A Novel Bongkrekic Acid Analog-Mediated Modulation of the Size of Lipid Droplets: Evidence for the Appearance of Smaller Adipocytes

Abstract

Thiazolidinediones (TZDs) are known as peroxisome proliferator-activated receptor γ (PPARγ) activators, and are used in the treatment of diabetes. Although the usefulness of TZDs has been demonstrated, some of their side effects are becoming an obstacle to their clinical applicability; edema is known to be evoked by the “structural characteristics” of TZD, but not by the PPARγ activation. Thus, novel therapeutic modalities (i.e., non-TZD-type PPARγ activators) having different structures to those of TZDs are desired. We previously identified bongkrekic acid (BKA) as a PPARγ activator using the human breast cancer MCF-7 cell line as a model system. In the present study, we newly synthesized BKA analogs and examined the usefulness of BKA and its analogs as PPARγ activators in differentiated adipocyte cells. Among the chemicals investigated, one of the BKA analogs (BKA-#2) strongly stimulated PPARγ and the differentiation of 3T3-L1 cells similar to pioglitazone, a positive control. Furthermore, BKA-#2 reduced the size of lipid droplets in the mature adipocyte cells. The possible modulation mechanism by BKA-#2 is discussed.

In recent years, the number of patients with diabetes, as well as its mortality rate, has been steadily increasing worldwide. Since diabetes is often concurrent with other lifestyle-related diseases such as obesity and high blood pressure, multiple drug therapy is applied to treat patients.^1,2) Various medications are available for diabetes, such as insulin, biguanide, and thiazolidinedione (TZD) derivatives, and incretin formulations have been developed in recent years. These agents are used in combinations based on the symptoms present.^3–5) Since many types of medicines need to be administered in order to treat diabetes, their effects and safety need to be carefully monitored.

TZD derivatives are peroxisome proliferator-activated receptor γ (PPARγ)-activating agents that have been used for the past 20 years as therapeutic drugs for diabetes.^6,7) PPAR is a type of nuclear receptor that regulates the transcription of various genes through PPAR response element (PPRE) by complexing with retinoid X receptor α (RXRα).⁸⁾ A number of genes involved in energy/lipid metabolism are regulated by PPARγ/RXRα, and complex activation is induced by various ligands that bind to PPARγ.^9–12)

As described above, pioglitazone (PIO), one of the TZD derivatives, functions as an effective therapeutic agent for diabetes through its PPARγ-activating effects.¹¹⁾ However, some of its side effects (e.g., allergic symptoms, heart disease, and edema) may become an obstacle to therapeutic treatments.¹³⁾ Edema has been shown to have the greatest influence compared with the other side effects, and results in the cessation of PIO; enhanced fluid retention due to the hyperactivity of Na⁺-HCO₃⁻ co-transporters expressed in the kidneys has been suggested as a mechanism responsible for edema, and the hyperactivity is not due to the PPARγ activation of PIO but the structural characteristics of PIO.^14,15) Therefore, the development of novel therapeutic agents with different structures to that of PIO are desired in order to avoid the side effects induced by TZD-type PPARγ activators.

Bongkrekic acid (BKA) was isolated from Pseudomonas cocovenenans by van Veen and Mertens, and has been identified as an inhibitor of the mitochondrial ADP/ATP translocator.¹⁶⁾

BKA is currently used in studies on cell death; its other biological activities have not yet been elucidated in detail.^17,18) Although BKA may be obtained from natural sources, its yield is very low, and commercially available BKA is generally very expensive with low purity; therefore, difficulties are associated with performing additional biological tests. We recently established a total synthesis method for BKA with high purity (>98%).¹⁹⁾ We also reported that chemically synthesized BKA promoted PPARγ transcriptional activity in MCF-7 breast cancer cells.²⁰⁾ We herein investigated whether BKA, together with its analogs newly synthesized in this study (Fig. 1), stimulates PPARγ in pre-adipocyte 3T3-L1 cells. We identified one BKA analog (i.e., BKA-#2) (Fig. 1) that strongly induced differentiation of preadipocyte and reduction of lipid droplets in mature adipocyte.

Fig. 1. Chemical Structures of Tested Compounds

The structures of the tested compounds: BKA, BKA analogs (BKA-#1 to -#9), and pioglitazone (PIO).

