells was expressed as the mean percentage of the specific neural cells. Cell counter of ImageJ software (National Institutes of Health, Bethesda, MD, U.S.A.) was used to count the cells.^7,10)

Statistical analyses were performed using SPSS 13.0 software (SPSS, Chicago, IL, U.S.A.). All data are expressed as mean±standard deviation (S.D.) of at least three independent experiments. Differences between multiple groups were evaluated by the Kruskal–Wallis one-way ANOVA. Experiments with two groups were tested for statistical significance using unpaired, two-tailed, Student’s t-tests. The level of significance was set at a p<0.05.

RESULTS

Ost Enhanced Survival and Proliferation of Cultured NSCs in Vitro

We firstly established NSCs culture derived from the SVZ and hippocampus region of adult C57BL/6 mice. After 5–7 d in culture, individual neural stem cells proliferated to form distinct neurospheres containing 20–200 NSCs. All of the neurospheres tested were capable of secondary expansion. NSCs at passage 4–10 were used in the study because the cells can be maintained in vitro for extended periods of time without losing their proliferation or differentiation potential,⁹⁾ and the NSCs at 3rd to 15th passage have equivalent ability of both self-renewal and multipotency in differentiation.^7,10) Figure 2A showed a typical neurosphere at 5th passage, which co-expressed high level of nestin and Sox2 as determined by immunostaining, indicating the neural precursor nature of the cells. NSCs differentiation was induced by culture in differentiation medium withdrawing mitogen b-FGF and EGF from the medium. After 10 d in culture, dissociated single NSCs changed their morphology and developed into three primary CNS phenotypes, neurons (NeuN⁺, 13.59%), astrocytes (GFAP⁺, 38.56%), and oligodendrocyte precursors (NG2⁺, 9.29%), whereas a fraction of the NSCs (20.83%) remained undifferentiated with nestin⁺ (Figs. 2B, C), indicating the neural differentiation potential of the NSCs.

Fig. 2. Generation and Characterization of NSCs in Vitro

NSCs were isolated from the SVZ region of adult C57BL/6 mice and expanded in DMEM/F-12 supplied with 20 ng/mL EGF, 20 ng/mL b-FGF and 2% B27 supplements. (A) A typical neurosphere at 5th passage was immunostained with antibodies against nestin and Sox2. (B) Differentiation of NSCs in vitro. To induce NSCs differentiation, neurospheres were dissociated into single cells and maintained in differentiation medium withdrawing b-FGF and EGF. After 10 d of culture, NSCs differentiated into NeuN⁺ neurons, NG2⁺ oligodendrocyte precursors and GFAP⁺ astrocytes, a fraction of the NSCs remained undifferentiated with nestin⁺ as verified by immunostaining. (C) Quantitative analysis of percentages of NSCs differentiated into each type of neural cells among total number of NSCs (DAPI⁺). Nuclei were stained with DAPI. Data represent the mean of three independent experiments. Magnification ×10 for A, ×40 for B.

To determine the proliferation-inducing effect of Ost on NSCs in detail, single NSCs at 5th passage were treated with increasing concentrations of Ost in growth medium for different durations. The cell viability was determined using MTT assay at day 3 after seeding. The proliferation potential was assessed by immunofluorescence staining for proliferation marker Ki67 at day 3 and by measurement of neurosphere diameters at days 3, 5, and 7, respectively. As shown in Figs. 3A, B, treatment with Ost (10, 50 and 100 µM) promoted the formation and increased the number and size of neurospheres in a dose-dependent manner. The diameters of neurospheres treated with 50 or 100 µM Ost were obviously larger than those in control-NSCs (Fig. 3B, p<0.05, p<0.01). In addition, significant increases in both cell viability (Fig. 3C) and percentages of Ki67-positive cells were observed in Ost-treated groups (Figs. 3C, D). Treatment with 100 µM Ost for 3 d led to a 38.9% of Ki67-positive cells compared to 23.1% in control (Fig. 3D, p<0.05), and a 1.3 fold increase in cell viability compared to control (Fig. 3C, p<0.01). These indices confirmed that Ost promoted the NSCs survival and induced the cells proliferation.

Fig. 3. The Promotive Effect of Ost on NSCs Survival and Proliferation in Vitro

Dissociated NSCs were cultured with Ost (0, 10, 50, and 100 µM) for 3 to 7 d. (A) Microphotographs of neurospheres exposed to Ost (0, 100 µM) for 5 d. (B) Neurosphere diameters measured by ImageJ software at days 3, 5, and 7, respectively. (C) Quantification of percentage of Ki67⁺/nestin⁺/DAPI⁺ cells among total number of NSCs (nestin⁺/DAPI⁺) as verified by immunofluorescence staining. (D) Cell viability determined by MTT assay at day 3 of culture. Magnification ×10 for A. * p<0.05, ** p<0.01 vs. control. Values are expressed as mean±S.D. and represent three independent experiments.

