Caffeic Acid Phenethyl Ester Inhibits the Proliferation of HEp2 Cells by Regulating Stat3/Plk1 Pathway and Inducing S Phase Arrest

Abstract

Caffeic acid phenethyl ester (CAPE), an active polyphenolic component of honeybee propolis, has been demonstrated to have many medicinal properties. However, the antitumor effect and mechanism of CAPE on laryngeal carcinoma cells have not been examined. In this study, we treated HEp2 cells with various concentration of CAPE, and the results showed that CAPE can reduce the viability of HEp2 cells with IC₅₀ values of 23.8 ± 0.7 µM for 72 h. Meanwhile, CAPE significantly inhibited activation of signal transducer and activator of transcription (Stat)3 in a concentration dependent manner in HEp2 cells and regulated the expression and transcription of Plk1. AG490, a specific Stat3 inhibitor, not only inhibited the activation and expression of Stat3, but also inhibited the expression of Plk1 in HEp2 cells, so Stat3 was probably involved in the regulation of Plk1 in HEp2 cells. In addition, treatment of CAPE leaded to a blockage of cell cycle in S phase in HEp2 cells. Therefore, CAPE inhibited the proliferation of HEp2 Cells probably by regulating Stat3/Plk1 pathway and inducing S phase arrest.

INTRODUCTION

Laryngeal carcinoma as a malignant carcinoma of head and neck region is the 11th most common cancer in people all over the world, which also is the most common head and neck malignancy in northeast China.^1,2) The surgical treatment, chemotherapy and radiotherapy make a significant increase in survival with cure rates of up to 80 to 90% for patients at early stage, however, the survival decreases to as low as 40% in patients at late stage.^1,3) Meanwhile, it remains unsatisfactory for distant metastasis and relapse.^4,5) Therefore, more efforts need to develop new approaches and strategies for treatment of laryngeal carcinoma.

Signal transducer and activator of transcription (Stat)3 as a transcription factor is phosphorylated to regulate transcription of target genes in response to cytokines and growth factors.⁶⁾ Aberrant activation of Stat3 promotes proliferation and oncogenesis by regulating transcription of various genes.⁷⁾ Plk1 is a key regulator of cell division.⁸⁾ Deregulation of Plk1 has been demonstrated to lead to tumorigenesis.⁹⁾ Previous studies have shown that Stat3 and Plk1 control each other’s transcription in a positive feedback loop that leads to tumor development.¹⁰⁾ Aberrant activation of Stat3 and frequently overexpression of Plk1 have been found in various tumors, including laryngeal carcinoma.^11,12) Therefore, Stat3/Plk1 pathway may be a potential target for laryngeal carcinoma therapy.

Caffeic acid phenethyl ester (CAPE), an active polyphenolic component of propolis, has been reported to exhibit various bioactive properties such as antitumor^13,14) and neuroprotection.^15,16) CAPE suppresses proliferation of tumor cells through various mechanisms including inducing apoptosis and inhibiting the angiogenesis.^17,18) However, the antitumor effect and mechanism of CAPE on laryngeal carcinoma cells have not been examined. In this report, we explored antitumor effects and underlying mechanisms of CAPE against HEp2 in vitro.

MATERIALS AND METHODS

Cell Line and Culture

The cell line (HEp2) was purchased from Boster Biological Technology Co., Ltd. (Wuhan, China). The cells were cultured in RPMI 1640 with 10% fetal bovine serum (FBS; PAN) and 1% penicillin–streptomycin antibiotics (Hyclone) in a humidified incubator with 5% CO₂ at 37°C.

Anti-proliferation Activity Assay

Cell viability was detected using the MTS assay (Promega, U.S.A) according to the manufacturer’s instructions. Briefly, HEp2 cells were plated in 96-well plates at 4000 cells/well. After incubated for 12 h, the cells were exposed to CAPE (J&K Scientific, China) or AG490 (Beyotime Biotechnology, China) at various concentrations. After 24, 48 or 72 h, 20 µL MTS was added in per well and incubated at 37°C for 3 h. Absorbance of each well was detected by a microplate reader at a wavelength of 490 nm.

