Biological and Pharmaceutical Bulletin
Online ISSN : 1347-5215
Print ISSN : 0918-6158
ISSN-L : 0918-6158
Regular Articles
Field Survey of Ephedra Plants in Central Asia (1). Characterization of Ephedra equisetina, Ephedra intermedia, and Their Putative Hybrids Collected in the Zaravshan Mountains of Tajikistan
Hiroaki Hayashi Musavvara ShukurovaShihoko OikawaMinami OhtaIsao FujiiFiruza NasyrovaKurbon AlievHikmat HisorievInoyat FattokhovMadibron Saidov
Author information
JOURNAL FREE ACCESS FULL-TEXT HTML

2019 Volume 42 Issue 4 Pages 552-560

Details
Abstract

Field surveys of Ephedra plants were conducted in the Zaravshan Mountains of Tajikistan. E. equisetina, E. intermedia, and their putative hybrids were collected. They were identified based on their phenotypes and their sequences of nuclear ribosomal DNA internal transcribed spacer 1 (ITS1) region. Sequencing and species-specific PCR analyses of their ITS1 sequences revealed six putative hybrids of E. equisetina and E. intermedia. The total ephedrine and pseudoephedrine content of most of the Ephedra samples collected in Tajikistan were higher than the 0.7% lower limit prescribed by the Japanese pharmacopoeia, 17th edition (JP17), and varied from 0.34 to 3.21% by dry weight. The total alkaloid level of E. intermedia (11E08-1) cultivated in Japan varied from 1.77 to 2.30% by dry weight, which was much higher than the 0.7% lower limit prescribed by JP17.

INTRODUCTION

Ephedra herb contains ephedrine (Ep) and pseudoephedrine (PEp), which are effective in treating asthma and nasal congestion.1) Ephedra herb is also an important ingredient in traditional Japanese Kampo prescriptions used to treat influenza, cough, nasal congestion, and obesity.24) Three Ephedra species, E. sinica STAPF., E. intermedia SCHRENK et C. A. MEY., and E. equisetina BUNGE, have been recorded in the Japanese pharmacopoeia 17th edition (JP17).5) All Ephedra herbs used in Japanese Kampo prescriptions are imported from China. However, the natural Chinese Ephedra resources have been rapidly depleted because of habitat destruction.6)

Tajikistan is a landlocked Central Asian country. Among the three Ephedra species recorded in JP17, E. intermedia and E. equisetina are distributed in Tajikistan.710) Ephedra herb was collected in Tajikistan during the Soviet Union era for pharmaceutical production. In 1981, Japan imported 68 t of Ephedra herb from the former Soviet Union.11) Currently, however, Ephedra herb is no longer harvested in Tajikistan. Although Tajikistan is one of the most important habitats of Ephedra plants worldwide, the characteristics of Ephedra plants growing here have not yet been closely investigated. Thus, in the present study, field surveys were performed to characterize the Ephedra plants of Tajikistan.

MATERIALS AND METHODS

Plant Materials

Field surveys of Ephedra plants were conducted in the Zaravshan Mountains of Tajikistan (Fig. 1). The herbaceous stems and seeds used in the present study were collected as shown in Fig. 1 and Table 1. E. equisetina (Fig. 2A), E. intermedia (Fig. 2B), and their putative hybrids were collected and identified in field surveys. The plants were identified by Hiroaki Hayashi according to their phenotypic traits based on the descriptions of the Flora of the former U.S.S.R,7) Tajikistan,8,9) and China.10) The Ephedra specimens collected in the present study were deposited in the Herbarium of the Institute of Botany, Plant Physiology, and Genetics of the Academy of Science of Tajikistan.

Fig. 1. Ephedra Collection Sites in Tajikistan

Dotted lines on the map indicate the field survey route in Tajikistan.

