Maturational Characterization of Mouse Cortical Neurons Three-Dimensionally Cultured in Functional Polymer FP001-Containing Medium

Abstract

The aim of the present study is to construct and characterize a novel three-dimensional culture system for mouse neurons using the functional polymer, FP001. Stereoscopically extended neurites were found in primary mouse cortical neurons cultured in the FP001-containing medium. Neurons cultured with FP001 were distributed throughout the medium of the observation range whereas neurons cultured without FP001 were distributed only on the bottom of the dish. These results demonstrated that neurons can be three-dimensionally cultured using the FP001-containing medium. The mRNA expression of the glutamatergic neuronal marker vesicular glutamate transporter 1 in neurons cultured in the FP001-containing medium were higher than that in neurons cultured in the FP001-free medium. Expression of the matured neuronal marker, microtubule-associated protein 2 (MAP2) a,b, and the synapse formation marker, Synapsin I, in neurons cultured with FP001 was also higher than that in neurons cultured without FP001. The expression pattern of MAP2a,b in neurons cultured with FP001, but not that in neurons cultured without FP001, was similar to that in the embryonic cerebral cortex. Exposure to glutamate significantly increased 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) reduction activity in neurons cultured with FP001 compared to that in neurons cultured without FP001. These results suggested that glutamatergic neurotransmission in neurons three-dimensionally cultured in the FP001-containing medium may be upregulated compared to neurons two-dimensionally cultured in the FP001-free medium. Thus, neurons with the properties close to those in the embryonic brain could be obtained by three-dimensionally culturing neurons using FP001, compared to two-dimensional culture with a conventional adhesion method.

INTRODUCTION

Neurons form complicated neuronal networks that three-dimensionally spread in the living brain, and thereby, perform neurotransmission that is required to exert normal brain function. Therefore, abnormalities in the formation of neuronal networks may result in the onset and/or development of various neuropsychiatric disorders, including depression and schizophrenia.^1–5) Neurons differentiated from neural stem cells extend neurites and make synapses with other neurons to form neuronal networks. Such neuronal differentiation and maturation requires scaffolds, which include supporting cells, such as glial cells, in the brain. For research purposes, neurons are usually cultured by adhering them on a dish as an in vitro experimental system for analysis of neuronal function. However, neurons in the adhesion culture in dishes only extend neurites in the planar direction, but are not able to reproduce the properties of neurons inside the brain under a stereoscopic environment.^6–8) Therefore, three-dimensionally cultured neurons have recently been recognized as an alternative tool to analyze more physiologically relevant events in the neuronal networks.

In general, the three-dimensional culture methods are classified into at least three types: Sphere method refers to culturing of aggregated clusters of floating cells^9,10); microcarrier-capsule method refers to culturing of cells adhered to particles dispersed in the medium^11,12); and embedding method refers to culturing of cells embedded into gels or microfibers as scaffolds.^13,14) The sphere method is useful for analysis of biological activity of compounds since it is easy to add compounds into the medium of the floating aggregated cells, but may not be suitable for culturing neurons that extend neurites and form neuronal networks owing to the difficulty in getting scaffolds. The microcarrier-capsule method may be suitable for culturing neural stem/progenitor cells since a large number of cells can be cultured with a small volume of the medium due to a large surface area of scaffolds with high density of the particles.^11,12) However, small size of the particles may be insufficient as scaffolds for neurites, and therefore, it may also be unsuitable for culturing neurons. Thus, embedding method has been widely used for three-dimensional culture of neurons to acquire scaffolds for neurite outgrowth.^13–15)

Puschmann et al. reported three-dimensional culturing of neurons embedded in polyurethane nanofibers, the structure of which is biologically compatible for neurons and suitable for maintaining the three-dimensional structure of neurites and neuronal networks.¹⁵⁾ In addition, embedding method, using porous polystyrene and collagen gel as scaffolds, has been reported to be suitable not only for the three-dimensional culture of neurons, but also immunostaining and patch clamping by preparing sliced sections from the embedded cultures.^13,14) The electric current observed in the patch clamp in this three-dimensionally culture of neurons was more similar to that in a section of the living brain, compared to that observed in two-dimensionally cultured neurons.¹⁴⁾ However, embedding culture method may not be suitable for assessing biological activity of compounds due to difficulty in adding or removing compounds which may not be evenly dispersed in the medium, and in collecting cells from embedded gels or fibers.

