Curcumin Down-Regulates Toll-Like Receptor-2 Gene Expression and Function in Human Cystic Fibrosis Bronchial Epithelial Cells

Abstract

Cystic fibrosis (CF), the most common lethal inherited disorder caused by mutation in the gene encoding the CF transmembrane regulator (CFTR), is characterized by chronic inflammation that ultimately leads to death from respiratory failure. In CF patients, up-regulation of toll-like receptor-2 (TLR2), a pattern recognition receptor that senses CF-pathogenic bacteria Staphylococcus aureus peptidoglycan (PGN), in airway epithelial cells is observed, and enhanced proinflammatory responses towards PGN may result in detrimental effects in CF patients. Here, we showed that curcumin, a well known anti-inflammatory agent derived from the curry spice turmeric, inhibits TLR2 expression in CF bronchial epithelial cell line, CFBE41o- cells. Strong suppression of TLR2 gene and protein expression was observed at more than 40 µM of curcumin treatment in CFBE41o- cells. Consistent with decreased expression of TLR2, PGN-dependent interleukin-8 (IL-8) gene up-regulation was markedly reduced by 40 µM of curcumin treatment. Strong reductions of TLR2 gene expression and function were also observed in primary human CF bronchial epithelial cells, but not in human non-CF primary cells. Interestingly, curcumin treatment decreased nuclear expression of transcription factor specificity protein 1 (SP1), a factor that is critical for increased basal TLR2 expression in CF cell line and primary cells. Finally, curcumin-dependent SP1 reduction was diminished by anti-oxidant N-acetylcystein (NAC) and proteasomal inhibitor MG-132, suggesting the crucial roles of oxidative and proteasomal degradation pathways. Taken together, our study shows that curcumin down-regulates TLR2 gene expression and function in CF bronchial epithelial cells possibly by accelerating SP1 degradation via an oxidative process.

INTRODUCTION

Cystic fibrosis (CF) is the most common lethal inherited disorder caused by mutation in the gene encoding the CF transmembrane regulator (CFTR).¹⁾ Because CFTR is a cyclic AMP-dependent Cl⁻ channel that controls fluid and ion transport across the lung epithelium, its expression and function are crucial for maintenance of mucus clearance that restricts microbial infections.²⁾ In CF airway, CFTR defect causes an impaired mucociliary clearance and recurrent pulmonary infection, which exacerbates hyperinflammatory phenotype that is strongly associated with CF morbidity and mortality.^1,2) Thus, identification of the molecules that can be targeted to dampen an overexuberant inflammatory response in CF airway is urgently needed. One of the candidate inflammatory genes that is dysregulated in CF airway is the innate immune molecule toll-like receptor-2 (TLR2). Muir et al.³⁾ and Firoved et al.⁴⁾ showed up-regulation of TLR2 gene in CF airway epithelial cells. Moreover, we have also reported that expression and function of TLR2 are increased by specificity protein 1 (SP1)-dependent epigenetic mechanism in CF airway epithelial cells.^5,6) Despite the idea that TLR2 up-regulation is responsible for the CF-associated enhanced proinflammatory responses, the agents that control dysregulated expression of TLR2 in CF airway has yet to be determined.

Curcumin is the major bioactive compound in turmeric (Curcuma longa) and has multiple biological activities. Among its many effects, anti-inflammatory effects of curcumin are well recognized, thereby it has been widely used in folk medicine for the therapy of inflammatory diseases.⁷⁾ Numerous molecular targets of curcumin, including transcription factors, cytokines and enzymes that are related to inflammation, have been identified thus far.⁷⁾ Interestingly, we have revealed that curcumin decreases TLR2 expression and function in TLR2-expressing innate immune cells including human monocytic cells and neutrophilic cells.⁸⁾ Furthermore, curcumin-dependent TLR2 suppression and its benefits were confirmed in several experimental disease models, such as hepatic,⁹⁾ cardiac¹⁰⁾ and brain¹¹⁾ injury models. This led us to hypothesize that dysregulated expression and function of TLR2 in CF airway epithelial cells can be also down-modulated by curcumin treatment.