Table 1. Ephedra Plants Collected in Tajikistan
Plant No.Herbarium accession No.Collection site coordinatesITS1 genotype by sequencingSpecies-specific PCRSpecies
GPS dataAltitude (m)E. equisetinaE. intermedia
11E016855939°07′32.01″N/68°51′46.56″E2390 mITS1-EE2E. equisetina
11E026856039°07′46.14″N/68°51′49.56″E2380 mITS1-EE1E. equisetina
11E036861139°07′52.60″N/68°51′46.73″E2270 mITS1-EI1E. intermedia
11E046861239°10′18.30″N/68°47′32.21″E2090 mITS1-EI1E. intermedia
11E056861339°11′43.78″N/68°38′48.78″E1870 mITS1-EI1E. intermedia
11E066861439°11′33.76″N/68°37′56.15″E2020 mITS1-EI1E. intermedia
11E076861539°11′17.54″N/68°37′41.17″E2100 mITS1-EI1E. intermedia
11E086861639°11′18.34″N/68°37′40.90″E2100 mITS1-EI1E. intermedia
11E096856139°11′09.85″N/68°37′43.18″E2130 mITS1-EE3E. equisetina
11E106861739°10′30.36″N/68°37′40.53″E2270 mITS1-EI1E. intermedia
12E136862539°5′13.41″N/68°23′40.54″E2380 mITS1-EI1E. intermedia
12E146856339°3′3.84″N/68°18′18.61″E2400 mITS1-EE3E. equisetina
12E156856439°3′0.93″N/68°18′20.49″E2400 mITS1-EE3E. equisetina
12E166862639°03′27.97″N/68°20′35.48″E2250 mITS1-EI1E. intermedia
12E176866839°03′30.55″N/68°20′50.79″E2210 mMIXPutative hybrid
12E186856539°03′30.55″N/68°20′50.79″E2210 mITS1-EE3E. equisetina
12E196856639°03′30.55″N/68°20′50.79″E2210 mITS1-EE1E. equisetina
12E206856739°5′10.71″N/68°22′13.24″E2220 mITS1-EE4E. equisetina
12E216856839°5′9.84″N/68°22′17.55″E2220 mITS1-EE1E. equisetina
12E226856939°05′3.43″N/68°23′28.84″E2380 mITS1-EE3E. equisetina
12E276857239°10′18.59″N/68°47′33.06″E2090 mITS1-EE5Putative hybrid
12E316863139°08′28.29″N/68°39′43.15″E2460 mITS1-EI1E. intermedia
12E326863239°08′29.31″N/68°39′43.47″E2460 mITS1-EI1E. intermedia
12E376857439°06′15.03″N/68°24′29.79″E2020 mITS1-EE3E. equisetina
12E396857539°05′03.36″N/68°23′29.11″E2380 mITS1-EE1E. equisetina
12E416857739°05′03.52″N/68°23′28.89″E2380 mITS1-EE1E. equisetina
12E446858039°02′57.57″N/68°18′20.85″E2400 mMIXPutative hybrid
12E456858139°02′56.86″N/68°18′19.90″E2400 mITS1-EE1E. equisetina
12E466858239°02′57.12″N/68°18′20.05″E2400 mITS1-EE3E. equisetina
12E476858339°02′55.93″N/68°18′19.65″E2400 mITS1-EE5E. equisetina
12E486863639°03′31.53″N/68°20′29.80″E2320 mITS1-EI1E. intermedia
12E516858439°03′30.73″N/68°20′50.96″E2210 mMIXPutative hybrid
12E536858639°03′30.55″N/68°20′50.79″E2210 mITS1-EE3Putative hybrid
12E546863839°03′31.03″N/68°20′51.46″E2210 mITS1-EI1E. intermedia
12E556867039°03′30.93″N/68°20′51.41″E2210 mMIXPutative hybrid
12E566863939°08′17.22″N/68°27′45.48″E1820 mITS1-EI1E. intermedia
12E576864039°08′17.17″N/68°27′45.76″E1820 mITS1-EI1E. intermedia
12E586864139°11′13.78″N/68°35′08.17″E1720 mITS1-EI1E. intermedia
13E066859139°03′21.21″N/68°20′39.21″E2210 mITS1-EE1E. equisetina
13E076859239°03′20.85″N/68°20′39.48″E2210 mITS1-EE1E. equisetina
13E086859330°01′58.42″N/68°16′19.52″E2470 mITS1-EE3E. equisetina
13E096859439°04′00.16″N/68°17′24.14″E2420 mITS1-E1E. equisetina
13E106859539°03′03.81″N/68°18′19.08″E2390 mITS1-E1E. equisetina
13E116864239°10′43.26″N/68°31′17.81″E1700 mITS1-EI1E. intermedia
13E296864739°11′30.34″N/69°07′02.74″E2460 mITS1-EI1E. intermedia
13E306860539°12′59.74″N/69°00′36.22″E2350 mITS1-EE3E. equisetina
13E316864939°11′02.49″N/68°43′15.44″E2070 mITS1-EI1E. intermedia
13E326865039°10′59.70″N/68°42′46.71″E2060 mITS1-EI1E. intermedia
13E336860639°01′55.77″N/68°16′17.99″E2470 mITS1-EE3E. equisetina
13E356860839°02′00.88″N/68°16′20.99″E2470 mITS1-EE3E. equisetina
Fig. 2. Ephedra equisetina (A, 11E02) and E. intermedia (B, 11E03) in Tajikistan