The FCeM medium contains the functional polymer, FP001, which is polysaccharide gellan gum, has a double helix structure under cooling conditions, and forms a bridging structure via carboxyl groups in the presence of divalent ions.^16,17) By forming a cross-linked structure in the medium, cells can be evenly dispersed and suspended. Therefore, spontaneous aggregation of the cells is reduced, and a uniform size of spheres is obtained during the culture in the FCeM medium. In fact, stable large-scale culture of human induced pluripotent stem cells has been reported using the FCeM medium.¹⁸⁾ Since the cross-linked structure of FP001 has high fluidity, and the viscosity of the FCeM medium is almost equal to that of water,^18,19) compounds can be freely added and dispersed into the FCeM medium. Thus, this medium may be suitable for three-dimensional culture of neurons for the analysis of biological activity of exogenously added compounds. However, there have been very few studies that report such application of the FCeM medium to culture neurons.

In the present study, we attempted to observe whether neurons derived from embryonic mouse cerebral cortex can be three-dimensionally cultured in the FCeM medium. In this experiment, two types of media commonly used for neuronal culture were used. Furthermore, by comparing the expression of various neuronal markers between the neurons three-dimensionally cultured in the medium with FP001 and the neurons two-dimensionally cultured in the medium without FP001, maturation of the neurons cultured in the FCeM medium was characterized.

MATERIALS AND METHODS

Materials

Gellan gun (FP001)-containing Neurobasal medium (FCeM-N) and Dulbecco’s modified Eagle’s medium (FCeM-D) were prepared at Nissan Chemical Industries (Tokyo, Japan) according to a previously described method.¹⁹⁾ Dulbecco’s modified Eagle’s medium (DMEM) without FP001, poly-L-lysine, anti-microtubule-associated protein 2 (MAP2), anti-βIII-tubulin, anti-Synapsin I, and anti-β-actin antibodies, and anti-mouse and -rabbit immunoglobulin G (IgG) antibodies, conjugated with peroxidase, were purchased from Sigma-Aldrich (St. Louis, MO, U.S.A.). Neurobasal medium without FP001 was purchased from Thermo Fisher Scientific (Malvern, PA, U.S.A.). Anti-vesicular glutamate transporter 1 (VGLUT1) antibody and non-fat dry milk were supplied by Cell Signaling Technology (Danvers, MA, U.S.A.). Fetal bovine serum (FBS) was obtained from Biowest (Nuaillé, France). ISOGEN was purchased from Nippon Gene (Tokyo, Japan). MultiScribe™ Reverse Transcriptase was supplied by Applied Biosystems (Foster City, CA, U.S.A.). THUNDERBIRD SYBR qPCR Mix and Can Get Signal were obtained from TOYOBO (Osaka, Japan). All other chemicals and reagents were of the highest purity available and were purchased from commercial sources.

Animals

Pregnant C57BL/6-Tg (CAG-EGFP) mice and ICR mice were purchased from Japan SLC (Hamamatsu, Japan). The mice were housed under pathogen-free conditions under controlled temperature (21–25°C) with a 12 h light/dark cycle. The lights remained on from 8:00 to 20:00, and food and water were available to the mice ad libitum. The animals were cared for in strict compliance with the guidelines outlined in the National Institutes of Health Guide for the Care and Use of Laboratory Animals. All animal procedures were approved by the Kanazawa University Animal Care Committee.

Neuronal Culture

Primary cortical neuronal cultures were performed according to the methods described by Nakamichi et al., with minor modifications.²⁰⁾ In brief, cerebral cortices from 15-d-old embryonic C57BL/6-Tg (CAG-EGFP) mice or ICR mice were dissected and incubated with 0.25% trypsin in phosphate-buffered saline (PBS) containing 28 mM glucose at 37°C for 20 min. Cells were mechanically dissociated using a 1000-µL pipette tip in Neurobasal medium or DMEM and plated at a density of 7.5 × 10⁵ cells/mL into glass-bottom or plastic dishes that were coated with 7.5 µg/mL poly-L-lysine, for two-dimensional adhesion cultures. The remaining cellular suspension was centrifuged and resuspended in FCeM-N or FCeM-D. These cells were plated at a density of 2.25 × 10⁶, 4.50 × 10⁶, and 7.50 × 10⁶ cells/mL into non-coating glass-bottom or plastic dishes, for three-dimensional cultures. Cortical neurons were cultured in Neurobasal medium or FCeM-N that was supplemented with 100 U/mL penicillin, 100 µg/mL streptomycin, B-27 supplement, and 0.5 mM glutamine, or in DMEM or FCeM-D that was supplemented with 100 U/mL penicillin, 100 µg/mL streptomycin, 28 mM glucose, 2 mM glutamine, 5 mM N-(2-hydroxyethyl)piperazine-N-2-ethanesulfonic acid (HEPES), 50 µg/mL apo-transferrin, 500 ng/mL insulin, 1 pM β-estradiol, 3 nM triiodothyronine, 20 nM progesterone, 8 ng/mL sodium selenite, and 100 µM putrescine, at 37°C in a humidified atmosphere under 5% CO₂.