Colony Formation Assay

To assess the clonogenic capacity of cells in vitro, 500 cells were plated in six-well culture plates. Following 24 h incubation, the cells were treated with various concentrations of CAPE for 24 h. After being washed with phosphate buffered saline (PBS), the cells were allowed to grow for 10 d to form colonies, and then fixed with methanol and stained with crystal violet.

Western Blot Analysis

After treatment, Western blotting was performed according to the standard protocol. Briefly, total protein was extracted from cells after 24 h of treatment CAPE or 2.5 h of treatment of AG490. Equal amounts of protein lysates were separated on sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) gels and then transferred to polyvinylidene difluoride (PVDF) membranes. The blots were blocked and probed with primary antibodies against Stat3 (12640, Cell Signaling Technology, U.S.A.), phospho-Stat3 (tyrosine (Tyr) 705) (9145, Cell Signaling Technology) and Plk1 (sc5585, Santa Cruz, U.S.A.). β-Actin (PM053, MBL, Japan) was used as a loading control. Then the signals were detected by enhanced chemiluminescence detection reagent (Applygen, China).

Cell Cycle Analysis

Cell cycle was tested by flow cytometry. Cells were harvested after 12 h of treatment with various concentrations of CAPE and fixed in ice-cold ethanol at −4°C overnight. The cells were centrifuged to remove the fixing solution. The ribonuclease (RNase) was added and incubated 30 min, and cells were stained with propidium iodide for 15 min in dark conditions at room temperature. The cells were then analyzed by flow cytometry (FACSVerse™, BD, U.S.A.).

Quantitative (q)RT-PCR Analysis

Cells were harvested after 24 h of treatment with CAPE and total RNA were isolated using Trizol reagent (Invitrogen, U.S.A.). The cDNA was gained with the Transcript Reverse Transcription System (Promega). The reverse-transcription products were amplified by an ABI 7300 Detection System (Applied Biosystems, U.S.A.) using the SYBR Green PCR Master Mix (Roche, Switzerland) and the primers. The primers of genes are shown in Table 1. The value gained for each gene was normalized to that of the gene encoding glyceraldehyde-3-phosphate dehydrogenase (GAPDH). The change-in-cycling-threshold (2^−ΔΔCt) method was used for calculation of the relative expression level of the genes.

Table 1. Nucleotide Sequences of the Primers Used for Quantitative (q)RT-PCR

Gene	Forward primer (5′→3′)	Reverse primer (5′→3′)
Stat3	CAGCAGCTTGACACACGGTA	AAACACCAAAGTGGCATGTGA
Plk1	AAAGAGATCCCGGAGGTCCTA	GGCTGCGGTGAATGGATATTTC
GAPDH	GGAGCGAGATCCCTCCAAAAT	GGCTGTTGTCATACTTCTCATGG

Statistical Analysis

Statistical analysis was performed using the GraphPad Prism 5. The significance of differences was determined by Student’s t-test or one-way ANOVA. A value of p < 0.05 was identified as statistical significance.

RESULTS

CAPE Inhibits the Proliferation of HEp2

To explore the potential anti-proliferation effect of CAPE to laryngeal carcinoma cells, we first treated HEp2 cells with increasing concentrations of CAPE for 24, 48 and 72 h followed by MTS assay. We observed that CAPE exposure slightly inhibited the HEp2 cells viability at 24 h (Fig. 1a), but exhibited significant inhibitory effects at 48 and 72 h in a concentration dependent manner (Figs. 1b, 1c). The IC₅₀ values of CAPE in HEp2 cells for 72 h were 23.8 ± 0.7 µM. Gefitinib was used to be a positive control, which had good efficacy in the treatment of squamous cell carcinoma of the head and neck in clinical studies, and showed obvious anti-proliferative effect on HEp2 cells¹⁹⁾ (Fig. 1d). In addition, CAPE exposure inhibited colony formation of HEp2 cells in a concentration dependent manner (Fig. 1e). HEp2 cell growth states exposed to 0, 10, 20, 40 and 80 µM CAPE for 48 h were shown in Fig. 1f. These results suggest that CAPE has the potential to inhibit the proliferation of laryngeal carcinoma cells.