Cultivation of Ephedra Plants

Seeds of Ephedra plants (11E08 and 12E37) from Tajikistan were germinated and planted in pots containing vermiculite. They were fertilized with a 1000× dilution of liquid nutrients (Hanakoujou, Sumitomo Chemical Garden Products, Tokyo, Japan) and raised indoors under artificial light for >1 year. They were then transferred to the Herbal Garden of Iwate Medical University and grown outdoors for >3 years (11E08-1) and >1 year (12E37-1), respectively. A strain of E. sinica obtained from Tsumura & Co. (Tokyo, Japan) was also raised at the Herbal Garden of Iwate Medical University for >9 years. The herbal stems of these cultivated Ephedra plants were harvested on October 25, 2016 for HPLC analysis.

Chemicals

Authentic Ep and PEp samples were obtained from Alps Pharmaceutical Industry Co., Ltd., Gifu, Japan.

Amplification and Sequencing of Nuclear Ribosomal DNA ITS1 Region

DNA was extracted from dried herbaceous stems using a DNeasy Plant Mini Kit (Qiagen, Hilden, Germany). The 5′-terminal of the nuclear internal transcribed spacer 1 (ITS1) sequence was amplified by PCR using the template DNA from herbaceous stems, Taq-DNA polymerase (New England Biolabs Inc., Ipswich, MA, U.S.A.), anti-Taq high (Toyobo Co., Ltd., Osaka, Japan), and two reported primers for ITS1,12,13) namely, 5′-GAC GTC GCG AGA AGT TCA TT-3′ (Eph-F) and 5′-ACC ATA GAT AGG GGA AGC GTG TTA-3′ (Eph-ITS 649R). After initial denaturation (2 min at 94°C), 30 cycles of 15 s at 94°C, 30 s at 55°C, and 15 s at 68°C, and a final elongation of 5 min at 68°C were performed on a thermocycler. The amplified fragments were treated with ExoSAP-It (Affymetrix/USB, Alfa Aesar, Tewksbury, MA, U.S.A.). The purified fragments were directly sequenced using the dideoxy chain termination method (3130xl Genetic Analyzer, Applied Biosystems, Foster City, CA, U.S.A.) and the two primers used in PCR amplification. To obtain the full ITS1 sequence, the 3′-terminal of the ITS1 sequence was amplified and sequenced using two reported primers for ITS1,12,13) namely, 5′-ATT TGA GAC AAA CGT CTC CC-3′ (Eph-ITS 405F) and 5′-CGG GAT TCT GCA ATT CAC AC-3′ (5.8S-R), as described above.

Species-Specific PCR Analysis

A partial region of the nuclear ITS1 sequence was amplified by PCR using the template DNA from herbaceous stems, Taq-DNA polymerase (New England Biolabs), anti-Taq high (Toyobo Co., Ltd.), and two species-specific primers, namely, 5′-GCT CTC CGT AGA AGG AAC CGG ATG-3′ and 5′-GGG AGA CGT TTG TCT CAA ATA TTT TTT TGA-3′ for E. equisetina or 5′-GCT CTC CGT TGA AGG AAC CGG AAA-3′ and 5′-GGG AGA CGT TTG TCT CAA ATA TTT TTT TAT-3′ for E. intermedia. After initial denaturation (2 min at 94°C), 30 cycles of 15 s at 94°C, 30 s at 55°C, and 15 s at 68°C, and a final elongation of 5 min at 68°C were performed using a thermocycler.