The present study shows that curcumin inhibits TLR2 expression and function in CF bronchial epithelial cell line, CFBE41o- cells as well as primary human CF bronchial epithelial cells. The mechanism underlying curcumin-dependent TLR2 suppression may involve degradation and downregulation of SP1, a factor that is critical for increased basal TLR2 expression in CF cell line and primary cells, via curcumin-dependent oxidative process. The study shows that curcumin may also be an agent that controls infection-associated inflammation in CF airway.

MATERIALS AND METHODS

Reagents

Peptidoglycan (PGN) from Staphylococcus aureus was purchased from Fluka (Buchs, Switzerland).^5,6) Curcumin, mithramycin A and N-acetylcystein (NAC) were purchased from Sigma (St. Louis, MO, U.S.A.).⁸⁾ MG-132 was purchased from Calbiochem (La Jolla, CA, U.S.A.).

Cell Culture and Curcumin Treatment

The human bronchial epithelial CFBE41o- was previously generated and grown in fibronectin/bovine serum albumin (BSA)-coated dishes.¹²⁾ These cells were maintained in minimum essential medium (MEM) supplemented with 10% fetal bovine serum, 100 U/mL of penicillin, and 100 mg/mL of streptomycin. Primary human normal (healthy donor-derived; NHBE, Lot# 235243, 32Y, Female, Caucasian) and CF (CF patients-derived, DHBE-CF, Lot#222158, 28Y, Female, Caucasian) bronchial epithelial cells were purchased from TaKaRa (Shiga, Japan) and maintained as described previously.¹³⁾ These primary bronchial epithelial cells are isolated from normal and CF human donors in accordance with all informed consent rules and regulations based on manufacturer’s information. All cells were cultured in a humidified incubator at 37°C with 5% CO₂. For curcumin treatment, cells were incubated with the indicated dose for the indicated time periods. No cellular toxicity was observed in curcumin-treated bronchial epithelial cell lines and primary cells at any concentrations tested, as determined by microscopy analysis.

RNA Isolation, cDNA Synthesis and Real-Time Quantitative RT-PCR Analysis

Total RNA from the cells was isolated using RNAiso plus^® reagent (TaKaRa) according to the recommended protocol.¹³⁾ RNA isolation, cDNA synthesis and real-time quantitative RT-PCR analysis were performed using protocols that were previously reported. Real-time quantitative RT-PCR analysis of TLR2, interleukin-8 (IL-8), glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and 18s ribosomal RNA (18srRNA) was performed in an iCycler thermal cycler (Bio-Rad) with an iQ5 qRT-PCR detection system (Bio-Rad) using SYBR^® Premix Ex Taq™ II (Perfect Real Time) (TaKaRa). PCR amplifications were performed with the following amplification conditions: 95°C for 3 min, for 40 cycles at 95°C for 10 s (denaturation step), at 60°C for 1 min (annealing/extension steps). The relative quantity of target genes was normalized using either human GAPDH and 18srRNA genes as the internal controls and expressed as the relative quantity of target genes (fold induction). Primers used for real-time quantitative RT-PCR are shown in Table 1.

Table 1. Quantitative RT-PCR Primer (5′→3′)

TLR2	FW	AGGCGGACATCCTGAACCT
	RV	GGCCAGCAAATTACCTGTGTG
IL-8	FW	CTTTGGCAAAACTGCACCTT
	RV	CTGGCCGTGGCTCTCTTG
SP1	FW	GCCGCTCCCAACTTACAGAA
	RV	CCCATCAACGGTCTGGAACT
GAPDH	FW	GGCAGAGATGATGACCCTTTT
	RV	TCCACTGGCGTCTTCACC
18srRNA	FW	CGGCTACCACATCCAAGGAA
	RV	GCTGGAATTACCGCGGCT

Flowcytometry

Cell surface expression of TLR2 was determined by flowcytometry as previously described.⁸⁾ Briefly, CFBE41o- cells were plated in 6-cm tissue culture dish in MEM and treated with or without curcumin. Cells were detached with 0.25% of trypsin and were centrifuged. Washed cells were prepared at a concentration of 1.0 × 10⁶ cells/sample, and cell surface staining was performed using monoclonal mouse anti-TLR2 antibody (T2.5) (ab16894; Abcam, Cambridge, MA, U.S.A.), followed by staining with Alexa Fluor^® 488 goat anti-mouse immunoglobulin G (IgG) (H + L) (A28175; Invitrogen, Carlsbad, CA, U.S.A.). Antibodies-stained cells were analyzed by flowcytometry in a FACSCalibur flow cytometer (BD Biosciences, San Jose, CA, U.S.A.) using a 488 nm argon excitation laser.