Fig. 1. CAPE Inhibits the Proliferation of HEp2 Cells

a, b, c. HEp2 cells were treated with 0, 10, 20, 40 and 80 µM CAPE for 24, 48 or 72 h. Cell viability was detected with a MTS assay. c. Gefitinib was a positive control and its inhibitory effect for proliferation of HEp2 cells at 0, 5, 10 and 20 µM for 72 h. Data are expressed as the mean ±standard deviation ( S.D.), n = 3. e. Colony formation assay with HEp2 cells exposed to 0, 5, 10, 20, 40 and 80 µM CAPE for 10 d. f. HEp2 cell growth states exposed to 0, 10, 20, 40 and 80 µM CAPE for 48 h.

Stat3 Is Involved in the Regulation of Plk1 in HEp2 Cells

Studies demonstrated that Stat3 directly activated Plk1 transcription and Plk1 potentiated Stat3 expression in some human tumors, such as esophageal squamous cell carcinoma (ESCC) cells¹⁰⁾ and lung adenocarcinoma epithelial cells.²⁰⁾ However, the relationship between Stat3 and Plk1 in laryngeal carcinoma cells is unclear. To investigate the involvement of Stat3 on Plk1, we treated HEp2 cells with AG490,²¹⁾ a specific inhibitor of Stat3, at 10 µM for 2.5 h. The results showed that AG490 not only inhibited the activation and expression of Stat3, but also inhibited the expression of Plk1 (Figs. 2a, 2b). Furthermore, we treated HEp2 cells with increasing concentrations of AG490 for 48 h followed by MTS assay. We observed that AG490 exposure inhibited the proliferation of HEp2 cells (Fig. 2c). Therefore, we speculated that Stat3 was involved in the regulation of Plk1 in HEp2 cells and the Stat3/Plk1 pathway played an important role in proliferation of HEp2 cells

Fig. 2. AG490, a Specific Inhibitor of Stat3, Inhibited the Expression of Plk1 and Reduced Cells Viability of HEp2 Cells

a. HEp2 cells were treated with 0 and 10 µM AG490 for 2.5 h, then the cell lysates were immunoblotted for the indicated proteins. b. The data were expressed as the intensity of protein bands of the target genes/β-actin relative to the control group. Data are expressed as the mean ± S.D., n = 3. c. HEp2 cells were treated with various concentrations of AG490 for 48 h. Cell viability was detected with a MTS assay. Data are expressed as the mean ± S.D., n = 3.

CAPE Regulates Stat3/Plk1 Pathway in HEp2 Cells

To investigate whether CAPE could regulate Stat3/Plk1 pathway in human laryngeal carcinoma cells, we respectively treated HEp2 cells with 10, 20, 40 and 80 µM CAPE for 24 h. As a result, expressions of Stat3 and p-Stat3 (Y705) were significantly reduced in a concentration dependent manner (Figs. 3a, 3b). Meanwhile, Plk1 as a directly activated gene by Stat3 was significantly rose in 20 µM CAPE exposure and significantly lowered in high concentration of CAPE exposure. Furthermore, we investigated the transcriptional level of Stat3 and Plk1 in CAPE treated HEp2 cells, we preformed qRT-PCR at 10, 20, 40 and 80 µM CAPE exposure (Figs. 3c, 3d). The transcriptional level of Stat3 and Plk1 was consistent with the expression level. Taken together, these results demonstrated that CAPE inhibited cell proliferations in HEp2 cells probably by regulating Stat3/Plk1 pathway.