HPLC Analysis of Ep and PEp

The Ep and PEp content were determined using the method described in earlier studies, with a slight modification.14) Dried stem samples were ground with a mortar and a pestle, and 40 mg of each powdered sample was added to 4 mL of a mixture of MeCN, H2O, and H3PO4 (400 : 600 : 0.4) with 0.4% sodium dodecyl sulfate (SDS) and extracted ultrasonically for 60 min. An aliquot (2 µL) of the extract was analyzed by photodiode-array HPLC as follows: Prominence HPLC system (Shimadzu Corporation, Kyoto, Japan) was used; column, Inertsil ODS-3 (3 µm, 2.1 mm i.d. × 150 mm, GL Sciences, Tokyo, Japan); solvent, MeCN, H2O, and H3PO4 (400 : 600 : 0.4) with 0.4% SDS; flow rate, 0.2 mL/min; column temperature, 40°C. The quantities of Ep and PEp were determined on the basis of their peak areas of UV absorption at 210 nm. The calibration curves for Ep and PEp were as follows: Ep content (%) = Peak Area of Ep/1975817, PEp content (%) = Peak Area of PEp/1967978. The linearity was good in the 0–5% range for Ep and PEp. The identity of each constituent was verified by comparing its retention time and UV spectrum to that of its respective authentic sample.

Nucleotide Sequence

The nucleotide sequence data reported in this paper are deposited in the DDBJ, EMBL, and GenBank under the accession numbers: LC342287 (E. equisetina, 11E02), LC342288 (E. intermedia, 11E03), LC342289 (E. equisetina, ITS1-EE1), LC342290 (E. equisetina, ITS1-EE2), LC342291 (E. equisetina, ITS1-EE3), LC342292 (E. equisetina, ITS1-EE4), LC342293 (E. equisetina, ITS1-EE5), and LC342294 (E. intermedia, ITS1-EI1).

RESULTS

Field Surveys of Ephedra Plants in the Northwestern Mountain Range of Tajikistan

Field surveys of Ephedra plants were carried out in the Zaravshan Mountains of Tajikistan as shown in Fig. 1. This region was the Ephedra production center of the former Soviet Union. In total, 73 Ephedra samples from 50 plants were collected as shown in Table 1 and Fig. 1. These plants were identified as E. equisetina (Fig. 2A), E. intermedia (Fig. 2B), and their putative hybrids (E. sp.), based on their morphologies and DNA analyses. E. equisetina plants collected in the present study were 1–2 m in height, and their woody stems were well developed. Their internodes were 1.5–3 cm in length and 1–2 mm in diameter. Their seed cones contained one seed, fleshy red bracts, and slightly curved integument tubes (Fig. 3A). In contrast, E. intermedia plants collected in the present study were 0.5–1 m in height. Their internodes were 3–6 cm in length and 1.5–3 mm in diameter. Their seed cones contained two seeds, fleshy red bracts, and spirally twisted, long integument tubes (Fig. 3B).

Fig. 3. Seed Cones of Ephedra equisetina (A, 12E37) and E. intermedia (B, 13E11) Collected in Tajikistan

Nineteen Ephedra species, namely, E. strobilacea BUNGE, E. ciliata FISCH. et C. A. MEY., E. aitchisonii V. NIKITIN, E. heterosperma V. NIKITIN, E. glauca REGEL, E. tesquorum V. NIKITIN, E. tibetica V. NIKITIN, E. microsperma V. NIKITIN, E. ferganensis V. NIKITIN, E. persica V. NIKITIN, E. intermedia, E. regeliana FLORIN, E. minuta FLORIN, E. equisetina, E. valida V. NIKITIN, E. gerardiana WALLICH et C. A. MEY., E. pulvinaris V. NIKITIN, E. fedtschenkoi PAULSEN, and E. lomatolepis SCHRENK are listed in the Flora of Tajikistan.8,9) Furthermore, E. glauca, E. tesquorum, E. tibetica, E. microsperma, E. ferganensis, and E. persica have been recorded as synonyms of E. intermedia in the Flora of China.10) In addition, E. heterosperma, a newly defined Ephedra species in the Flora of Tajikistan, has a spirally twisted integument tube,8) characteristic of E. intermedia.10) Thus, in the present study, Ephedra plants collected in Tajikistan were identified based on the classification of Ephedra in the Flora of China.10)