Ost Up-Regulated the Expression of Self-renewal Genes in NSCs

To investigate the molecular mechanism of Ost on NSCs proliferation, RT- and real-time PCR were used to analyse Notch1, Hes 1 and Mash 1 mRNA expression. It is known that Notch activity is required for maintenance of stem cell character.⁵¹⁾ Activation of Notch signaling induces the expression of transcriptional repressor genes such as Hes 1 and Hes 5, leading to repression of proneural gene expression and maintenance of neural stem/progenitor cells population.²²⁾ Results of RT-PCR in the present study (Figs. 4A, B) indicated that Ost exposure for 3 d increased the expression of Notch 1 and Hes 1 mRNA (0.983 Notch 1 and 0.897 Hes 1 in 100 µM Ost-treated NSCs vs. 0.451 Notch 1 and 0.282 Hes 1 in control-NSCs, p<0.001), while did not affect Mash 1 mRNA. The finding was further confirmed by quantitative analysis of real-time PCR (Fig. 4C). The results suggested that Ost activated Notch pathway and up-regulated the expression of self-renewal genes in NSCs, which were consistent with the self-renewal maintaining and proliferation-inducing effect of Ost on the NSCs.

Fig. 4. Ost Up-Regulated the Expression of Self-renewal Genes of NSCs

NSCs were cultured with Ost (0, 10, 50, and 100 µM) for 3 d. (A) The mRNA levels of Notch 1, Hes 1 and Mash 1 were analyzed by RT-PCR. (B) The mRNA expression was semi-quantified by ImageJ, normalized with β-actin internal control. (C) The mRNA expression was quantitative analysed by real-time PCR. Relative changes in gene expression were determined using ΔΔCt method, and β-actin was used as the internal control. * p<0.05, ** p<0.01, *** p<0.001 vs. control. Values are expressed as mean±S.D. and represent three independent experiments.

Ost Promoted NSCs Proliferation in a Notch Signaling- Dependent Way

We next investigated whether or not the promotion of NSCs proliferation induced by Ost is dependent on activation of Notch signaling, the γ-secretase inhibitor N-[N-(3,5-difluorophenacetyl)-l-alanyl]-S-phenylglycine-t-butyl ester (DAPT) was used to block the pathway. NSCs were maintained in the presence or absence of Ost (100 µM) and DAPT (10 µM) for 3 d.⁵²⁾ The proliferative response of Ost/inhibitor was studied using cell proliferation assays. Results showed that Ost treatment increased the cell survival and the percentage of Ki67-positive cells obviously as compared with control-NSCs (Figs. 5A, B, p<0.001). Inhibition of Notch activity by DAPT significantly depressed the cell viability and reduced the percentage of Ki67-positive cells, the proliferation-inducing effect of Ost on NSCs was abolished by the Notch inhibitor DAPT (Figs. 5A, B, p<0.001).

Fig. 5. The Proliferation-Inducing Activity of Ost Is Mediated by Activation of Notch Signaling

NSCs were maintained in the presence or absence of Ost (100 µM) and DAPT (10 µM) for 3 d. The proliferative response was studied using cell proliferation assays. (A) MTT assay; (B) Quantification of percentage of Ki67⁺ cells among total number of NSCs. (C) Protein levels of Notch 1 and Hes 1 in the NSCs detected by Western blotting; (D) Quantification of proteins expression using image J, and normalized with β-actin internal control. * p<0.05, ** p<0.01, *** p<0.001 vs. control; ^### p<0.001 vs. Ost-control. Values are expressed as mean±S.D. and represent three independent experiments.

To further investigate the protein level of Notch 1 and Hes 1 in Ost and DAPT treated cultures, Western blotting was used at day 3 post treatment. Results indicated that Ost exposure increased the protein levels of Notch 1 and Hes 1 in NSCs compared to control-NSCs. While the augmented protein expression of Notch 1 and Hes 1 induced by Ost were relieved by DAPT-treatment (Figs. 5C, D, p<0.001). These observations confirmed that the effects of Ost on promoting NSCs survival and inducing the cells proliferation were mediated by activation of Notch signaling pathway.

Ost Promoted Neurogenesis in APP/PS1 Double Tg Mice

In the following study, we detected the NSCs self-renewal and neurogensis in hippocampal region of the brain of Tg mice after Ost treatment (20 mg/kg daily for 6 weeks). Seven micrometer brain sections were immunostained with antibodies against proliferation marker Ki67, neuronal marker NF-M and apoptotic cell marker Caspase 3. The Ki67 protein is a cellular marker for proliferation.⁵³⁾ It is strictly associated with and may be necessary for cellular proliferation. The protein is present during all active phases of the cell cycle (G1, S, G2, and mitosis), but is absent from resting cells (G0), thus is widely used as an excellent marker to determine the growth fraction of a given cell population.^38–40) Results showed that dividing cells double labeled with Ki67 and NF-M, which were identified as newly formed neurons, were visualized in the dentate gyrus (DG) regions of hippocampus of both wild-type and APP/PS1 Tg mice (Fig. 6A). The number of newborn neurons (Ki67⁺ /NF-M⁺) in Tg mice was reduced as compared to WT control (2.45/mm² in Tg mice vs. 9.88/mm² in WT control, p<0.001, Fig. 6E), a significant increase was observed in Ost-treated Tg mice (8.03/mm², vs. Tg control, p<0.001, Fig. 6E); Additionally, increases in the number of apoptotic cells as well as Aβ production in hippocampus were observed in Tg mice as compared to WT control, while Ost-treatment reduced the number of apoptotic cells and lowered the level of Aβ significantly (p<0.01 or 0.001, Figs. 6B, C, D, F). The results suggested that Ost exposure could enhance the ability of NSCs proliferation in vivo and promote regeneration of newborn neurons, and also inhibited apoptosis and reduced Aβ production in hippocampus, thus efficiently supported neurogenesis and rescued impaired neurons in hippocampus of Tg mice, which is consistent with our in vitro findings and our previous report.⁵⁴⁾