Western Blotting

SP1 protein expression was assayed as previously described.¹⁴⁾ Equal amounts of nuclear protein extract were fractionated by 7.5% SDS-polyacrylamide gel electrophoresis and transferred to polyvinylidene difluoride membrane (Millipore, Bedford, MA, U.S.A.). The membrane was blocked with PBS-T (PBS, 0.1% (v/v) Tween 20) and 5% nonfat milk. Detection of SP1 and actin with anti-SP1 rabbit polyclonal antibody (sc-59) and anti-actin polyclonal goat antibody (sc-1616) (Santa Cruz Biotechnology, Santa Cruz, CA, U.S.A.) was carried out as described.

Statistical Analysis

For statistical analysis, the data were analyzed by one-way ANOVA with Dunnett’s or Tukey–Kramer multiple comparison test, or Student’s t-test (JMP software, SAS Institute, Cary, NC, U.S.A.) as indicated in each figure legend.

RESULTS

Curcumin Suppresses the mRNA Expression of TLR2 in CFBE41o- Cells

To determine the effect of curcumin on the regulation of TLR2 gene expression in CF bronchial epithelial cells, we treated CFBE41o- cells with curcumin and evaluated the expression level of TLR2 gene by quantitative real-time RT-PCR. As shown in Fig. 1, after the treatment of CFBE41o- cells with curcumin, TLR2 mRNA expression was greatly decreased at concentrations of curcumin in the range 40–60 µM, despite the slight but not significant increase at low concentration (10–20 µM) of curcumin (Fig. 1A). Curcumin-dependent TLR2 down-regulation was also time-dependent, and maximum reduction of TLR2 mRNA expression (approximately 80%) with 40 µM curcumin was detected 6–12 h after cellular stimulation (Fig. 1B).

Fig. 1. Curcumin Suppresses the Expression of TLR2 mRNA in CFBE41o- Cells

CFBE41o- cells were incubated with the indicated dose of curcumin for 12 h (A) or at 40 µM for the indicated time periods (B) and then quantitative real time RT-PCR was performed using isolated RNA to determine the level of TLR2 mRNA. TLR2 mRNA levels were normalized to the level of GAPDH mRNA. Results represent the mean ± standard error of the mean (S.E.M.) performed in triplicate. * p < 0.05, ** p < 0.005, *** p < 0.0005, n.s.; not significant (vs. DMSO-treated CFBE41o- cells); Dunnett’s test.

Curcumin Suppresses the Surface Protein Expression and Function of TLR2 in CFBE41o- Cells

Having demonstrated that curcumin down-regulates TLR2 mRNA in CFBE41o- cells, we next confirmed whether curcumin also affects protein expression and function of TLR2. Flow cytometric analysis showed the decreased cell surface expression of TLR2 in curcumin (40 µM)-treated CFBE41o- cells (Fig. 2A), suggesting that curcumin also suppresses the protein expression of TLR2 in CFBE41o- cells. We next evaluated the level of TLR2 ligand-responsiveness by analyzing the induction of IL-8 mRNA after the treatment with well-known TLR2 ligand, peptidoglycan (PGN) derived from Gram-positive bacteria. As shown in Fig. 2B, treatment with PGN for 1 h induced IL-8 expression in a dose-dependent manner (Fig. 2B, dimethyl sulfoxide (DMSO)). Pretreatment of these cells with 40 µM of curcumin, but not with 20 µM, suppressed PGN-induced IL-8 induction (Fig. 2B, Cur 20 and Cur 40 µM). These are consistent with the data on the decreased expression of TLR2 in 40 µM of curcumin-treated CFBE41o- cells. Thus, our data show that curcumin suppresses the responsiveness of these cells to TLR2 ligand exposure, which is likely caused by a decrease of TLR2 gene and protein expression.