Three-Dimensional Imaging

For two-dimensional cultures, cortical neurons derived from C57BL/6-Tg (CAG-EGFP) mice were seeded at 1.5 × 10⁵ cells/0.2 mL/well into Lab-Tek^® chambered cover glass, and cultured for 3 d in Neurobasal medium or DMEM. For three-dimensional cultures, cortical neurons from CAG-EGFP mice were seeded at 4.5 × 10⁵, 9.0 × 10⁵, and 1.5 × 10⁶ cells/0.2 mL/well into Lab-Tek^® chambered cover glass, and cultured for 3 d in FCeM-N or FCeM-D. These neurons were observed with Z-stack image acquisition using a confocal laser-scanning microscope (LSM710, Carl Zeiss, Jena, Germany) equipped with an argon laser. Fluorescence images were acquired using an excitation wavelength of 488 nm. The parameters of illumination and detection were digitally controlled to ensure that the same settings were maintained throughout the experiments.

Quantitative RT-PCR

For two-dimensional cultures, cortical neurons isolated from ICR mice were seeded at 7.5 × 10⁵ cells/mL/well into 12-well plastic dishes, cultured for 3 d in Neurobasal medium or DMEM, and washed with ice-cold PBS. Cells were centrifuged at 4°C for 5 min at 15000 × g after cell harvesting. For three-dimensional cultures, cortical neurons isolated from ICR mice were seeded at 2.25 × 10⁶ cells/mL/well into 12-well plastic dishes, and cultured for 3 d in FCeM-N or FCeM-D. Cultures were centrifuged at 4°C for 5 min at 2000 × g, and supernatant was removed by aspiration. Pellets were washed with ice–cold PBS, followed by centrifugation at 4°C for 5 min at 15000 × g. Total RNA was extracted from pellets thus obtained according to the standard ISOGEN procedure. cDNA was synthesized with oligo (dT)_12–18 primer, deoxynucleotide triphosphate mix, RT buffer, and MultiScribe™ Reverse Transcriptase, and amplified on a Mx3005P (Agilent Technologies, Santa Clara, CA, U.S.A.) in a reaction mixture containing cDNA with relevant sense and antisense primers (Table 1), and THUNDERBIRD SYBR qPCR Mix. PCR reactions were initiated by template denaturation at 95°C for 15 min, followed by 40 cycles of amplification (denaturation at 95°C for 10 s, and primer annealing and extension at 60°C for 30 s). Relative quantification of expression levels of the target genes was determined by the 2^−ΔΔCt method using transcripts of acidic ribosomal phosphoprotein P0 (36B4) as the internal standard.

Table 1. Primers Used for Real-Time Polymerase Chain Reaction

Genes	Sense primers	Antisense primers
mPNMT	AGACCTGAGCAACCCTGATG	CCGGAGCCAATATCAATGAG
mTH	GCAGCCCTACCAAGATCAAA	CAGGGTGTACGGGTCAAACT
mVGLUT1	TCGTGTCCATGGTCAACAAC	TGTAGCCCCAGAAAAAGGAG
mGAD1	ATACAACCTTTGGCTGCATGT	GAGGGTTCCAGGTGACTGAA
mChAT	CCCTCCAGCTCCTTCATGGT	GAGTGCTCACACACACCACACC
mTPH	GGGCTGGTGAAAGCACTTAG	ATTCGCAGTCCACGAAGATT
mDβH	TTTGTGTTGACCGGCTACTG	GCGAGCACAGTAACCACCTT
m36B4	ACTGGTCTAGGACCCGAGAAG	TCCCACCTTGTCTCCAGTCT