Characterization of Ephedra Plants Based on ITS1 Sequences

The Ephedra plants collected from Tajikistan were characterized by determining their nuclear ribosomal DNA internal transcribed spacer 1 (ITS1) sequences. Figure 4 shows the alignment of the ITS1 sequences of the E. equisetina (11E02) and E. intermedia (11E03) collected in the present study. The 3′-terminal part of the ITS1 region is rich in substitutions and deletions. Therefore, it was difficult to analyze the 3′-terminal ITS1 regions of some of the Ephedra samples collected in Tajikistan by direct sequencing. For this reason, we focused on the 5′-terminal part of the ITS1 region. The partial ITS1 sequences of 50 Ephedra plants were analyzed. All E. intermedia plants identified by their morphological traits showed the same ITS1 sequence. In contrast, the E. equisetina plants identified by their morphological characteristics were divided by ITS1 genotype (Table 2). Putative hybrids were also identified by direct sequencing. They showed mixed sequences derived from both E. equisetina and E. intermedia (Table 2). Two Ephedra plants (12E17 and 12E55) had a nearly 50% mixed ratio of E. intermedia sequences. Plants 12E44 and 12E51 showed almost 25% mixed ratio of E. intermedia sequences.

Fig. 4. Alignment of the ITS1 Sequences of Ephedra equisetina (11E02) and E. intermedia (11E03) Collected in Tajikistan
Table 2. Nucleotide Differences of Nuclear Ribosomal DNA ITS1 Region of Ephedra Plants Collected in Tajikistan
SpeciesGenotypeNucleotide position of nuclear ribosomal DNA ITS1 region of E. equisetina
3347839697138–139180216228268310391–392468474507534544563579
E. equisetinaHQ882770CCATGAGCCCTCTCCCCGACT
AY 394073YCATGAGCCCTCTCCCCGACT
ITS1-EE1CCATGAGCCCTCTCCCCGACT
ITS1-EE2YCATGAGCCYTCTCCCCGACT
ITS1-EE3CCATGAGCCCTCTCYCCGACT
ITS1-EE4CCATGAGCCCTYTCCCCGACT
ITS1-EE5CYATGAGCCCTCTCCCCGACT
E. intermediaAY 394070CCTAAATGTTCCCTAAATTTTACAA
ITS1-EI1CCTAAATGTTCCCTAAATTTTACAA
Putative hybrids12E17CCWWRnd.nd.nd.nd.nd.nd.nd.YYYRMMW
12E55CCWWGnd.nd.nd.nd.nd.nd.nd.YYYRMMW
12E44CYAWRnd.nd.nd.nd.nd.nd.nd.CCYRMMW
12E51CYWWRnd.nd.nd.nd.nd.nd.nd.CCYRMCA

The morphological traits of these plants, showing mixed sequences by direct sequencing, differed from those of E. equisetina and E. intermedia. Therefore, these plants may be hybrids of the two species. Two putative hybrids (12E17 and 12E55), which had neither seed cones nor pollen cones, were shrubs of 1 m height, and their woody stems were well developed, similar to that in E. equisetina. However, their internodes were 3–6 cm in length and 2–4 mm in diameter, which were similar to those of E. intermedia. Another putative hybrid (12E44) measured 1 m in height, and its woody stem was also well-developed, like that in E. equisetina. This plant had seed cones with one seed, fleshy red bracts, and slightly curved integument tubes, which were similar to those of E. equisetina. In contrast, internodes of 12E44 were 1.5–2.5 cm in length and 1.5–2 mm in diameter, which were thicker than those of E. equisetina. The morphological traits of 12E51 were similar to those of E. equisetina, although 12E51 showed almost 25% mixed ratio of E. intermedia sequences.

To confirm hybridization of the plants collected in the present study, PCR was conducted using species-specific primers (Fig. 4) for the ITS1 sequences of E. equisetina and E. intermedia, respectively (Fig. 5). Four putative hybrids (12E17, 12E55, 12E44, and 12E51) were identified by species-specific PCR as well as direct sequencing. In addition, two Ephedra plants (12E27 and 12E53), both morphologically identified as E. equisetina, generated PCR products specific to both E. intermedia and E. equisetina. Therefore, these two plants may also be derived from hybrids of the two species.

Fig. 5. Identification of Putative Hybrids by PCR Using Species-Specific Primers for ITS1

E: PCR using E. equisetina-specific primers; I: PCR using E. intermedia-specific primers.