Fig. 2. Curcumin Suppresses Surface Protein Expression and Function of TLR2 in CFBE41o- Cells

(A) Curcumin (20 or 40 µM, 12 h)-treated or non-treated CFBE41o- cells were incubated with either anti-TLR2 antibody or normal mouse IgG, then stained with secondary Alexa Fluor^® 488-labeled antibody, and analyzed by flow cytometry. Each cell type was stained with normal mouse IgG for normalization. (B) CFBE41o- cells were treated with the indicated dose of curcumin for 8 h, and then stimulated with TLR2 ligand PGN for 4 h. IL-8 mRNA levels were measured by quantitative real-time RT-PCR and normalized to the level of GAPDH. Result represents the mean ± S.E.M. performed in triplicate. ** p < 0.005, *** p < 0.0005, n.s.; not significant (vs. PGN-nontreated CON cells); Dunnett’s test. (Color figure can be accessed in the online version.)

Curcumin Suppresses the Expression and Function of TLR2 in CF Patients-Derived Bronchial Epithelial Cells

To exclude the possibility that the effect of curcumin is only observed in cell lines, we evaluated the effect of curcumin on the TLR2 gene expression in primary bronchial epithelial cells derived from CF patient (DHBE-CF). As shown in Fig. 3, significant decrease of TLR2 gene expression at >20 µM was also observed in DHBE-CF cells (Fig. 3A). Consistently, pretreatment of these cells with 40 µM of curcumin suppressed PGN-induced IL-8 up-regulation (Fig. 3B), demonstrating that curcumin also suppresses the expression and function of TLR2 in CF primary cells. On the other hand, the level of TLR2 expression in healthy donor-derived bronchial epithelial NHBE cells was not decreased by curcumin treatment (Supplementary Fig. 1A). Of note, 40 µM curcumin slightly but significantly increased the TLR2 mRNA expression in these cells in an as-yet undefined mechanism.

Fig. 3. Curcumin Suppresses the Expression and Function of TLR2 mRNA in Primary Human CF Bronchial Epithelial Cells

(A) Primary human bronchial epithelial cells-derived from CF patient (DHBE-CF) were treated with the indicated dose of curcumin for 12 h and then quantitative real-time PCR was performed using isolated mRNA. TLR2 mRNA levels were normalized to the level of 18srRNA mRNA. * p < 0.05, ** p < 0.005, *** p < 0.0005 (vs. DMSO-treated DHBE-CF cells); Dunnett’s test. (B) DHBE-CF cells were treated with curcumin (40 µM) for 8 h, and then stimulated with TLR2 ligand PGN for 4 h. IL-8 mRNA levels were measured by quantitative real-time RT-PCR and normalized to the level of GAPDH. ** p < 0.005, n.s.; not significant (vs. PGN-nontreated CON cells); Student’s t-test. Results represent the mean ± S.E.M. performed in triplicate.

Curcumin Down-Regulates TLR2 Gene Expression and Function in CF Bronchial Epithelial Cells by Suppressing SP1

In our previous study, we have shown the importance of SP1 transcription factor for the increased expression of TLR2 in CF epithelial cells.⁶⁾ As shown in Fig. 4A, the quantitative RT-PCR data revealed that treatment of CFBE41o- cells with mithramycin A, an SP1 inhibitor, suppressed the TLR2 mRNA expression, confirming a positive role of SP1 in the regulation of TLR2 gene in CFBE41o- cells. To assess if SP1 expression is regulated by curcumin in CFBE41o- cells, we evaluated the effect of curcumin on the SP1 gene and protein expression. Interestingly, although SP1 gene expression was not affected by curcumin treatment (Fig. 4B), decreased SP1 protein expression in the nucleus was observed in a treatment time-dependent manner in CFBE41o- cells (Fig. 4C). Curcumin-dependent reduction in SP1 protein expression was also observed in primary DHBE-CF cells (Fig. 4D). Based on our finding on curcumin-dependent TLR2 suppression in CF bronchial epithelial cells (Figs. 1–3) and previous findings on curcumin-dependent SP1 suppression,^15–17) we therefore postulated that curcumin may inhibit TLR2 gene expression via the suppression of its positive regulatory molecule, SP1. Our hypothesis was supported by the result shown in Figs. 4E and 4F that curcumin no longer enhances mithramycin A-dependent TLR2 down-regulation in human CF bronchial cell line and primary cells, respectively, suggesting that curcumin and mithramycin A may target the same SP1-involved pathway. Thus, our data demonstrate that curcumin decreases TLR2 gene expression likely by suppressing SP1 transcription factor.