Fig. 3. CAPE Regulated the Stat3/Plk1 Pathway in HEp2 Cells

a. HEp2 cells were treated with 0, 10, 20, 40 and 80 µM CAPE, then the cell lysates were immunoblotted for the indicated proteins. b. The data were expressed as the intensity of protein bands of the target genes/β-actin relative to the control group. Data are expressed as the mean ± S.D., n = 3. c, d. HEp2 cells were treated with 0, 10, 20, 40 and 80 µM CAPE, then gene mRNA levels of STAT3 and Plk1 were examined by qRT-PCR. GAPDH was used as an internal reference. Data are expressed as the mean ± S.D., n = 3. * p < 0.05, ** p < 0.01, *** p < 0.001 versus control.

CAPE Arrested the Cell Cycle at S Phase in HEp2 Cells

Plk1 have emerged as critical regulators of cell cycle, so we further detected the effects of CAPE on cell cycle progression. Exposure CAPE to HEp2 cells for 12 h caused an interference with cell cycle distribution. As shown in Fig. 4, treatment of CAPE leaded to a blockage of cell cycle in S phase. When HEp2 cells were treated with 10 µM of CAPE, compared with control, the percentage of cells in G2/M phase decreased from 33.6 to 18.4%. The percentage of cells in S phase increased form 9.7% in control to 21.2% in 10 µM CAPE treatment. When HEp2 cells were treated with 20 µM CAPE, there was the similar level arrest as 10 µM CAPE treatment. However, the inhibition of Plk1 generally induces G2/M arrest, but not S arrest. Thus, the S phase arrest was not induced by Plk1 inhibition. Stat3 can arrest cell cycle progression through many pathways,²²⁾ and CAPE may induce cell cycle arrest through other pathway. Anyhow, the S phase arrest is an important factor to inhibit the proliferation of HEp2 cells.

Fig. 4. CAPE Mainly Arrested the Cell Cycle at S Phase in HEp2 Cells

a. The HEp2 cells were treated with 0, 10, and 20 µM CAPE for 12 h, then the cell cycle distribution was determined using flow cytometry. b. The data were expressed as the percentage of cells in G1, S and G2 phase. Data are expressed as the mean ± S.D., n = 3. * p < 0.05, ** p < 0.01, *** p < 0.001 versus control.

DISCUSSION

We present here that CAPE inhibits the proliferation of human laryngeal carcinoma HEp2 cells, which partly attributes to the inhibition effect of Stat3/Plk1 pathway and the S phase arrest.

Previous studies have demonstrated that Stat3 directly activates Plk1 transcription through binding to the PLK1-SIE element in the PLK1 promoter, and Plk1 potentiates Stat3 expression as well in esophageal squamous cell carcinoma cells. Stat3 and Plk1 control each other’s transcription in a positive feedback loop that contributes to the development of tumor.¹⁰⁾ In this report, we found that Stat3 was also involved in the regulation of Plk1 in HEp2 cells, and the Stat3/Plk1 pathway played an important role in proliferation of HEp2 cells. Furthermore, CAPE was found to regulate Stat3/Plk1 pathway in HEp2 cells to inhibit the proliferation of HEp2 cells.

Our results showed that the expression and transcriptional level of Plk1 were increased in a low concentration CAPE treatment in HEp2. Plk1 is overexpressed in a wide spectrum of tumors and is frequently considered as an oncogene, which implies that overexpression of Plk1 could promote tumor development.^23,24) However, recent studies show that the overexpression of Plk1 prevents the development of Kras-induced and Her2-induced mammary gland tumors by perturbing mitotic progression and cytokinesis.²⁵⁾ Therefore, we speculated that, on the one hand, inhibiting expression of Plk1 in a high concentration CAPE treatment can generate the therapeutic benefits, on the other hand, Plk1 up-regulation may have tumor-suppressive properties by perturbing mitotic progression and cytokinesis in HEp2 cells. We will further study the mechanism in the follow-up work.