Ep and PEp Content of Ephedra Plants Collected in Tajikistan

HPLC analysis was performed to determine the Ep and PEp content in the Ephedra samples collected in the present study. Table 3 shows the Ep and PEp levels in the herbaceous stems of E. equisetina collected in Tajikistan. The total alkaloid content of Ep and PEp (TAC) varied from 0.34 to 2.69% by dry weight. The TAC was >0.7% by dry weight in 91% of the E. equisetina samples, where 0.7% is the lower limit prescribed by JP17. The relative alkaloid ratios (RAR, Ep/[Ep + PE]) of the E. equisetina samples ranged from 0 to 0.99. Table 4 shows the content of Ep and PEp in the herbaceous stems of E. intermedia collected in the present study. The TAC of the E. intermedia samples varied from 1.06 to 3.21% by dry weight, which were higher than the 0.7% lower limit prescribed by JP17. The RAR of the E. intermedia samples ranged from 0.02 to 0.19. Table 5 shows the content of Ep and PEp in the stems of the putative hybrids identified by species-specific PCR. The TAC of the putative hybrids varied from 0.73 to 2.92% by dry weight, which were also higher than the 0.7% lower limit prescribed by JP17. The RAR of the putative hybrids ranged from 0.34 to 0.70.

Table 3. Contents of Ephedrine (Ep) and Pseudoephedrine (PEp) in Herbaceous Stems of Ephedra equisetina Collected in Tajikistan
Plant No.Sample No.Collection dateContent (% of dry weight) ofRAR
EpPEpTAC (Ep + PEp)Ep/(Ep + PEp)
11E011Oct. 9, 20110.910.811.720.53
2Jun. 3, 20120.550.461.010.54
11E021Oct. 9, 20111.100.561.660.66
2Jun. 3, 20120.880.531.410.63
11E091Oct. 9, 20111.160.932.090.55
2Jun. 2, 20121.010.561.570.64
12E141Jun. 3, 20121.480.982.460.60
2Oct. 14, 20121.100.681.780.62
12E151Jun. 3, 20120.260.370.630.41
2Oct. 14, 20120.380.610.990.38
12E181Jun. 3, 20120.880.241.120.78
12E191Jun. 3, 20121.280.461.740.73
2Oct. 14, 20121.450.531.980.73
12E201Jun. 3, 20121.090.281.370.79
12E211Jun. 3, 20120.270.070.340.79
12E221Jun. 3, 20120.810.321.130.72
2Oct. 13, 20121.070.491.560.68
12E371Oct. 13, 20120.640.000.640.99
12E391Oct. 13, 20120.560.400.960.58
12E411Oct. 13, 20121.161.162.320.50
12E451Oct. 14, 20120.730.571.300.56
12E461Oct. 14, 20120.700.701.400.50
12E471Oct. 14, 20121.110.892.000.55
13E061Jul. 27, 20130.950.491.440.66
13E071Jul. 27, 20131.671.022.690.62
13E081Jul. 27, 20130.001.171.170.00
2Oct. 19, 20130.001.151.150.00
13E091Jul. 28, 20131.290.601.890.68
13E101Jul. 28, 20130.311.261.570.20
13E301Oct. 13, 20130.600.671.270.47
13E331Oct. 19, 20130.890.501.390.64
13E351Oct. 19, 20130.600.571.170.51
Table 4. Contents of Ephedrine (Ep) and Pseudoephedrine (PEp) in Herbaceous Stems of Ephedra intermedia Collected in Tajikistan
Plant No.Sample No.Collection dateContent (% of dry weight) ofRAR
EpPEpTAC (Ep + PEp)Ep/(Ep + PEp)
11E031Oct. 9, 20110.061.291.350.04
2Jun. 3, 20120.071.861.930.04
11E041Oct. 9, 20110.082.532.610.03
2Jun. 3, 20120.102.452.550.04
11E051Oct. 9, 20110.123.033.150.04
2Jun. 2, 20120.092.072.160.04
11E061Oct. 9, 20110.322.452.770.12
2Jun. 2, 20120.321.902.220.14
11E071Oct. 9, 20110.472.743.210.15
2Jun. 2, 20120.402.803.200.13
11E081Oct. 9, 20110.342.252.590.13
2Jun. 2, 20120.291.852.140.14
11E101Oct. 9, 20110.202.512.710.07
2Jun. 2, 20120.232.682.910.08
12E131Jun. 2, 20120.421.772.190.19
2Oct. 13, 20120.241.151.390.17
12E161Jun. 3, 20120.282.132.410.12
2Oct. 14, 20120.231.661.890.12
12E311Sep. 30, 20120.211.161.370.15
12E321Sep. 30, 20120.091.952.040.05
12E481Oct. 14, 20120.131.861.990.07
12E541Oct. 14, 20120.100.961.060.10
2Oct. 19, 20130.101.131.230.08
12E561Oct. 14, 20120.041.881.920.02
12E571Oct. 14, 20120.391.932.320.17
12E581Oct. 14, 20120.142.742.880.05
13E111Jul. 28, 20130.231.952.180.11
13E291Oct. 13, 20130.111.731.840.06
13E311Oct. 13, 20130.121.831.950.06
13E321Oct. 13, 20130.362.422.780.13
Table 5. Contents of Ephedrine (Ep) and Pseudoephedrine (PEp) in Herbaceous Stems of Putative Hybrids of Ephedra Plants Collected in Tajikistan
Plant No.Sample No.Collection dateContent (% of dry weight) ofRAR
EpPEpTAC (Ep + PEp)Ep/(Ep + PEp)
12E171Jun. 3, 20120.641.191.830.35
2Oct. 14, 20120.551.041.590.34
3Oct. 19, 20130.661.231.890.35
12E271Sep. 29, 20121.140.952.090.55
12E441Oct. 14, 20121.370.842.210.62
2Oct. 19, 20131.620.922.540.64
12E511Oct. 14, 20120.470.260.730.64
2Oct. 19, 20130.800.551.350.59
12E551Oct. 14, 20120.611.131.740.35
2Oct. 19, 20131.031.892.920.35
12E531Oct. 14, 20121.260.541.800.70