MATERIALS AND METHODS

Reagents

BKA and nine BKA analogs (BKA-#1 to BKA-#9) (Fig. 1) were synthesized using established methods.^19,21) The purities of these compounds were found to be >98% by HPLC or column chromatography. PIO and dexamethazone (DEX) were purchased from Wako Pure Chemical Industries, Ltd. (Osaka, Japan) (purity: 98%, HPLC). Isobutylmethylxanthine (IBMX) (purity >99%, HPLC) and insulin (from bovine pancreas, ≥25 USP units/mg) were purchased from Sigma-Aldrich (St. Louis, MO, U.S.A.).

Cell Cultures

Mouse embryonic fibroblast 3T3-L1 cells were obtained from the American Type Culture Collection (ATC C) (Rockville, MD, U.S.A.). Cells were routinely grown in Dulbecco’s Modified Eagle’s Medium Dulbecco’s modified Eagle’s medium (DMEM) (Invitrogen, Carlsbad, CA, U.S.A.), supplemented with 10% fetal bovine serum, 100 U/mL of penicillin, and 100 mg/mL of streptomycin at 37°C in a 5% CO₂ atmosphere.

Induction of Differentiation and Analysis of Adipocytes

The differentiation of 3T3-L1 preadipocytes into adipocytes was induced as described previously.²²⁾ 3T3-L1 cells (3×10⁵ cells/well) were seeded on a 6-well plate. Two days after cells had reached confluency, differentiation was induced using 1 mM IBMX, 1.7 µM insulin, and 1 µM DEX (Day 0). Culture medium was changed every two days, and the compounds being tested were added on Day 2 or 8 (see Fig. 3; experimental scheme). In addition, culture medium was supplied with 0.85 µM insulin during from Days 2 to 8. Lipid droplets in differentiated adipocytes were detected by Oil-Red O staining. Oil-Red O was performed according to a previous study.^23,24)

Dual Luciferase Reporter Assay

Prior to DNA transfection, 3T3-L1 cells were seeded (5×10⁴ cells/well) on 24-well plates containing DMEM medium (Invitrogen). The transfection of each plasmid vector was performed using Lipofectamine LTX^® with PLUS™ reagent (Invitrogen). DNA mixtures of 300 ng of the PPRE-Luc plasmid containing the rat acyl-CoA oxidase PPRE were co-transfected with 2 ng of the Renilla luciferase reporter plasmid (pRL-CMV) (Promega) in 24-well plates. The PPRE reporter construct was a gift from Dr. Curtis J. Omiecinski (Pennsylvania State University, PA, U.S.A.).²⁵⁾ Twenty-four hours after transfection, culture medium was replaced by phenol red-free DMEM supplemented with 10% charcoal-stripped FBS, followed by a treatment with BKA, its analogs, and PIO. Cell extracts were prepared with 100 µL passive lysis buffer (Promega) 24 h after the treatments with the compounds, and 20 µL of the extracts was used in dual-luciferase assays by the GloMAX-Multi Detection System (Promega). The ratio of firefly luciferase activity to Renilla luciferase activity in each sample served as a measure of normalized luciferase activity.

Real-Time RT-PCR Analysis

Total RNA was collected from 10 µM PIO, 25 µM BKA-#2, or vehicle-treated 3T3-L1 cells after the indicated exposure periods (see Figure legends) using the RNeasy kit (Qiagen, Inc., Hilden, Germany) and purified using RNeasy/QIAamp columns (Qiagen, Inc.). cDNA was prepared via RT of total RNA using the ReverTra Ace^® qPCR RT kit (Toyobo Co., Ltd., Osaka, Japan). Real-time RT-PCR assays were performed with FastStart Essential DNA Green Master (Roche Applied Science, Indianapolis, IN, U.S.A.) and LightCycler Nano (Roche Diagnostics, Mannheim, Germany). The sequences of using primers were shown in Table 1. The reaction conditions for all mRNAs were 95°C for 10 min, followed by 45 cycles at 95°C for 10 s, at 58°C for 10 s, and 72°C for 15 s. Individual mRNA levels were normalized to the corresponding β-actin mRNA levels.