CONCLUSION

Here, we report that CAPE has potent antitumor activity against HEp2 cells by reducing cell proliferation in vitro. We further identify the Stat3/Plk1 signaling pathway as a pivotal molecular target of CAPE in HEp2 cells.

Acknowledgments

This work was supported by the Foundation of ZhongShan Hospital of Fudan University (2014ZSQN08).

Conflict of Interest

The authors declare no conflict of interest.

REFERENCES

• 1) Obid R, Redlich M, Tomeh C. The treatment of laryngeal cancer. Oral Maxillofac. Surg. Clin. North Am., 31, 1–11 (2019).
• 2) Liu B, Ren Z, Shi Y, Guan C, Pan Z, Zong Z. Activation of signal transducers and activators of transcription 3 and overexpression of its target gene CyclinD1 in laryngeal carcinomas. Laryngoscope, 118, 1976–1980 (2008).
• 3) Lan H, Zhu J, Ai Q, Yang Z, Ji Y, Hong S, Song F, Bu Y. Rapid functional screening of effective siRNAs against Plk1 and its growth inhibitory effects in laryngeal carcinoma cells. BMB Reports, 43, 818–823 (2010).
• 4) Marioni G, Marchese-Ragona R, Cartei G, Marchese F, Staffieri A. Current opinion in diagnosis and treatment of laryngeal carcinoma. Cancer Treat. Rev., 32, 504–515 (2006).
• 5) Thomas L, Drinnan M, Natesh B, Mehanna H, Jones T, Paleri V. Open conservation partial laryngectomy for laryngeal cancer: a systematic review of English language literature. Cancer Treat. Rev., 38, 203–211 (2012).
• 6) Yu H, Lee H, Herrmann A, Buettner R, Jove R. Revisiting STAT3 signalling in cancer: new and unexpected biological functions. Nat. Rev. Cancer, 14, 736–746 (2014).
• 7) Siveen KS, Sikka S, Surana R, Dai X, Zhang J, Kumar AP, Tan BK, Sethi G, Bishayee A. Targeting the STAT3 signaling pathway in cancer: role of synthetic and natural inhibitors. Biochim. Biophys. Acta, 1845, 136–154 (2014).
• 8) Craig SN, Wyatt MD, McInnes C. Current assessment of polo-like kinases as anti-tumor drug targets. Expert Opinion on Drug Discovery, 9, 773–789 (2014).
• 9) Yamamoto Y, Matsuyama H, Kawauchi S, Matsumoto H, Nagao K, Ohmi C, Sakano S, Furuya T, Oga A, Naito K, Sasaki K. Overexpression of polo-like kinase 1 (PLK1) and chromosomal instability in bladder cancer. Oncology, 70, 231–237 (2006).
• 10) Zhang Y, Du XL, Wang CJ, Lin DC, Ruan X, Feng YB, Huo YQ, Peng H, Cui JL, Zhang TT, Wang YQ, Zhang H, Zhan QM, Wang MR. Reciprocal activation between PLK1 and Stat3 contributes to survival and proliferation of esophageal cancer cells. Gastroenterology, 142, 521–530.e3 (2012).
• 11) Bollrath J, Phesse TJ, von Burstin VA, Putoczki T, Bennecke M, Bateman T, Nebelsiek T, Lundgren-May T, Canli O, Schwitalla S, Matthews V, Schmid RM, Kirchner T, Arkan MC, Ernst M, Greten FR. gp130-mediated Stat3 activation in enterocytes regulates cell survival and cell-cycle progression during colitis-associated tumorigenesis. Cancer Cell, 15, 91–102 (2009).
• 12) Knecht R, Elez R, Oechler M, Solbach C, von Ilberg C, Strebhardt K. Prognostic significance of polo-like kinase (PLK) expression in squamous cell carcinomas of the head and neck. Cancer Res., 59, 2794–2797 (1999).