Figure 6 compares the TAC and RAR of E. equisetina, E. intermedia, and their putative hybrids. Most of E. equisetina were plotted in the E. equisetina group except for 13E08 and 13E10, which were plotted in the E. intermedia group. Many putative hybrids were plotted in the E. equisetina group but 12E17 and 12E55 were located between E. equisetina and E. intermedia.

Fig. 6. Relationship between Total Alkaloid Content (TAC, Ep + PEp) and Relative Alkaloid Ratios (RAR, Ep/[Ep + PEp]) of Ephedra equisetina (○), E. intermedia (●), and Putative Hybrids (▲) Collected in Tajikistan

Ep and PEp Content of Ephedra Plants Cultivated in Japan

The Ep and PEp content of the Ephedra plants collected in Tajikistan were determined to be very high. Therefore, we cultivated Ephedra plants using seeds derived from those plants. Table 6 shows the Ep and PEp content in the stems of the Ephedra plants cultivated in Japan. The TAC of E. intermedia (11E08-1) varied from 1.77 to 2.31% by dry weight, which was much higher than the 0.7% lower limit prescribed by JP17. The RAR of E. intermedia (11E08-1) ranged from 0.16 to 0.19 and was similar to those of the E. intermedia collected in Tajikistan (Table 4). In contrast, the TAC of E. equisetina (12E37-1) varied from 0.44 to 0.88% by dry weight, and the RAR ranged from 0.89 to 0.92. In addition, the TAC of E. sinica (IMU-ES1) varied from 0.14 to 0.30% by dry weight, which were lower than the 0.7% lower limit prescribed by JP17. The RAR of E. sinica (IMU-ES1) ranged from 0.46 to 0.51.

Table 6. Contents of Ephedrine (Ep) and Pseudoephedrine (PEp) in Herbaceous Stems of Ephedra Plants Cultivated in Iwate, Japan
Plant No.SpeciesCollection dateContent (% of dry weight) ofRAR
EpPEpTAC (Ep + PEp)Ep/(Ep + PEp)
IMU-ES1Ephedra sinicaOct. 25, 20160.140.150.290.47
0.140.160.300.46
0.070.070.140.51
11E08-1Ephedra intermediaOct. 25, 20160.291.481.770.16
0.311.661.970.16
0.451.862.310.19
12E37-1Ephedra equisetinaOct. 25, 20160.450.050.500.90
0.410.030.440.92
0.780.100.880.89

DISCUSSION

Ephedra plants is one of the most important medicinal plants used in traditional Kampo prescriptions. Therefore, field surveys of Ephedra plants have been undertaken in many countries such as China,6,14,15) Mongolia,13,16) Pakistan,17) and Nepal.18) However, the characteristics of the Ephedra plants of Central Asia, including Tajikistan, have not yet been explored in depth. In the present study, E. equisetina, E. intermedia, and their putative hybrids were collected from the Zaravshan Mountains of Tajikistan. This region was the production center of Ephedra herb of the former Soviet Union. Numerous Ephedra habitats were observed during this field survey, and the Ephedra resources of the Zaravshan Mountains may potentially supply Ephedra herb worldwide.