Fig. 4. Curcumin Suppresses the Expression of Nuclear SP1 Protein That Contributes to TLR2 Reduction in CF Bronchial Epithelial Cells

(A) CFBE41o- cells were untreated or treated with mithramycin A (0.5, 1, 5 µM) for 24 h. TLR2 mRNA levels were measured by quantitative real-time RT-PCR and normalized to the level of 18srRNA mRNA. *** p < 0.0005 (vs. DMSO-treated CFBE41o- cells); Dunnett’s test. (B) CFBE41o- cells were treated with curcumin (40 µM) or DMSO for 12 h. SP1 mRNA levels were measured by quantitative real-time RT-PCR and normalized to level the of 18srRNA mRNA. n.s.; not significant (vs. DMSO-treated CFBE41o- cells); Student’s t-test. (C, D) CFBE41o- (C) and DHBE-CF (D) cells were treated with DMSO or curcumin (40 µM) for the indicated time periods, and nuclear proteins were harvested for Western blotting analysis with anti-SP1 and anti- actin (internal control) antibodies. (E, F) CFBE41o- (E) and DHBE-CF (F) cells were untreated or treated with mithramycin A for 24 h and/or curcumin for 12 h. TLR2 mRNA levels were measured by quantitative real-time RT-PCR and normalized to the level of 18srRNA mRNA. * p < 0.05, ** p < 0.005, *** p < 0.0005 (vs. DMSO-treated cells); Dunnett’s test. For quantitative RT-PCR analysis, result represents the mean ± S.E.M. performed in triplicate.

Oxidative and Proteasomal Degradation Pathways Are Responsible for Curcumin-Dependent SP1 Reduction in CF Bronchial Epithelial Cells

We investigated whether curcumin-induced TLR2 suppression is involved in pro-oxidant properties of curcumin as previously shown in monocytes and neutrophils.⁸⁾ To examine this possibility, CFBE41o- cells were treated with anti-oxidant N-acetylcystein (NAC). As shown in Fig. 5A, NAC effectively blocked TLR2 down-regulation by curcumin, suggesting that curcumin-induced TLR2 suppression depends on the curcumin-associated formation of reactive metabolite in CFBE41o- cells. We further examined whether curcumin decreases SP1 expression by induction of curcumin-associated reactive metabolite. The Western blot result showed that NAC pretreatment blunts curcumin-induced SP1 reduction (Fig. 5B, NAC), suggesting that curcumin-induced production of reactive metabolite causes SP1 decrease, which may result in the reduction of TLR2 expression. Finally, because increasing evidence suggests that curcumin potentiates proteasomal degradation of certain proteins,^18–20) we assessed the possible involvement of proteasomal degradation pathway in curcumin-dependent SP1 down-regulation. Notably, pretreatment with proteasomal inhibitor MG-132, a peptidyl-aldehyde proteasome inhibitor, rescued SP1 expression under curcumin-treated condition (Fig. 5B, MG-132), indicating that curcumin accelerates proteasomal degradation of SP1 protein, resulting in TLR2 down-regulation in CF cells.

Fig. 5. Curcumin-Induced TLR2 Suppression Is Attenuated by the Anti-oxidant and Proteasomal Inhibitor

(A) CFBE41o- cells were incubated with curcumin (40 µM) and NAC (1, 10 mM) for 12 h and then quantitative real-time RT-PCR was performed using isolated RNA to determine the level of TLR2 mRNA. TLR2 mRNA levels were normalized to the level of 18s rRNA mRNA. Result represents the mean ± S.E.M. performed in triplicate. * p < 0.05, ** p < 0.005, n.s.; not significant (vs. DMSO-treated cells); Tukey–Kramer test. (B) CFBE41o- cells were treated with DMSO, NAC (10 mM) or MG-132 (10 µM) for 1 h prior to curcumin (40 µM) treatment for 6 h, and nuclear proteins were harvested for Western blotting analysis with anti-SP1 and anti-actin (internal control) antibodies.