Table 1. Primer Sequences for Real Time RT-PCR

Gene	Forward (5′→3′)	Reverse (5′→3′)
β-Actin	GACGGCCAGGTCATCACTATT	TACCACCAGACAGCACTGTGTT
PPARγ	CTCCAAGAATACCAAAGTGCGA	GCCTGATGCTTTATCCCCACA
aP2	AAGACAGCTCCTCCTCGAAGGTT	TGACCAAATCCCCATTTACGC
C/EBPα	TGGACAAGAACAGCAACGAG	TCACTGGTCAACTCCAGCAC
Adiponectin	GCAAGCTCTCCTGTTCCTCTTAATC	TGCATCTCCTTTCTCTCCCTTCTC
Mcp-1	CTTCCTCCACCACCATGCA	CCAGCCGGCAACTGTGA
Resistin	TCACTTTTCACCTCTGTGGATATGAT	TGCCCCAGGTGGTGTAAA
TGH	ATGCGCCTCTACCCTCTGATA	AGCAAATCTCAAGGAGCCAAG
Bcl-2	GAGAGCGTCAACAGGGAGATG	CCAGCCTCCGTTATCCTGGA
Bax	TGAAGACAGGGGCCTTTTTG	AATTCGCCGGAGACACTCG
p53	GCGTAAACGCTTCGAGATGTT	TTTTTATGGCGGGAAGTAGACTG

Data Analysis

Differences were considered significant when the p value was calculated as <0.05. Dunnett’s test was used to compare the control group and other treatment groups. These calculations were performed using Statview 5.0 J software (SAS Institute Inc., Cary, NC, U.S.A.).

RESULTS AND DISCUSSION

We previously reported that BKA (25 µM) stimulated PPARγ transcriptional activity in MCF-7 cells.²⁰⁾ Therefore, we initially examined whether BKA (25 µM) (Fig. 1) activates PPAR transcriptional activity in 3T3-L1 preadipocyte cells. BKA had no influence on PPAR activity in 3T3-L1 cells, whereas PIO (10 µM), a positive control, significantly increased PPAR-mediated PPRE activity by approximately 1.5-fold in 3T3-L1 cells (Fig. 2A). Chemicals have generally to overcome a barrier, the lipid bilayer, when entering cells to evoke their biological actions. Since BKA contains three highly polar carboxylic acid moieties (−COOH) in its structure (Fig. 1), the polarities of chemicals including that of BKA may be a key determinant for passing through the lipid bilayer (possibly in 3T3-L1 cells). Based on this hypothesis, we originally synthesized nine BKA analogs (i.e., BKA-#1 to BKA-#9; Fig. 1) in order to identify compounds with the potential to stimulate PPARγ in 3T3-L1 cells. Among them, only 25 µM BKA-#2 positively/significantly enhanced luciferase activity mediated by PPRE, which was similar to the effects of 10 µM PIO (Figs. 2B, C). When the structures of BKA-#2 and -#3 were compared (see Fig. 1), the −COOH group of BKA-#3 was reduced to the neutral −CH₂OH group in BKA-#2. In support of our hypothesis described above, BKA-#3, a more hydrophilic compound than BKA-#2, did not exhibit significant stimulating activity (Fig. 2B). Thus, in subsequent experiments, we focused on the biological activities of BKA-#2.

Fig. 2. Influence of BKA Analogs on PPRE Transcriptional Activity

Effects of BKA (A) and BKA analogs (B and C) on PPRE-mediated transcriptional activity. Luciferase activity was measured 24 h after treatments with PIO (10 µM), BKA (25 µM), and BKA analogs (1, 5, 25 µM). Transfection efficacy was adjusted for Renilla luciferase activity. Data are expressed as a fold induction from the vehicle-treated control (Ctl.), as the mean±S.D. (n=3 to 9). * p<0.05 versus the control group.