Fig. 6. Ost Increased the Number of Newborn Neurons and Decreased the Number of Apoptotic Cells as Well as Aβ Production in Hippocampus

Tg mice were treated with Ost (20 mg/kg daily) for 6 weeks, brain sections of the mice were immunostained with anti-cleaved caspase 3, and double-immunostained with anti-Ki67 and anti-NF-M antibodies. Nuclei were stained with DAPI. Western blotting analysis was also performed with the hippocampus. (A) Representative photomicrographs of brain hippocampus (DG) of the mice in three groups. Cells triple labelled with NF-M, Ki67 and DAPI were identified as newborn neurons (arrows indicated). (B) Caspase 3 staining for apoptotic cells in the hippocampus (CA3). (C) Protein expression of Aβ, Notch 1 and Hes 1 in the hippocampus detected by Western blotting; (D) Quantification of protein levels using imageJ, and normalized with β-actin. (E) Quantification of new generated neurons in DG regions of hippocampus as showed in A. (F) Quantification of apoptotic cells in CA3 regions of hippocampus as showed in B. Magnification ×40 in A and B. Values are expressed as mean±S.D. (n=6). * p<0.05, ** p<0.01, *** p<0.001 vs. WT control; ^# p<0.05, ^## p<0.01, ^### p<0.001 vs. Tg control.

Ost Ameliorated Cognitive Impairment in APP/PS1 Double Tg Mice

Since Ost promote NSCs proliferation both in vitro and in vivo, we next sought to correlate the regeneration of new neurons and recovery of brain functions. To investigate the effects of Ost on cognitive function of Tg mice, hippocampus-dependent learning and memory was analyzed using Morris water maze test after a six-week treatment with Ost.^49,50) Spatial learning was expressed as the latency of time spent on finding the escape platform in the water maze.⁴⁷⁾ Significant differences among the three groups were observed (Figs. 7A, B). The Tg mice showed significantly longer escape latency than that of the WT control (78.2 s in Tg group vs. 38.6 s in WT control at day 5, p<0.01, Fig. 7B), while Ost treatment reduced the latency significantly (46.4 s in Tg+Ost group vs. 78.2 s in Tg control at day 5, p<0.01, Fig. 7B), indicating a better cognitive performance in Tg+Ost group.

Fig. 7. Effects of Ost on Cognitive Function of Tg Mice

Morris water maze was used to evaluate learning and memory function of the mice after a 6-week treatment with Ost. (A) Representative individual swim paths in the water maze trial (at day 5). (B) Escape latency in the formal experiments of water maze task. (C) The number of plat form crossings. (D) Percentage of time spent in the target quadrant. ** p<0.01vs. WT control. ^# p<0.05, ^## p<0.01 vs. Tg group. Values are expressed as mean±S.D. (n=9).

The probe trial was performed to measure the maintenance of memory function after a 24 h delay.⁴⁴⁾ The number of platform crossings was notably reduced in Tg mice compared to WT control, while significantly improved in Tg+Ost group (8.4 in Tg+Ost group vs. 3.4 in Tg control, p<0.05, Fig. 7C). Moreover, treatment with Ost increased the time spent in the target quadrant compared to untreated Tg mice (49.9% in the Tg+Ost group vs. 36.0% in the Tg control, p<0.01, Fig. 7D). Thus, it is reasonable to consider that Ost ameliorated the spatial memory impairment in Tg mice.

Taken together, these results demonstrated that Ost-treatment significantly improved the learning and memory function in APP/PS1 Tg mice, which may be correlated with the regeneration of newborn neurons and inhibition of apoptosis in hippocampus of the brain induced by Ost.

DISCUSSION

It is believed that neuronal death caused by abnormal deposition of Aβ is the main cause of cognitive decline in AD.^3,4) Adult neurogenesis plays a key role in rescue of impaired neurons and amelioration of cognitive impairment in APP/PS1 Tg mice.^55,56) Abundant evidences indicate that progenitor cells in regions of adult mammalian brain such as the dentate gyrus of hippocampus can undergo mitosis and generate new cells that differentiate into functionally integrated neurons throughout life. The incorporation of functional adult-generated neurons into existing neural networks provides a higher capacity for plasticity, which may favor the encoding and storage of certain types of memories.⁵⁷⁾ Although the NSCs would be stimulated to proliferation and differentiation in several pathological conditions, such as neurological diseases, cerebral ischemic in adult brain, often this response is not sufficient to overcome the damage.³¹⁾

Current knowledge of adult hippocampal neurogenesis indicates that the production of new cells in the brain follows a multi-step process during which newborn cells are submitted to various regulatory factors that influence cell proliferation, maturation, fate determination and survival.^22,31) Many studies have demonstrated that environmental and/or behavioral factors can modulate neurogenesis and affect hippocampal-dependent learning and memory. For instance, a marked increase in hippocampal neurogenesis was observed in rats housed in an enriched environment, rather than in isolation environment, and the augmented neurogenesis was associated with improved spatial memory.⁵⁷⁾ Numerous small molecular materials such as growth factors, retinoic acid and TCM active constituent have been well known to possess the ability to regulate the biological characteristics of NSCs and promote neurogenesis.³¹⁾ Salvianolic acid B, for example, could promote NSCs proliferation in a dose dependent manner⁸⁾; Ginsenoside Rb1 and Rg1 improved spatial learning and increase hippocampal synaptophysin level in mice.⁵⁸⁾ Curcumin stimulated adult hippocampal neurogenesis and enhanced neural plasticity and repair.⁵⁹⁾ Therefore, regulation of neurogenesis by NSCs is anticipated as a noble therapeutic strategy for the functional recovery of damaged brains in AD and other neurological disorders.