• 13) Grunberger D, Banerjee R, Eisinger K, Oltz EM, Efros L, Caldwell M, Estevez V, Nakanishi K. Preferential cytotoxicity on tumor cells by caffeic acid phenethyl ester isolated from propolis. Experientia, 44, 230–232 (1988).
• 14) Lin WL, Liang WH, Lee YJ, Chuang SK, Tseng TH. Antitumor progression potential of caffeic acid phenethyl ester involving p75(NTR) in C6 glioma cells. Chem. Biol. Interact., 188, 607–615 (2010).
• 15) Wei X, Ma Z, Fontanilla CV, Zhao L, Xu ZC, Taggliabraci V, Johnstone BH, Dodel RC, Farlow MR, Du Y. Caffeic acid phenethyl ester prevents cerebellar granule neurons (CGNs) against glutamate-induced neurotoxicity. Neuroscience, 155, 1098–1105 (2008).
• 16) Noelker C, Bacher M, Gocke P, Wei X, Klockgether T, Du Y, Dodel R. The flavanoide caffeic acid phenethyl ester blocks 6-hydroxydopamine-induced neurotoxicity. Neurosci. Lett., 383, 39–43 (2005).
• 17) Lee YJ, Kuo HC, Chu CY, Wang CJ, Lin WC, Tseng TH. Involvement of tumor suppressor protein p53 and p38 MAPK in caffeic acid phenethyl ester-induced apoptosis of C6 glioma cells. Biochem. Pharmacol., 66, 2281–2289 (2003).
• 18) Jung JE, Kim HS, Lee CS, Park DH, Kim YN, Lee MJ, Lee JW, Park JW, Kim MS, Ye SK, Chung MH. Caffeic acid and its synthetic derivative CADPE suppress tumor angiogenesis by blocking STAT3-mediated VEGF expression in human renal carcinoma cells. Carcinogenesis, 28, 1780–1787 (2007).
• 19) Erjala K, Raitanen M, Kulmala J, Grenman R. Concurrent use of vinorelbine and gefitinib induces supra-additive effect in head and neck squamous cell carcinoma cell lines. J. Cancer Res. Clin. Oncol., 133, 169–176 (2007).
• 20) Yan W, Yu H, Li W, Li F, Wang S, Yu N, Jiang Q. Plk1 promotes the migration of human lung adenocarcinoma epithelial cells via STAT3 signaling. Oncol. Lett., 16, 6801–6807 (2018).
• 21) Dowlati A, Nethery D, Kern JA. Combined inhibition of epidermal growth factor receptor and JAK/STAT pathways results in greater growth inhibition in vitro than single agent therapy. Mol. Cancer Ther., 3, 459–463 (2004).
• 22) Richardson JSM, Aminudin N, Abd Malek SN. Chalepin: a compound from Ruta angustifolia L. Pers exhibits cell cycle arrest at S phase, suppresses nuclear factor-kappa B (NF-kappaB) pathway, signal transducer and activation of transcription 3 (STAT3) phosphorylation and extrinsic apoptotic pathway in non-small cell lung cancer carcinoma (A549). Pharmacognosy Magazine, 13 (Suppl. 3), S489–S498 (2017).
• 23) Strebhardt K, Ullrich A. Targeting polo-like kinase 1 for cancer therapy. Nat. Rev. Cancer, 6, 321–330 (2006).
• 24) Yim H, Erikson RL. Plk1-targeted therapies in TP53- or RAS-mutated cancer. Mutat. Res. Rev. Mutat. Res., 761, 31–39 (2014).
• 25) de Cárcer G, Venkateswaran SV, Salgueiro L, El Bakkali A, Somogyi K, Rowald K, Montanes P, Sanclemente M, Escobar B, de Martino A, McGranahan N, Malumbres M, Sotillo R. Plk1 overexpression induces chromosomal instability and suppresses tumor development. Nat. Commun., 9, 3012 (2018).