In the medical care of type 2 diabetes, TZD derivatives are often applied in order to improve insulin resistance, which is attributed to obesity. Moreover, these drugs may promote adipocyte differentiation through the activation of PPARγ coupling with insulin-sensitizing effects.^26,27) If the BKA-#2-mediated stimulation of PPARγ is functionally active, BKA-#2 as well as PIO may further “promote” the differentiation of 3T3-L1 cells chemically triggered by a combination of dexamethasone, insulin, and IBMX (“stimulus”) (Fig. 3). 3T3-L1 cells were exposed to PIO and BKA-#2 on Day 2 after the addition of the stimulus, followed by an incubation for 6 d (D2 to 8: the early treatment). In 3T3-L1 cells stimulated with vehicle (control), some parts of the cells stained positively; however, BKA-#2 and PIO significantly promoted the differentiation of preadipocytes to mature adipocytes (Fig. 4A). No observable Oil-Red O-stained cells were detected under the non-stimulated condition (Fig. 4A; Non-stimulated). Furthermore, we quantified the amount of Oil-Red O that partitioned into the droplets, and the results obtained showed that, consistent with the results in Fig. 4A, BKA-#2 and PIO significantly increased the amount of lipid droplets compared to control cells (Fig. 4B). To obtain evidence for the induction of differentiation into adipocytes, we determined transcript levels of adipogenic markers.²⁸⁾ In support of the results in Figs. 4A and B, it was revealed that the expression levels of PPARγ, aP2, and C/EBPα in cells treated with BKA-#2 and PIO were higher than those in control cells (Fig. 4C).

Fig. 3. Experimental Scheme for the Induction of Differentiation in Pre-adipocyte 3T3-L1 Cells

The compounds tested were added 2 d after a differentiation-inducing stimulus for the early treatment (D2 to 8), or 8 d after the stimulus for the late treatment (D8 to 14).

Fig. 4. Induction of Differentiation into Adipocytes by BKA-#2 in the Early Differentiation Phase

A differential stimulus (Day 0) and the addition of additives (Day 2: vehicle or PIO/BKA-#2) were performed according to the procedure shown in Fig. 3 and described in Materials and Methods. A non-stimulated (NS) group unstimulated on Day 0 acted as a negative control group. (A, upper panel) The whole cell culture dish view of Oil-Red O staining. (A, lower panel) Oil-Red O stained images of lipid droplets. (B) Determination of Oil-Red O incorporated into lipid droplets. Cells after Oil-Red O staining were treated isopropanol, and the absorbance at 490 nm was measured. Data are expressed as a fold change from the vehicle-treated control (Ctl.), as the mean±S.D. (n=3). * p<0.05 versus the control group. (C) Real-time RT-PCR analysis of PPARγ, aP2, and C/EBPα mRNA in differentiated-3T3-L1 cells. Data are expressed as a fold change from the vehicle-treated control (Ctl.), as the mean±S.D. (n=3). * p<0.05 versus the control group.

Chemicals with the potential to decrease the size of “enlarged adipocytes” are required to overcome insulin resistance. As shown in previous studies, the effect of some agent on adipocytes vary depending on the timing of exposure after differentiation, and TZD derivatives increase reduced-size adipose tissues.^29,30) In order to investigate whether BKA-#2 and PIO affect the size of adipocytes that had been differentiated for 8 d after the stimulation (see Fig. 3), mature adipocytes (Day 8) were treated with BKA-#2 and PIO for an additional 6 d (Days 8 to 14). As shown in Fig. 5A, the size of lipid droplets in Day 8 control cells appeared larger than in Day 14 control cells. In this condition, BKA-#2 and PIO clearly decreased lipid droplet size in the cells (Fig. 5B, C) (see also Fig. 5A). The mechanisms underlying the improvements induced in insulin resistance by the activation of PPARγ have been suggested as follows; i) an increase in adiponectin production via PPRE-mediated transcription and ii) the activation of PPARα and AMP-activated protein kinase (AMPK) via adiponectin signaling.^31,32) Thus, we investigated the transcript levels of adiponectin in 3T3-L1 cells together with two representative hypertrophic adipocyte marker genes; monocyte chemoattractant protein 1 (MCP-1/CCL2) (an insulin-responsive gene) and resistin (D8 to 14: the late treatment).^33–35) As shown in Fig. 6, the mRNA expression of adiponectin and resistin in Day 14 (control) was decreased as compared with control in Day 8, while Mcp-1 expression was increased in Day 14. These results were consistent with previous studies,^34,36) and suggest that adipocyte hypertrophy occurred in concert with duration from Days 8 to 14. In NS group, although it seems to be increased expression of Mcp-1, it was probably because of inflammatory-like response by long-term culture of 3T3-L1. However, contrary to expectations, these mRNAs showed no alternation by the treatments with PIO and BKA-#2 compared to the controls (Fig. 6). We further investigated whether the reduction of lipid droplets in the mature adipocytes was influenced by the degradation of triglycerides, and thus we measured the mRNA expression of triglyceride hydrolase (TGH), which is known as a lipase in 3T3-L1 adipocyte.^37,38) The expression of TGH tended to be increased by PIO/BKA-#2 treatment (Fig. 6). These results suggest that the downsizing of lipid droplets in mature adipocyte may be caused, at least in part, by lipolytic effects of PIO/BKA-#2.