Ost, a natural coumarin derivative, has taken considerable attention because of its diverse pharmacological functions and is considered to have potential therapeutic applications.^35,60) A volume of interesting studies have revealed the neuroprotective effects of Ost on some experimental models of cerebral ischemia/reperfusion and brain injury via anti-oxidative and anti-inflammatory activities.^33,35,60) Also Ost attenuated clinical severity and CNS inflammation and demyelination of EAE mice by blocking reduction of NGF and suppressed IFN-γ increase.³⁶⁾ In spite of the large volume of known activities of Ost, its effect on adult hippocampal neurogenesis is still remained unknown.³¹⁾ In the present study, we firstly investigated the influences of Ost on survival and proliferation of NSCs in vitro, and then investigated its impact on hippocampal neurogenesis and hippocampus-dependent cognitive functions in APP/PS1 Tg mice. Results showed that Ost promoted NSCs proliferation both in vitro and in vivo. Ost exposure not only promoted the formation and increased the size and number of cultured neurospheres (Figs. 3A, B, p<0.01), but also increased the percentage of Ki67-positive cells as well as the cell viability significantly (Figs. 3C, D, p<0.01), confirming the proliferation-inducing effect of Ost on the NSCs in vitro. Similar results were also obtained in vitro on the NSCs derived from Tg mice (data not shown).

To test the effect of Ost on neurogenesis in vivo and on neurogenesis-dependent memory mechanisms, 9-month-old APP/PS1 double Tg mice were examined, which represents a mouse model for AD pathology with the appearance of classic and well-described symptoms of AD including problems with hippocampal spatial learning and associated memory deficits.^46–48) After a six-week treatment with Ost (20 mg/kg daily), the cognitive impairment of the mice was determined using Morris water maze; at the same time point, brain sections of the mice were immunostained with antibodies against Ki67, NF-M and Caspase-3. Results showed that Ost stimulation significantly ameliorated the learning and memory deficits of AD mice by shortening escape latency and increasing the time spent in the target zone during the probe test (Fig. 7). Additionally, a significant increase in the number of newborn neurons (Ki67⁺/NF-M⁺) and decrease in apoptosis (Caspase-3⁺) in hippocampal region of the brain were observed in the mice of Tg+Ost group compared to Tg-control (Fig. 6). It is known that NSCs proliferation is important to produce of neurogenesis. Compounds that can promote neural stem cell proliferation are seen to support neurogenesis.³¹⁾ These observations suggested that Ost promoted NSCs proliferation and enhanced survival of the newborn neurons, thus efficiently supported neurogenesis, rescued impaired neurons in the hippocampus and ameliorated the spatial learning and memory impairment in the Tg mice, implicating the therapeutic potential of Ost in AD via improving hippocampus-dependent cognitive functions.

Caspases are crucial mediators of programmed cell death (apoptosis). Among them, Caspase-3 is a frequently activated death protease, catalyzing the specific cleavage of many key cellular proteins.⁶¹⁾ Caspase 3 is involved in the cleavage of amyloid-beta precursor protein (APP), which is associated with neuronal death in AD.⁶²⁾ Targeted inhibition of Caspase-3 by Ost may attenuate Aβ-induced apoptosis,^63,64) and may be a new therapeutic for preventing neuronal apoptosis and inhibiting progression of AD.

To gain further insight into the molecular mechanisms of the proliferation-inducing effect of Ost on NSCs, involvement of Notch signaling pathway was evaluated. It is previous known that Notch activity is required for maintenance of stem cell characte,⁵¹⁾ whereas inactivation of Notch signaling induces neuronal differentiation and depletes the neural stem cell population, and eventually neurogenesis was completely lost.^23–25) Results of both RT- and real-time PCR in the present study indicated that Ost exposure activated Notch pathway and up-regulated the expression of self-renewal genes Notch 1 and Hes 1 mRNA (Fig. 4), which were consistent with the self-renewal maintaining and proliferation-inducing effects of Ost on NSCs both in vitro and in vivo.

To further investigate whether or not the promotion of NSCs proliferation by Ost is depended on activation of Notch signaling, DAPT was used to block the Notch pathway. DAPT is a γ-secretase inhibitor and indirectly an inhibitor of Notch signaling.⁵²⁾ It is known that activation of the Notch response is mediated by means of the Notch intracellular domain, which is cleaved away from the full-length receptor in a two-step proteolytic process, one of which is mediated by a presenilin-γ-secretase complex.⁶⁵⁾ This complex is also involved in the generation of the Aβ peptide. DAPT efficiently blocks the presenilin-γ-secretase complex⁶⁶⁾ and, as a consequence, efficiently prevents activation of the Notch response.^67,68) Results in this study showed that blocking of Notch activity by DAPT significantly inhibited the NSCs viability and reduced the percentage of Ki67-positive cells, and the proliferation-inducing effect of Ost on NSCs was abolished by the Notch inhibitor DAPT (Figs. 5A, B). Western blotting results showed that augmented protein expression of Notch 1 and Hes 1 induced by Ost were relieved by DAPT-treatment (Figs. 5C, D). These observations confirmed that the effects of Ost on promoting NSCs survival and inducing the cells proliferation were mediated by activation of Notch signaling pathway. Similar effects were also observed in vitro on the NSCs derived from Tg mice (data not shown).