DISCUSSION

TLR2 homodimer or heterodimer in association with TLR1 or TLR6 are innate immune receptor complex that recognizes Gram-positive bacterial molecules such as lipopeptides, lipoteichoic acids, and PGN.²¹⁾ TLR2 is highly expressed in sentinel immune cells, including neutrophils, dendritic cells, monocytes and macrophages²²⁾; however, its basal expression in epithelial cells is basically kept at lower level. Importantly, we and others have shown that TLR2 expression and function are increased in CF airway epithelial cells possibly due to intrinsic inflammation^23–25) and/or CFTR defect-dependent epigenetic regulation.^5,6) The latter mechanism involves mithramycin A-sensitive SP1-dependent transcriptional machinery as we previously described.⁶⁾ The present study reveals that curcumin is a potent TLR2 inhibitor in CF bronchial epithelial cells, possibly through its suppressive effect on the basal expression of transcription factor SP1. Based on the previous findings that curcumin could target several key molecules involved in CF airway inflammation such as nuclear factor (NF)-κB and activating protein-1 (AP-1), and that curcumin also has a potential to correct defective CFTR protein folding in CF airway, our findings further support the idea on the usefulness of curcumin for inflammatory management in CF patients.

Our study provides mechanistically unique aspects that identify oxidative process and proteasomal degradation pathways for curcumin-dependent SP1 suppression. We have previously shown that high concentration, but not low concentration, of curcumin treatment decreases TLR2 gene expression in monocytic and neutrophilic cells,⁸⁾ consistent with present study. Similar biphasic effects of curcumin on its target gene regulation has been demonstrated in many studies.^26,27) On the other hand, curcumin-dependent protein degradation has been well described mainly in cancer biology. For example, curcumin inhibits human immunodeficiency virus-1 (HIV-1) by promoting Tat protein degradation.¹⁸⁾ Curcumin stimulates AMP-activated protein kinase (AMPK) activity, which accelerates the autophagy–lysosomal protein degradation pathway with Akt degradation in breast cancer cells.²⁸⁾ More importantly, curcumin induces proteasome-dependent down-regulation of SP1, SP3, and SP4 in bladder cancer cells.¹⁷⁾ Thus, oxidative process and proteasomal degradation pathways are likely crucial for curcumin’s mechanism of action. Our study could not ascertain whether these pathways act separately or collaboratively; however, the finding by Hsin et al., uniquely shows that curcumin-dependent oxidative signal results in proteasomal degradation of SP1 in human lung adenocarcinoma A549 cells,¹⁶⁾ supporting the idea of curcumin-oxidative process-SP1 degradation axis as a general pathway in airway epithelial cells.

Overall, our data demonstrate that curcumin inhibits TLR2 gene expression and function possibly via an oxidative process in CF bronchial epithelial cell line and primary cells. We also show the possible involvement of oxidative process-SP1 degradation axis by curcumin, that causes TLR2 suppression in CF airway epithelial cells. Because curcumin’s oral bioavailability is extremely poor due to low-aqueous solubility, rapid systemic clearance, inadequate tissue absorption and degradation at alkaline pH values,²⁹⁾ development of curcumin derivatives or curcumin delivery system with better pharmacokinetics and safety would be necessary for future application in CF therapy.

Acknowledgments

This work was supported by the Japan Society for the Promotion Science (JSPS) KAKENHI (Grant Numbers JP25460102 and JP17H03570 [to T.S.], and JP15J09420 [to S.K.]), the JSPS Program on Strategic Young Researcher Overseas Visits Program for Accelerating Brain Circulation (Grant Number S2510 [to H.K.]), and the Program for Leading Graduate Schools HIGO (Health life science: Interdisciplinary and Glocal Oriented; Ministry of Education, Culture, Sports, Science and Technology (MEXT) of Japan.

Conflict of Interest

The authors declare no conflict of interest.

Supplementary Materials

The online version of this article contains supplementary materials.