Fig. 5. Reduction in Hypertrophic Adipocytes by BKA-#2 in the Late Differentiation Phase

A differential stimulus (Day 0) and the addition of additives (Day 2: vehicle) or (Day 8: vehicle or PIO/BKA-#2) were performed according to the procedure shown in Fig. 3 and described in Materials and Methods. Non-stimulated (NS) groups unstimulated on Day 0 acted as negative control groups (for Day 8 and Days 8 to 14, respectively). (A) Lipid droplets were stained with Oil-Red O. Scale bar is indicated as 100 µm. (B) The number of large lipid droplets in mature adipocytes. Lipid droplets that were >25 µm or >50 µm in size were counted using ImageJ free software (ver. 1.46r, National Institutes of Health; Bethesda, MD, U.S.A.). Data are expressed as the mean±S.D. (n=4). * p<0.05 versus the control group (Ctl.: Days 8 to 14).

Fig. 6. Real-time RT-PCR Analysis of the Adipocyte Marker Genes in Differentiated 3T3-L1 Cells

Cells were treated at the late differentiation phase, and total RNA was extracted on Days 8 and 14. A non-stimulated (NS) group unstimulated on Day 0 acted as a negative control group. All mRNAs were assessed by real-time RT-PCR as a ratio of β-actin. Data are expressed as a fold change from the vehicle-treated control (Ctl.), as the mean±S.D. (n=3). * p<0.05 versus the control group.

In previous studies, it is showed that PPARγ activation by TZD derivatives including PIO causes apoptotic cell death response.³⁹⁾ Thus, we examined the transcript levels of apoptosis-related genes in mature adipocytes after treatments with PIO or BKA-#2. As clearly shown in Fig. 7, p53, Bax, and Bcl-2 transcript levels in the PIO/BKA-#2-treated cells were similar to those in the control cells. These results suggest the possibility that PIO/BKA-#2 do not require apoptosis to downsize mature adipocytes in the experimental condition employed in this study.

Fig. 7. Effects of PIO and BKA-#2 on the mRNA Expression of Apoptosis-Related Genes in 3T3-L1 Cells

Cells were treated at the late differentiation phase, and total RNA was extracted on Days 8 and 14. A non-stimulated (NS) group unstimulated on Day 0 acted as a negative control group. All mRNAs were assessed by real-time RT-PCR as a ratio of β-actin. Data are expressed as a fold change from the vehicle-treated control (Ctl.), as the mean±S.D. (n=3). * p<0.05 versus the control group.

Even in recent years, some off-target effects by TZDs are noted in the treatment of type-II diabetes and it remains a therapeutic obstacle. Considering the results in present study, it is presumed that BKA-#2 acts as a pioglitazone-like PPARγ activator in preadipocyte/adipocyte. Clearly, further studies are warranted to assess the effects of BKA-#2 including occurrence of the side effects observed in TZDs in vivo.

Acknowledgments

This work was performed under the Research Program of “Dynamic Alliance for Open Innovation Bridging Human, Environment and Materials” in “Network Joint Research Center for Materials and Devices” [Research Nos. 20163071 and 20173065 (to H.A.)]. This study was also supported, in part, by JSPS KAKENHI Grant Numbers JP26293004 and JP16H01157 (to M.S.).

Conflict of Interest

The authors declare no conflict of interest.