γ-Secretase is an unusual protease with an intramembrane catalytic site that cleaves many type I membrane proteins, including the Aβ APP and the Notch receptor.^69,70) A central concern about activiating γ-secretase to stimulate Notch signaling by Ost in AD is whether it also causes Aβ production in the brain. In order to clarify this point, we in the present study examed Aβ production in the hippocampus of Tg mice by Western blot, as well as the levels of Noth 1 and Hes 1 proteins. A reduced Aβ level and increased Noth 1 and Hes 1 were observed in Ost-treated Tg mice as compared to untreated-Tg control (Figs. 6C, D). The results are consistent with our in vitro findings (Figs. 5C, D), and our previous study which indicated that Ost reduced intracellular level of Aβ both in neurons and SH-SY5Y cells.⁵⁴⁾ Mechanisms underlying the reduction of Aβ by Ost-treatment still needs to be further investigated. There is increasing evidence that some compounds act directly on a nucleotide-binding site within γ-secretase to selectively block cleavage of APP- but not Notch-based substrates, thus specifically modulate the generation of Aβ while sparing Notch.⁷⁰⁾ We suppose that Ost may target at a binding site within γ-secretase to cleave Notch-1 receptor without affecting APP cleavage, suggested an attractive safety for treating AD.

In addition to γ-secretase inhibitor DAPT, monoclonal antibodies (mAbs) against individual receptors and ligands, as well as miRNAs should be used to selectively block Notch signaling pathways, thus further confirm the relationship between proliferation-inducing effect of Ost and activation of Notch signaling pathway.

In conclusion, this collective evidence clearly demonstrated that Ost was capable of promoting NSCs proliferation and supporting hippocampus neurogenesis, thus efficiently ameliorated the hippocampus-dependent cognitive impairment in APP/PS1 Tg mice. Additionally, we confirmed that the self-renewal maintaining and proliferation-inducing effects of Ost were at least in part mediated by activation of Notch signaling pathway. These findings, together with the known activities of Ost, such as anti-oxidative, anti-inflammatory and neuroprotective effects, suggested that Ost may act as a potential drug in treatment of AD and other neurodegenerative diseases.

Acknowledgments

This work was supported by the National Natural Science Foundation of China (Nos. 81173580 and 81210108050), Natural Science Foundation of Liaoning Province (No. 201102144); Science Foundation of Shenyang City (No. F11-264-1-42).

Conflict of Interest

The authors declare no conflict of interest.