Western Blot Analysis

Western blot analysis was performed according to the methods described by Nakamichi et al., with minor modifications.²¹⁾ For two-dimensional cultures, cortical neurons from ICR mice were seeded at 7.5 × 10⁵ cells/mL/well into 12-well plastic dishes, cultured for 3 d in Neurobasal medium, and washed with ice-cold PBS. Cells were centrifuged at 4°C for 5 min at 15000 × g after cell harvesting. For three-dimensional cultures, cortical neurons from ICR mice were seeded at 2.25 × 10⁶ cells/mL/well into 12-well plastic dishes, and cultured for 3 d in FCeM-N. Cultures were centrifuged at 4°C for 5 min at 2000 × g, and supernatant FCeM were removed by aspiration. Pellets were washed with ice-cold PBS, followed by centrifugation at 4°C for 5 min at 15000 × g. Cerebral cortices from 15-d-old embryonic ICR mice were dissected, and centrifuged at 4°C for 5 min at 15000 × g after washing with ice-cold PBS. Pellets thus obtained from cultured neurons and cerebral cortices were resuspended and sonicated in 20 mM Tris–HCl buffer (pH 7.5) containing 1 mM ethylenediaminetetraacetic acid (EDTA), 1 mM ethylene glycol bis(2-aminoethyl ether)-N,N,N′,N′-tetraacetic acid (EGTA), 10 mM sodium fluoride, 10 mM sodium β-glycerophosphate, 10 mM sodium pyrophosphate, 1 mM sodium orthovanadate, and 1 µg/mL of various protease inhibitors [(p-amidinophenyl)methanesulfonyl fluoride, leupeptin, antipain, and benzamidine]. The suspensions were then added at a volume ratio of 4 : 1 to 10 mM Tris–HCl buffer (pH 6.8) containing 10% glycerol, 2% sodium dodecylsulfate, 0.01% bromophenol blue, and 5% mercaptoethanol, and mixed at room temperature for one hour. The protein concentration was determined using a Protein Assay Kit (BioRad Laboratories, Hercules, CA, U.S.A.). Each aliquot of 10 µg proteins was loaded on to a 7.5% polyacrylamide gel for electrophoresis at a constant current of 21 mA/plate for 30 min at room temperature, using a compact-slab size poly-acrylamide gel electrophoresis (PAGE) system (ATTO, Tokyo, Japan), followed by blotting to a polyvinylidene fluoride membrane that was previously treated with 100% methanol. The membrane was blocked with 5% non-fat dry milk or 2% bovine serum albumin (BSA) solution at 4°C overnight. The membrane was then incubated with antibodies against VGLUT1 (1 : 5000) that were diluted with buffer containing 5% non-fat dry milk, or against MAP2 (1 : 10000), Synapsin I (1 : 10000), βIII-tubulin (1 : 10000), or β-actin (1 : 50000), that were diluted with buffer containing 0.2% BSA, at room temperature for 2 d while shaking. The membrane was then washed and incubated with an anti-mouse IgG (1 : 10000–100000) or anti-rabbit IgG (1 : 5000–10000), that were conjugated with peroxidase and diluted with 5% non-fat dry milk or 0.2% BSA, at room temperature for 2 d while shaking. Proteins reactive with these antibodies were detected with the aid of ECL Prime™ or ECL™ detection reagents using a lumino image analyzer (LAS-4000, FUJIFILM, Tokyo, Japan). Densitometric determination was performed using ImageJ software.

3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium Bromide (MTT) Assay

Mitochondrial activity as an index of cell survival was determined by using the MTT assay according to the method described by Nakamichi et al., with minor modifications.²¹⁾ For two-dimensional cultures, cortical neurons from ICR mice were seeded at 7.5 × 10⁵ cells/mL/well into 24-well plastic dishes, and cultured for 3 d in Neurobasal medium. The cells were exposed to glutamate or hydrogen peroxide for 24 h and washed with ice-cold PBS. For three-dimensional cultures, cortical neurons from ICR mice were seeded at 2.25 × 10⁶ cells/mL/well into 24-well plastic dishes, and cultured for 3 d in FCeM-N. The cells were exposed to glutamate or hydrogen peroxide for 24 h and centrifuged at room temperature for 5 min at 2000 × g, and supernatant FCeM were removed by aspiration. Pellets were washed with ice-cold PBS, followed by centrifugation at room temperature for 5 min at 2000 × g. These two- and three-dimensional cultured cells were incubated with MTT solution (0.5 mg/mL in PBS) for 1 h at 37°C. Subsequently, solubilizing solution (0.04 M HCl in isopropanol) at volume equivalent to the MTT solution was added, and the mixture was well shaken for 10 min to dissolve the formazan. The absorbance of the dissolved suspension at 570 nm was measured using a microplate reader.