REFERENCES

• 1) Keidar S, Guttmann H, Stam T, Fishman I, Shapira C. High incidence of reduced plasma HDL cholesterol in diabetic patients treated with rosiglitazone and fibrate. Pharmacoepidemiol. Drug Saf., 16, 1192–1194 (2007).
• 2) Gaudiani LM, Lewin A, Meneghini L, Perevozskaya I, Plotkin D, Mitchel Y, Shah S. Efficacy and safety of ezetimibe co-administered with simvastatin in thiazolidinedione-treated type 2 diabetic patients. Diabetes Obes. Metab., 7, 88–97 (2005).
• 3) Charpentier G. Oral combination therapy for type 2 diabetes. Diabetes Metab. Res. Rev., 18 (Suppl. 3), S70–S76 (2002).
• 4) Yamanouchi T, Sakai T, Igarashi K, Ichiyanagi K, Watanabe H, Kawasaki T. Comparison of metabolic effects of pioglitazone, metformin, and glimepiride over 1 year in Japanese patients with newly diagnosed Type 2 diabetes. Diabet. Med., 22, 980–985 (2005).
• 5) Derosa G, D’Angelo A, Ragonesi PD, Ciccarelli L, Piccinni MN, Pricolo F, Salvadeo SA, Montagna L, Gravina A, Ferrari I, Paniga S, Cicero AF. Metformin-pioglitazone and metformin-rosiglitazone effects on non-conventional cardiovascular risk factors plasma level in type 2 diabetic patients with metabolic syndrome. J. Clin. Pharm. Ther., 31, 375–383 (2006).
• 6) Larsen TM, Toubro S, Astrup A. PPARgamma agonists in the treatment of type II diabetes: is increased fatness commensurate with long-term efficacy? Int. J. Obes. Relat. Metab. Disord., 27, 147–161 (2003).
• 7) Itoh H, Doi K, Tanaka T, Fukunaga Y, Hosoda K, Inoue G, Nishimura H, Yoshimasa Y, Yamori Y, Nakao K. Hypertension and insulin resistance: role of peroxisome proliferator-activated receptor gamma. Clin. Exp. Pharmacol. Physiol., 26, 558–560 (1999).
• 8) Gearing KL, Göttlicher M, Teboul M, Widmark E, Gustafsson JA. Interaction of the peroxisome-proliferator-activated receptor and retinoid X receptor. Proc. Natl. Acad. Sci. U.S.A., 90, 1440–1444 (1993).
• 9) Rodríguez JC, Gil-Gómez G, Hegardt FG, Haro D. Peroxisome proliferator-activated receptor mediates induction of the mitochondrial 3-hydroxy-3-methylglutaryl-CoA synthase gene by fatty acids. J. Biol. Chem., 269, 18767–18772 (1994).
• 10) Tontonoz P, Hu E, Graves RA, Budavari AI, Spiegelman BM. mPPAR gamma 2: tissue-specific regulator of an adipocyte enhancer. Genes Dev., 8, 1224–1234 (1994).
• 11) Bildirici I, Roh CR, Schaiff WT, Lewkowski BM, Nelson DM, Sadovsky Y. The lipid droplet-associated protein adipophilin is expressed in human trophoblasts and is regulated by peroxisomal proliferator-activated receptor-gamma/retinoid X receptor. J. Clin. Endocrinol. Metab., 88, 6056–6062 (2003).
• 12) Wu Z, Xie Y, Morrison RF, Bucher NL, Farmer SR. PPARgamma induces the insulin-dependent glucose transporter GLUT4 in the absence of C/EBPalpha during the conversion of 3T3 fibroblasts into adipocytes. J. Clin. Invest., 101, 22–32 (1998).
• 13) Kipnes MS, Krosnick A, Rendell MS, Egan JW, Mathisen AL, Schneider RL. Pioglitazone hydrochloride in combination with sulfonylurea therapy improves glycemic control in patients with type 2 diabetes mellitus: a randomized, placebo-controlled study. Am. J. Med., 111, 10–17 (2001).
• 14) Pegg K, Zhang J, Pollock C, Saad S. Combined effects of PPARγ agonists and epidermal growth factor receptor inhibitors in human proximal tubule cells. PPAR Res., 2013, 982462 (2013).