The Ephedra plants collected in Tajikistan were divided into seven ITS1 genotypes including putative hybrids with mixed ITS1 sequences. All the ITS1 sequences of the E. intermedia plants had the same genotype, namely, ITS-EI1. However, those of the E. equisetina plants were divided into five different ITS1 genotypes, namely, ITS-EE1, ITS-EE2, ITS-EE3, ITS-EE4, and ITS-EE5. Similar results were obtained for Ephedra plants collected in China12,14) Pakistan,17) and Mongolia.13)

Two putative hybrids of E. equisetina and E. intermedia, 12E17 and 12E55, were observed in the present study and showed identical mixed ITS1 sequences. Two other putative hybrids (12E44 and 12E51) were also identified. They showed mixed ITS1 sequences with a major E. equisetina component and a minor E. intermedia component. PCR analysis using species-specific ITS1 primers indicated that two additional plants (12E27 and 12E53) may also be hybrids of E. equisetina and E. intermedia. These plants (12E27 and 12E53) were identified as E. equisetina based on their morphological features and their ITS1 sequences by direct sequencing; however, these plants may have minor ITS1 sequences of E. intermedia, which were not detected by direct sequencing. Hybrids between E. przewalskii and E. intermedia (E. glauca) were previously reported among the Ephedra plants collected in Mongolia,13) and hybrids between E. gerardiana and E. intermedia were observed in Nepal.18) A hybrid of E. likiangensis and E. gerardiana was also found among the Ephedra plants cultivated in Japan.19) The present study showed that hybridization of E. equisetina and E. intermedia is common in the Zaravshan Mountains of Tajikistan since both species grow in the same habitats.

HPLC analysis revealed that the TAC in the 73 Ephedra samples collected in Tajikistan varied from 0.34 to 3.21% by dry weight. The TAC of most of the Ephedra samples (70; 96%) was higher than the lower limit of 0.7% by dry weight, as prescribed by JP17.5) The maximum TAC was 3.21% by dry weight in one E. intermedia specimen (11E07), and was similar to the levels determine for those collected in China (0.39–3.40%),15) Mongolia (0.00–4.59%),16) and Pakistan (0.00–1.87%).17) The RAR were reported to vary with Ephedra species and strain.1517) The RAR may depend on genetic factors.20,21) In the present study, the RAR of E. intermedia collected in Tajikistan ranged from 0.02 to 0.19 and resembled those for most E. intermedia collected in other countries.15,16)PEp was shown to have more potent anti-inflammatory effects than Ep.22) It has been recommended that E. intermedia with higher PEp levels should be used in anti-inflammatory Ephedra preparations.20,22) In the present study, only E. intermedia plants were observed at altitudes <2000 m. Therefore, Tajikistan could serve as a production center of E. intermedia. In contrast, the RAR of E. equisetina collected from Tajikistan ranged from 0 to 0.99. This wide variation in alkaloid content was also observed in E. equisetina and E. sinica collected in China15) and Mongolia.16)

Seeds of E. equisetina and E. intermedia collected in Tajikistan were germinated and raised in Iwate, Japan. The TAC of the cultivated E. intermedia strain 11E08-1 was much higher than the lower limit prescribed by JP17 (0.7% by dry weight) and those of other cultivated Ephedra species such as E. sinica strain IMU-ES1. The TAC of the cultivated E. sinica strains in Japan has been reported to be relatively low.20) Therefore, the E. intermedia strain 11E08-1 collected from Tajikistan could be used for the cultivation of Ephedra plants.

Acknowledgments

This study was supported by the Japan International Cooperation Agency (JICA) and the Japan Society for the Promotion of Science (JSPS) Program, Dispatch of Science and Technology Researchers. We are also grateful to Ms. Zumrad Sharopova, Mr. Shoh Sharipov, Mr. Husniddin Kuziboev, Ms. Shakhnoza Negmatova, Mr. Mirzokarim Sobirov, Mr. Yukichi Goto, Mr. Masakazu Kanamoto, and Nobuji Yoshikawa for their assistance. The authors would like to thank Alps Pharmaceutical Industry for providing authentic samples of Ep and PEp, and Tsumura & Co. for providing a strain of E. sinica.

Conflict of Interest

The authors declare no conflict of interest.

REFERENCES
 
© 2019 The Pharmaceutical Society of Japan
feedback
Top