REFERENCES

• 1) Elborn JS. Cystic fibrosis. Lancet, 388, 2519–2531 (2016).
• 2) Haq IJ, Gray MA, Garnett JP, Ward C, Brodlie M. Airway surface liquid homeostasis in cystic fibrosis: Pathophysiology and therapeutic targets. Thorax, 71, 284–287 (2016).
• 3) Muir A, Soong G, Sokol S, Reddy B, Gomez MI, Van Heeckeren A, Prince A. Toll-like receptors in normal and cystic fibrosis airway epithelial cells. Am. J. Respir. Cell Mol. Biol., 30, 777–783 (2004).
• 4) Firoved AM, Ornatowski W, Deretic V. Microarray analysis reveals induction of lipoprotein genes in mucoid Pseudomonas aeruginosa: implications for inflammation in cystic fibrosis. Infect. Immun., 72, 5012–5018 (2004).
• 5) Shuto T, Furuta T, Oba M, Xu H, Li J-D, Cheung J, Gruenert DC, Uehara A, Suico MA, Okiyoneda T, Kai H. Promoter hypomethylation of Toll-like receptor-2 gene is associated with increased proinflammatory response toward bacterial peptidoglycan in cystic fibrosis bronchial epithelial cells. FASEB J., 20, 782–784 (2006).
• 6) Furuta T, Shuto T, Shimasaki S, Ohira Y, Suico MA, Gruenert DC, Kai H. DNA demethylation-dependent enhancement of toll-like receptor-2 gene expression in cystic fibrosis epithelial cells involves SP1-activated transcription. BMC Mol. Biol., 9, 39 (2008).
• 7) Abdollahi E, Momtazi AA, Johnston TP, Sahebkar A. Therapeutic effects of curcumin in inflammatory and immune-mediated diseases: a nature-made jack-of-all-trades? J. Cell. Physiol., 233, 830–848 (2018).
• 8) Shuto T, Ono T, Ohira Y, Shimasaki S, Mizunoe S, Watanabe K, Suico MA, Koga T, Sato T, Morino S, Sato K, Kai H. Curcumin decreases toll-like receptor-2 gene expression and function in human monocytes and neutrophils. Biochem. Biophys. Res. Commun., 398, 647–652 (2010).
• 9) Tu CT, Han B, Yao QY, Zhang YA, Liu HC, Zhang SC. Curcumin attenuates Concanavalin A-induced liver injury in mice by inhibition of Toll-like receptor (TLR) 2, TLR4 and TLR9 expression. Int. Immunopharmacol., 12, 151–157 (2012).
• 10) Kim YS, Kwon JS, Cho YK, Jeong MH, Cho JG, Park JC, Kang JC, Ahn Y. Curcumin reduces the cardiac ischemia-reperfusion injury: involvement of the toll-like receptor 2 in cardiomyocytes. J. Nutr. Biochem., 23, 1514–1523 (2012).
• 11) Tu XK, Yang WZ, Chen JP, Chen Y, Ouyang LQ, Xu YC, Shi SS. Curcumin inhibits TLR2/4-NF-κB signaling pathway and attenuates brain damage in permanent focal cerebral ischemia in rats. Inflammation, 37, 1544–1551 (2014). Meｃdline
• 12) Cozens AL, Yezzi MJ, Kunzelmann K, Ohrui T, Chin L, Eng K, Finkbeiner WE, Widdicombe JH, Gruenert DC. CFTR expression and chloride secretion in polarized immortal human bronchial epithelial cells. Am. J. Respir. Cell Mol. Biol., 10, 38–47 (1994).
• 13) Kamei S, Fujikawa H, Nohara H, Ueno-Shuto K, Maruta K, Nakashima R, Kawakami T, Matsumoto C, Sakaguchi Y, Ono T, Suico MA, Boucher RC, Gruenert DC, Takeo T, Nakagata N, Li JD, Kai H, Shuto T. Zinc deficiency via a splice switch in zinc importer ZIP2/SLC39A2 causes cystic fibrosis-associated MUC5AC hypersecretion in airway epithelial cells. EBioMedicine, 27, 304–316 (2017).
• 14) Ueno-Shuto K, Kato K, Tasaki Y, Sato M, Sato K, Uchida Y, Sakai H, Ono T, Suico MA, Mitsutake K, Tokutomi N, Kai H, Shuto T. Lipopolysaccharide decreases single immunoglobulin interleukin-1 receptor-related molecule (SIGIRR) expression by suppressing specificity protein 1 (Sp1) via the toll-like receptor 4 (TLR4)-p38 pathway in monocytes and neutrophils. J. Biol. Chem., 289, 18097–18109 (2014).