REFERENCES

• 1) Zhongling F, Gang Z, Lei Y. Neural stem cells and Alzheimer’s disease: challenges and hope. Am. J. Alzheimers Dis. Other Demen., 24, 52–57 (2009).
• 2) Marx MJ. J. Neuroscience. New leads on the ‘how’ of Alzheimer’s. Science, 293, 2192–2194 (2001).
• 3) Hardy J, Selkoe DJ. The amyloid hypothesis of Alzheimer’s disease: progress and problems on the road to therapeutics. Science, 297, 353–356 (2002).
• 4) Kayed R, Head E, Thompson JL, McIntire TM, Milton SC, Cotman CW, Glabe CG. Common structure of soluble amyloid oligomers implies common mechanism of pathogenesis. Science, 300, 486–489 (2003).
• 5) Pluchino S, Furlan R, Martino G. Cell-based remyelinating therapies in multiple sclerosis: evidence from experimental studies. Curr. Opin. Neurol., 17, 247–255 (2004).
• 6) Magnus T, Rao MS. Neural stem cells in inflammatory CNS diseases: mechanisms and therapy. J. Cell. Mol. Med., 9, 303–319 (2005).
• 7) Yang J, Jiang Z, Fitzgerald DC, Ma C, Yu S, Li H, Zhao Z, Li Y, Ciric B, Curtis M, Rostami A, Zhang GX. Adult neural stem cells expressing IL-10 confer potent immunomodulation and remyelination in experimental autoimmune encephalitis. J. Clin. Invest., 119, 3678–3691 (2009).
• 8) Zhang N, Kang T, Xia Y, Wen Q, Zhang X, Li H, Hu Y, Hao H, Zhao D, Sun D, Yan Y, Zhang GX, Yang J. Effects of salvianolic acid B on survival, self-renewal and neuronal differentiation of bone marrow derived neural stem cells. Eur. J. Pharmacol., 697, 32–39 (2012).
• 9) Yang J, Rostami A, Zhang GX. Cellular remyelinating therapy in multiple sclerosis. J. Neurol. Sci., 276, 1–5 (2009).
• 10) Yang J, Yan Y, Ciric B, Yu S, Guan Y, Xu H, Rostami A, Zhang GX. Evaluation of bone marrow- and brain-derived neural stem cells in therapy of central nervous system autoimmunity. Am. J. Pathol., 177, 1989–2001 (2010).
• 11) Bi XB, Deng YB, Gan DH, Wang YZ. Salvianolic acid B promotes survival of transplanted mesenchymal stem cells in spinal cord-injured rats. Acta Pharmacol. Sin., 29, 169–176 (2008).
• 12) Vescovi AL, Snyder EY. Establishment and properties of neural stem cell clones: plasticity in vitro and in vivo. Brain Pathol., 9, 569–598 (1999).
• 13) Zompa EA, Cain LD, Everhart AW, Moyer MP, Hulsebosch CE. Transplant therapy: recovery of function after spinal cord injury. J. Neurotrauma, 14, 479–506 (1997).
• 14) Park KI, Liu S, Flax JD, Nissim S, Stieg PE, Snyder EY. Transplantation of neural progenitor and stem cells: developmental insights may suggest new therapies for spinal cord and other CNS dysfunction. J. Neurotrauma, 16, 675–687 (1999).
• 15) Fricker-Gates RA, Winkler C, Kirik D, Rosenblad C, Carpenter MK, Björklund A. EGF infusion stimulates the proliferation and migration of embryonic progenitor cells transplanted in the adult rat striatum. Exp. Neurol., 165, 237–247 (2000).
• 16) Coyne TM, Marcus AJ, Woodbury D, Black IB. Marrow stromal cells transplanted to the adult brain are rejected by an inflammatory response and transfer donor labels to host neurons and glia. Stem Cells, 24, 2483–2492 (2006).
• 17) Yi SH, Jo AY, Park CH, Koh HC, Park RH, Suh-Kim H, Shin I, Lee YS, Kim J, Lee SH. Mash1 and neurogenin 2 enhance survival and differentiation of neural precursor cells after transplantation to rat brains via distinct modes of action. Mol. Ther., 16, 1873–1882 (2008).
• 18) Doetsch F, Caille I, Lim DA, Garcia-Verdugo JM, Alvarez-Buylla A. Subventricular zone astrocytes are neural stem cells in the adult mammalian brain. Cell, 97, 703–716 (1999).
• 19) Johansson CB, Momma S, Clarke DL, Risling M, Lendahl U, Frisen J. Identification of a neural stem cell in the adult mammalian central nervous system. Cell, 96, 25–34 (1999).
• 20) Arvidsson A, Collin T, Kirik D, Kokaia Z, Lindvall O. Neuronal replacement from endogenous precursors in the adult brain after stroke. Nat. Med., 8, 963–970 (2002).
• 21) Magavi SS, Leavit BR, Macklis JD. Induction of neurogenesis in the neocortex of adult mice. Nature, 405, 951–955 (2000).
• 22) Imayoshi I, Sakamoto M, Yamaguchi M, Mori K, Kageyama R. Essential roles of Notch signaling in maintenance of neural stem cells in developing and adult brains. J. Neurosci., 30, 3489–3498 (2010).
• 23) Bertrand N, Castro DS, Guillemot F. Proneural genes and the specification of neural cell types. Nat. Rev. Neurosci., 3, 517–530 (2002).
• 24) Ross SE, Greenberg ME, Stiles CD. Basic helix-loop-helix factors in cortical development. Neuron, 39, 13–25 (2003).
• 25) Kageyama R, Ohtsuka T, Shimojo H, Imayoshi I. Dynamic Notch signaling in neural progenitor cells and a revised view of lateral inhibition. Nat. Neurosci., 11, 1247–1251 (2008).
• 26) Kageyama R, Ohtsuka T, Hatakeyama J, Ohsawa R. Roles of bHLH genes in neural stem cell differentiation. Exp. Cell Res., 306, 343–348 (2005).
• 27) Leker RR, Lasri V, Chernoguz D. Growth factors improve neurogenesis and outcome after focal cerebral ischemia. J. Neural Transm., 116, 1397–1402 (2009).
• 28) Arsenijevic Y, Weiss S. Insulin-like growth factor-I is a differentiation factor for postmitotic CNS stem cell-derived neuronal precursors: distinct actions from those of brain-derived neurotrophic factor. J. Neurosci., 18, 2118–2128 (1998).