• 15) Endo Y, Suzuki M, Yamada H, Horita S, Kunimi M, Yamazaki O, Shirai A, Nakamura M, Iso-O N, Li Y, Hara M, Tsukamoto K, Moriyama N, Kudo A, Kawakami H, Yamauchi T, Kubota N, Kadowaki T, Kume H, Enomoto Y, Homma Y, Seki G, Fujita T. Thiazolidinediones enhance sodium-coupled bicarbonate absorption from renal proximal tubules via PPARγ-dependent nongenomic signaling. Cell Metab., 13, 550–561 (2011).
• 16) Henderson PJ, Lardy HA. Bongkrekic acid. An inhibitor of the adenine nucleotide translocase of mitochondria. J. Biol. Chem., 245, 1319–1326 (1970).
• 17) Marzo I, Brenner C, Zamzami N, Jürgensmeier JM, Susin SA, Vieira HL, Prévost MC, Xie Z, Matsuyama S, Reed JC, Kroemer G. Bax and adenine nucleotide translocator cooperate in the mitochondrial control of apoptosis. Science, 281, 2027–2031 (1998).
• 18) Paquet C, Sané AT, Beauchemin M, Bertrand R. Caspase- and mitochondrial dysfunction-dependent mechanisms of lysosomal leakage and cathepsin B activation in DNA damage-induced apoptosis. Leukemia, 19, 784–791 (2005).
• 19) Matsumoto K, Suyama M, Fujita S, Moriwaki T, Sato Y, Aso Y, Muroshita S, Matsuo H, Monda K, Okuda K, Abe M, Fukunaga H, Kano A, Shindo M. Efficient total synthesis of bongkrekic acid and apoptosis inhibitory activity of its analogues. Chem. Eur. J., 21, 11590–11602 (2015).
• 20) Okazaki H, Takeda S, Ikeda E, Fukunishi Y, Ishii H, Taniguchi A, Tokuyasu M, Himeno T, Kakizoe K, Matsumoto K, Shindo M, Aramaki H. Bongkrekic acid as a selective activator of the peroxisome proliferator-activated receptor γ (PPARγ) isoform. J. Toxicol. Sci., 40, 223–233 (2015).
• 21) Okuda K, Hasui K, Abe M, Matsumoto K, Shindo M. Molecular design, synthesis, and evaluation of novel potent apoptosis inhibitors inspired from bongkrekic acid. Chem. Res. Toxicol., 25, 2253–2260 (2012).
• 22) Rubin CS, Hirsch A, Fung C, Rosen OM. Development of hormone receptors and hormonal responsiveness in vitro. Insulin receptors and insulin sensitivity in the preadipocyte and adipocyte forms of 3T3-L1 cells. J. Biol. Chem., 253, 7570–7578 (1978).
• 23) Jin S, Zhai B, Qiu Z, Wu J, Lane MD, Liao K. c-Crk, a substrate of the insulin-like growth factor-1 receptor tyrosine kinase, functions as an early signal mediator in the adipocyte differentiation process. J. Biol. Chem., 275, 34344–34352 (2000).
• 24) Tomiyama K, Nakata H, Sasa H, Arimura S, Nishio E, Watanabe Y. Wortmannin, a specific phosphatidylinositol 3-kinase inhibitor, inhibits adipocytic differentiation of 3T3-L1 cells. Biochem. Biophys. Res. Commun., 212, 263–269 (1995).
• 25) Takeda S, Ikeda E, Su S, Harada M, Okazaki H, Yoshioka Y, Nishimura H, Ishii H, Kakizoe K, Taniguchi A, Tokuyasu M, Himeno T, Watanabe K, Omiecinski CJ, Aramaki H. Δ⁹-THC modulation of fatty acid 2-hydroxylase (FA2H) gene expression: possible involvement of induced levels of PPARα in MDA-MB-231 breast cancer cells. Toxicology, 326, 18–24 (2014).
• 26) Yamauchi T, Kamon J, Waki H, Murakami K, Motojima K, Komeda K, Ide T, Kubota N, Terauchi Y, Tobe K, Miki H, Tsuchida A, Akanuma Y, Nagai R, Kimura S, Kadowaki T. The mechanisms by which both heterozygous peroxisome proliferator-activated receptor gamma (PPARgamma) deficiency and PPARgamma agonist improve insulin resistance. J. Biol. Chem., 276, 41245–41254 (2001).