• 15) Jutooru I, Chadalapaka G, Lei P, Safe S. Inhibition of NFκB and pancreatic cancer cell and tumor growth by curcumin is dependent on specificity protein down-regulation. J. Biol. Chem., 285, 25332–25344 (2010).
• 16) Hsin IL, Sheu GT, Chen HH, Chiu LY, Wang HD, Chan HW, Hsu CP, Ko JL. N-acetyl cysteine mitigates curcumin-mediated telomerase inhibition through rescuing of Sp1 reduction in A549 cells. Mutat. Res. -. Fundam. Mol. Mech. Mutagen., 688, 72–77 (2010).
• 17) Chadalapaka G, Jutooru I, Chintharlapalli S, Papineni S, Smith R 3rd, Li X, Safe S. Curcumin decreases specificity protein expression in bladder cancer cells. Cancer Res., 68, 5345–5354 (2008).
• 18) Ali A, Banerjea AC. Curcumin inhibits HIV-1 by promoting Tat protein degradation. Sci. Rep., 6, 27539 (2016).
• 19) Pongrakhananon V, Nimmannit U, Luanpitpong S, Rojanasakul Y, Chanvorachote P. Curcumin sensitizes non-small cell lung cancer cell anoikis through reactive oxygen species-mediated Bcl-2 downregulation. Apoptosis, 15, 574–585 (2010).
• 20) Aggarwal BB, Banerjee S, Bharadwaj U, Sung B, Shishodia S, Sethi G. Curcumin induces the degradation of cyclin E expression through ubiquitin-dependent pathway and up-regulates cyclin-dependent kinase inhibitors p21 and p27 in multiple human tumor cell lines. Biochem. Pharmacol., 73, 1024–1032 (2007).
• 21) Kirschning CJ, Schumann RR. TLR2: cellular sensor for microbial and endogenous molecular patterns. Curr. Top. Microbiol. Immunol., 270, 121–144 (2002).
• 22) Shuto T, Furuta T, Cheung J, Gruenert DC, Ohira Y, Shimasaki S, Suico MA, Sato K, Kai H. Increased responsiveness to TLR2 and TLR4 ligands during dimethylsulfoxide-induced neutrophil-like differentiation of HL-60 myeloid leukemia cells. Leuk. Res., 31, 1721–1728 (2007).
• 23) Xu Y, Clark JC, Aronow BJ, Dey CR, Liu C, Wooldridge JL, Whitsett JA. Transcriptional adaptation to cystic fibrosis transmembrane conductance regulator deficiency. J. Biol. Chem., 278, 7674–7682 (2003).
• 24) Ogilvie V, Passmore M, Hyndman L, Jones L, Stevenson B, Wilson A, Davidson H, Kitchen RR, Gray RD, Shah P, Alton EW, Davies JC, Porteous DJ, Boyd AC. Differential global gene expression in cystic fibrosis nasal and bronchial epithelium. Genomics, 98, 327–336 (2011).
• 25) Clarke LA, Botelho HM, Sousa L, Falcao AO, Amaral MD. Transcriptome meta-analysis reveals common differential and global gene expression profiles in cystic fibrosis and other respiratory disorders and identifies CFTR regulators. Genomics, 106, 268–277 (2015).
• 26) Kang J, Chen J, Shi Y, Jia J, Zhang Y. Curcumin-induced histone hypoacetylation: The role of reactive oxygen species. Biochem. Pharmacol., 69, 1205–1213 (2005).
• 27) Kim MS, Kang HJ, Moon A. Inhibition of invasion and induction of apoptosis by curcumin in H-ras-transformed MCF10A human breast epithelial cells. Arch. Pharm. Res., 24, 349–354 (2001).
• 28) Guan F, Ding Y, Zhang Y, Zhou Y, Li M, Wang C. Curcumin suppresses proliferation and migration of MDA-MB-231 breast cancer cells through autophagy-dependent Akt degradation. PLOS ONE, 11, e0146553 (2016).
• 29) Di Martino P, Censi R, Gigliobianco MR, Zerrillo L, Magnoni F, Agas D, Quaglia W, Lupidi G. Nano-medicine improving the bioavailability of small molecules for the prevention of neurodegenerative diseases. Curr. Pharm. Des., 23, 1897–1908 (2017).