• 29) Yabe T, Hirahara H, Harada N, Ito N, Nagai T, Sanagi T, Yamada H. Ferulic acid induces neural progenitor cell proliferation in vitro and in vivo. Neuroscience, 165, 515–524 (2010).
• 30) Heurteaux C, Gandin C, Borsotto M, Widmann C, Brau F, Lhuillier M, Onteniente B, Lazdunski M. Neuroprotective and neuroproliferative activities of NeuroAid (MLC601, MLC901), a Chinese medicine, in vitro and in vivo. Neuropharmacology, 58, 987–1001 (2010).
• 31) Zhuang P, Zhang Y, Cui G, Bian Y, Zhang M, Zhang J, Liu Y, Yang X, Isaiah AO, Lin Y, Jiang Y. Direct stimulation of adult neural stem/progenitor cells in vitro and neurogenesis in vivo by salvianolic acid B. PLoS ONE, 7, e35636 (2012).
• 32) Dong S, Zeng Q, Mitchell ES, Xiu J, Duan Y, Li CX, Tiwari JK, Hu YH, Cao XH, Zhao Z. Curcumin enhances neurogenesis and cognition in aged rats: implications for transcriptional interactions related to growth and synaptic plasticity. PLoS ONE, 7, e31211 (2012).
• 33) Chao X, Zhou J, Chen T, Liu W, Dong W, Qu Y, Jiang X, Ji X, Zhen H, Fei Z. Neuroprotective effect of osthole against acute ischemic stroke on middle cerebral ischemia occlusion in rats. Brain Res., 1363, 206–211 (2010).
• 34) Gao Z, Wen Q, Xia Y, Yang J, Gao P, Zhang N, Li H, Zou S. Osthole augments therapeutic efficiency of neural stem cells-based therapy in experimental autoimmune encephalomyelitis. J. Pharmacol. Sci., 124, 54–65 (2014).
• 35) Chen T, Liu W, Chao X, Qu Y, Zhang L, Luo P, Xie K, Huo J, Fei Z. Neuroprotective effect of osthole against oxygen and glucose deprivation in rat cortical neurons: involvement of mitogen-activated protein kinase pathway. Neuroscience, 183, 203–211 (2011).
• 36) Chen X, Pi R, Zou Y, Liu M, Ma X, Jiang Y, Mao X, Hu X. Attenuation of experimental autoimmune encephalomyelitis in C57BL/6 mice by osthole, a natural coumarin. Eur. J. Pharmacol., 629, 40–46 (2010).
• 37) McLenachan S, Lum MG, Waters MJ, Turnley AM. Growth hormone promotes proliferation of adult neurosphere cultures. Growth Horm. IGF Res., 19, 212–218 (2009).
• 38) Schonk DM, Kuijpers HJ, van Drunen E, van Dalen CH, Geurts van Kessel AH, Verheijen R, Ramaekers FC. Assignment of the gene(s) involved in the expression of the proliferation-related Ki-67 antigen to human chromosome 10. Hum. Genet., 83, 297–299 (1989).
• 39) Bullwinkel J, Baron-Lühr B, Lüdemann A, Wohlenberg C, Gerdes J, Scholzen T. Ki-67 protein is associated with ribosomal RNA transcription in quiescent and proliferating cells. J. Cell. Physiol., 206, 624–635 (2006).
• 40) Rahmanzadeh R, Huttmann G, Gerdes J, Scholzen T. Chromophore-assisted light in activation of pKi-67 leads to inhibition of ribosomal RNA synthesis. Cell Prolif., 40, 422–430 (2007).
• 41) Yang J, Bridges K, Chen KY, Liu AY. Riluzole increases the amount of latent HSF1 for an amplified heat shock response and cytoprotection. PLoS ONE, 3, e2864 (2008).
• 42) Guo Y, Wang P, Sun H, Cai R, Xia W, Wang S. Advanced glycation end product-induced astrocytic differentiation of cultured neurospheres through inhibition of Notch-Hes1 pathway-mdiated neurogenesis. Int. J. Mol. Sci., 15, 157–170 (2013).
• 43) Hu J, Huang X, Hong X, Lu Q, Zhu X. Arsenic trioxide inhibits the proliferation of myeloma cell line through notch signaling pathway. Cancer Cell Int., 13, 25 (2013).
• 44) Johnstone DM, Graham RM, Trinder D, Riveros C, Olynyk JK, Scott RJ, Moscato P, Milward EA. Changes in brain transcripts related to Alzheimer’s disease in a model of HFE hemochromatosis are not consistent with increased Alzheimer’s disease risk. J. Alzheimer’s Dis., 30, 791–803 (2012).
• 45) Zhuang PW, Cui GZ, Zhang YJ, Zhang MX, Guo H, Zhang JB, Lu ZQ, Isaiah AO, Lin YX. Baicalin regulates neuronal fate decision in neural stem/progenitor cells and stimulates hippocampal neurogenesis in adult rats. CNS Neurosci. Ther., 19, 154–162 (2013).
• 46) Jankowsky JL, Fadale DJ, Anderson J, Xu GM, Gonzales V, Jenkins NA, Copeland JN, Lee MK, Younkin LH, Wagner SL, Younkin SG, Borchelt DR. Mutant presenilins specifically elevate the levels of the 42 residue beta-amyloid peptide in vivo: evidence for augmentation of a 42-specific gamma secretase. Hum. Mol. Genet., 13, 159–170 (2004).
• 47) McClean PL, Hölscher C. Liraglutide can reverse memory impairment, synaptic loss and reduce plaque load in aged APP/PS1 mice, a model of Alzheimer’s disease. Neuropharmacology, 76 (Pt. A), 57–67 (2014).
• 48) Yan P, Bero AW, Cirrito JR, Xiao Q, Hu X, Wang Y, Gonzales E, Holtzman DM, Lee JM. Characterizing the appearance and growth of amyloid plaques in APP/PS1 mice. J. Neurosci., 29, 10706–10714 (2009).
• 49) Li X, Guo F, Zhang Q, Huo T, Liu L, Wei H, Xiong L, Wang Q. Electroacupuncture decreases cognitive impairment and promotes neurogenesis in the APP/PS1 transgenic mice. BMC Complement. Altern. Med., 14, 37 (2014).
• 50) Teng Y, Zhang MQ, Wang W, Liu LT, Zhou LM, Miao SK, Wan LH. Compound danshen tablet ameliorated aβ25–35-induced spatial memory impairment in mice via rescuing imbalance between cytokines and neurotrophins. BMC Complement. Altern. Med., 14, 23 (2014).