• 27) Li X, Ycaza J, Blumberg B. The environmental obesogen tributyltin chloride acts via peroxisome proliferator activated receptor gamma to induce adipogenesis in murine 3T3-L1 preadipocytes. J. Steroid Biochem. Mol. Biol., 127, 9–15 (2011).
• 28) Christy RJ, Yang VW, Ntambi JM, Geiman DE, Landschulz WH, Friedman AD, Nakabeppu Y, Kelly TJ, Lane MD. Differentiation-induced gene expression in 3T3-L1 preadipocytes: CCAAT/enhancer binding protein interacts with and activates the promoters of two adipocyte-specific genes. Genes Dev., 3, 1323–1335 (1989).
• 29) Kim JE, Chen J. Regulation of peroxisome proliferator-activated receptor-gamma activity by mammalian target of rapamycin and amino acids in adipogenesis. Diabetes, 53, 2748–2756 (2004).
• 30) Okuno A, Tamemoto H, Tobe K, Ueki K, Mori Y, Iwamoto K, Umesono K, Akanuma Y, Fujiwara T, Horikoshi H, Yazaki Y, Kadowaki T. Troglitazone increases the number of small adipocytes without the change of white adipose tissue mass in obese Zucker rats. J. Clin. Invest., 101, 1354–1361 (1998).
• 31) Yamauchi T, Kamon J, Minokoshi Y, Ito Y, Waki H, Uchida S, Yamashita S, Noda M, Kita S, Ueki K, Eto K, Akanuma Y, Froguel P, Foufelle F, Ferre P, Carling D, Kimura S, Nagai R, Kahn BB, Kadowaki T. Adiponectin stimulates glucose utilization and fatty-acid oxidation by activating AMP-activated protein kinase. Nat. Med., 8, 1288–1295 (2002).
• 32) Yamauchi T, Kamon J, Ito Y, Tsuchida A, Yokomizo T, Kita S, Sugiyama T, Miyagishi M, Hara K, Tsunoda M, Murakami K, Ohteki T, Uchida S, Takekawa S, Waki H, Tsuno NH, Shibata Y, Terauchi Y, Froguel P, Tobe K, Koyasu S, Taira K, Kitamura T, Shimizu T, Nagai R, Kadowaki T. Cloning of adiponectin receptors that mediate antidiabetic metabolic effects. Nature, 423, 762–769 (2003).
• 33) Ozaki KI, Awazu M, Tamiya M, Iwasaki Y, Harada A, Kugisaki S, Tanimura S, Kohno M. Targeting the ERK signaling pathway as a potential treatment for insulin resistance and type 2 diabetes. Am. J. Physiol. Endocrinol. Metab., 310, E643–E651 (2016).
• 34) Ikeda Y, Tsuchiya H, Hama S, Kajimoto K, Kogure K. Resistin affects lipid metabolism during adipocyte maturation of 3T3-L1 cells. FEBS J., 280, 5884–5895 (2013).
• 35) Ikeda Y, Hama S, Kajimoto K, Okuno T, Tsuchiya H, Kogure K. Quantitative comparison of adipocytokine gene expression during adipocyte maturation in non-obese and obese rats. Biol. Pharm. Bull., 34, 865–870 (2011).
• 36) Ito A, Suganami T, Miyamoto Y, Yoshimasa Y, Takeya M, Kamei Y, Ogawa Y. Role of MAPK phosphatase-1 in the induction of monocyte chemoattractant protein-1 during the course of adipocyte hypertrophy. J. Biol. Chem., 282, 25445–25452 (2007).
• 37) Soni KG, Lehner R, Metalnikov P, O’Donnell P, Semache M, Gao W, Ashman K, Pshezhetsky AV, Mitchell GA. Carboxylesterase 3 (EC 3.1.1.1) is a major adipocyte lipase. J. Biol. Chem., 279, 40683–40689 (2004).
• 38) Dolinsky VW, Gilham D, Hatch GM, Agellon LB, Lehner R, Vance DE. Regulation of triacylglycerol hydrolase expression by dietary fatty acids and peroxisomal proliferator-activated receptors. Biochim. Biophys. Acta, 1635, 20–28 (2003).
• 39) Xiao Y, Yuan T, Yao W, Liao K. 3T3-L1 adipocyte apoptosis induced by thiazolidinediones is peroxisome proliferator-activated receptor-gamma-dependent and mediated by the caspase-3-dependent apoptotic pathway. FEBS J., 277, 687–696 (2010).