• 51) Mizutani K, Yoon K, Dang L, Tokunaga A, Gaiano N. Differential Notch signalling distinguishes neural stem cells from intermediate progenitors. Nature, 449, 351–355 (2007).
• 52) Crawford TQ, Roelink H. The notch response inhibitor DAPT enhances neuronal differentiation in embryonic stem cell-derived embryoid bodies independently of sonic hedgehog signaling. Dev. Dyn., 236, 886–892 (2007).
• 53) Scholzen T, Gerdes J. The Ki-67 protein: from the known and the unknown. J. Cell. Physiol., 182, 311–322 (2000).
• 54) Hu Y, Wen Q, Liang W, Kang T, Ren L, Zhang N, Zhao D, Sun D, Yang J. Osthole reverses beta-amyloid peptide cytotoxicity on neural cells by enhancing cyclic amp response element-binding protein phosphorylation. Biol. Pharm. Bull., 36, 1950–1958 (2013).
• 55) Bruel-Jungerman E, Rampon C, Laroche S. Adult hippocampal neurogenesis, synaptic plasticity and memory: facts and hypotheses. Rev. Neurosci., 18, 93–114 (2007).
• 56) Deng W, Aimone JB, Gage FH. New neurons and new memories: how does adult hippocampal neurogenesis affect learning and memory? Nat. Rev. Neurosci., 11, 339–350 (2010).
• 57) Nilsson M, Perfilieva E, Johansson U, Orwar O, Eriksson PS. Enriched environment increases neurogenesis in the adult rat dentate gyrus and improves spatial memory. J. Neurobiol., 39, 569–578 (1999).
• 58) Mook-Jung I, Hong HS, Boo JH, Lee KH, Yun SH, Cheong MY, Joo I, Huh K, Jung MW. Ginsenoside Rb1 and Rg1 improve spatial learning and increase hippocampal synaptophysin level in mice. J. Neurosci. Res., 63, 509–515 (2001).
• 59) Kim SJ, Son TG, Park HR, Park M, Kim MS, Kim HS, Chung HY, Mattson MP, Lee J. Curcumin stimulates proliferation of embryonic neural progenitor cells and neurogenesis in the adult hippocampus. J. Biol. Chem., 283, 14497–14505 (2008).
• 60) Ji HJ, Hu JF, Wang YH, Chen XY, Zhou R, Chen NH. Osthole improves chronic cerebral hypoperfusion induced cognitive deficits and neuronal damage in hippocampus. Eur. J. Pharmacol., 636, 96–101 (2010).
• 61) Fernandes-Alnemri T, Litwack G, Alnemri ES. CPP32, a novel human apoptotic protein with homology to Caenorhabditis elegans cell death protein Ced-3 and mammalian interleukin-1 beta-converting enzyme. J. Biol. Chem., 269, 30761–30764 (1994).
• 62) Aliaghaei A, Digaleh H, Khodagholi F, Ahmadiani A. Encapsulated choroid plexus epithelial cells actively protect against intrahippocampal aβ-induced long-term memory dysfunction; upregulation of effective neurogenesis with the abrogated apoptosis and neuroinflammation. J. Mol. Neurosci., 56, 708–721 (2015), Epub ahead of print.
• 63) Qin Y, Chen Z, Han X, Wu H, Yu Y, Wu J, Liu S, Hou Y. Progesterone attenuates Aβ25–35-induced neuronal toxicity via JNK inactivation and progesterone receptor membrane component 1-dependent inhibition of mitochondrial apoptotic pathway. J. Steroid Biochem. Mol. Biol., (2015), Epub ahead of print.
• 64) Zare N, Motamedi F, Digaleh H, Khodagholi F, Maghsoudi N. Collaboration of geldanamycin-activated P70S6K and Hsp70 against beta-amyloid-induced hippocampal apoptosis: an approach to long-term memory and learning. Cell Stress Chaperones, 20, 309–319 (2015).
• 65) Selkoe D, Kopan R. Notch and Presenilin: regulated intramembrane proteolysis links development and degeneration. Annu. Rev. Neurosci., 26, 565–597 (2003).
• 66) Dovey HF, John V, Anderson JP, Chen LZ, De Saint Andrieu P, Fang LY, Freedman SB, Folmer B, Goldbach E, Holsztynska EJ, Hu KL, Johnson-Wood KL, Kennedy SL, Kholodenko D, Knops JE, Latimer LH, Lee M, Liao Z, Lieberburg IM, Motter RN, Mutter LC, Nietz J, Quinn KP, Sacchi KL, Seubert PA, Shopp GM, Thorsett ED, Tung JS, Wu J, Yang S, Yin CT, Schenk DB, May PC, Altstiel LD, Bender MH, Boggs LN, Britton TC, Clemens JC, Czilli DL, Dieckman-McGinty DK, Droste JJ, Fuson KS, Gitter BD, Hyslop PA, Johnstone EM, Li W-Y, Little SP, Mabry TE, Miller FD, Ni B, Nissen JS, Porter WJ, Potts BD, Reel JK, Stephenson D, Su Y, Shipley LA, Whitesitt CA, Yin T, Audia JE. Functional gamma-secretase inhibitors reduce beta amyloid peptide levels in brain. J. Neurochem., 76, 173–181 (2001).
• 67) Sastre M, Steiner H, Fuchs K, Capell A, Multhaup G, Condron MM, Teplow D, Haass C. Presenilin-dependent gamma-secretase processing of beta amyloid precursor protein at a site corresponding to the S3 cleavage of Notch. EMBO Rep., 2, 835–841 (2001).
• 68) Geling A, Steiner H, Willem M, Bally-Cuif L, Haass C. A gamma-secretase inhibitor blocks Notch signaling in vivo and causes a severe neurogenic phenotype in zebrafish. EMBO Rep., 3, 688–694 (2002).
• 69) Netzer WJ, Dou F, Cai D, Veach D, Jean S, Li Y, Bornmann WG, Clarkson B, Xu H, Greengard P. Gleevec inhibits beta-amyloid production but not Notch cleavage. Proc. Natl. Acad. Sci. U.S.A., 100, 12444–12449 (2003).
• 70) Fraering PC, Ye W, LaVoie MJ, Ostaszewski BL, Selkoe DJ, Wolfe MS. γ-Secretase substrate selectivity can be modulated directly via interaction with a nucleotide-binding site. J. Biol. Chem., 280, 41987–41996 (2005).