Statistical Analysis

All experiments were performed at least three times. Data were expressed as the mean ± standard error of the mean (S.E.M.) The statistical significance of differences was determined by means of Student’s t-test or one-way ANOVA with the Tukey–Kramer test, and p < 0.05 denoted a statistically significant difference.

RESULTS

Morphology of Three-Dimensionally Cultured Neurons in the FCeM

We have first investigated whether neurons can three-dimensionally extend neurites in the FCeM medium. When neurons derived from cortices of C57BL/6-Tg (CAG-EGFP) mice were seeded at the same cell density and cultured for 3 d, the density of the cells in FCeM-N (Figs. 1A–D) was larger than that in FCeM-D (Figs. 1E–H). Neurites were clearly observed in cultures seeded at 2.25 × 10⁶ cells/mL (Figs. 1A, B, E, F), whereas neurites were not clearly observed owing to excessively high cell density in cultures seeded at 4.5 × 10⁶ cells/mL (Figs. 1C, G) and 2.25 × 10⁷ cells/mL (Figs. 1D, H). While observing single cell body at high magnification, three-dimensionally extended neurites from the cell body were observed (Figs. 1B, F). The number of neurites observed in FCeM-N (Figs. 1A, B) was higher than that in FCeM-D (Figs. 1E, F).

Fig. 1. Morphology of Mouse Cortical Neurons Cultured in Either Neurobasal Medium with FP001 or DMEM with FP001

Cortical neurons derived from embryonic C57BL/6-Tg (CAG-EGFP) mice were cultured for 3 d in the FCeM (three-dimensional cultures), followed by observation with Z-stack image acquisition using a confocal laser-scanning microscope. Cortical neurons seeded at 2.25 × 10⁶ (A, B, E, F), 4.50 × 10⁶ (C, G), or 7.50 × 10⁶ cells/mL (D, H) were cultured in the FCeM-N (A–D) or FCeM-D (E–H). Panel (B) and (F) show high-magnification observation of panel (A) and (E), respectively. The experiment was repeated in triplicates, and typical fluorescence images are shown. (Color figure can be accessed in the online version.)

Next, distributions of three-dimensionally cultured neurons in the medium containing FP001 was compared with those two-dimensionally cultured in the medium not containing FP001. Neurons cultured in the Neurobasal medium (Fig. 2A) or DMEM (Fig. 2C) at 7.5 × 10⁵ cells/mL were two-dimensionally distributed on the bottom of the culture dish in the plane direction. On the other hand, neurons cultured in the FCeM-N (Fig. 2B) or FCeM-D (Fig. 2D) at 2.25 × 10⁶ cells/mL were three-dimensionally distributed not only on the bottom of the dish, but also throughout the media within the observation range. Thus, it was shown that three-dimensional extension of neurites can be observed for neurons cultured in the FP001-containing medium.

Fig. 2. Difference between Distribution of Cortical Neurons Cultured in the Medium without and with FP001

Cortical neurons derived from embryonic C57BL/6-Tg (CAG-EGFP) mice were cultured for 3 d in the medium in absence (two-dimensional cultures) or presence of FP001 (three-dimensional cultures), followed by observation with Z-stack image acquisition using a confocal laser-scanning microscope. Cortical neurons seeded at 7.5 × 10⁵ cells/mL were cultured in the Neurobasal medium (A) or DMEM (C). Cortical neurons seeded at 2.25 × 10⁶ cells/mL were cultured in the FCeM-N (B) or FCeM-D (D). The experiment was repeated in triplicates independently, and typical fluorescence images are shown. (Color figure can be accessed in the online version.)

Expression of Neurotransmitter Phenotype-Related Genes in the Cultured Neurons

Neurotransmitter phenotype was next examined in the neurons three-dimensionally cultured in the FP001-containing medium. In neurons cultured in FCeM-N and FCeM-D, mRNA expression of the glutamatergic neuronal marker, VGLUT1, and the dopaminergic neuronal marker, tyrosine hydroxylase (TH), was higher and tended to be higher, respectively, whereas that of the GABAergic neuronal marker, glutamate decarboxylase (GAD), was lower, compared to that in neurons cultured in the Neurobasal medium and DMEM without FP001, respectively (Figs. 3A, B). Since these observations were common in the two media, it was speculated that three-dimensional culture using FP001 would be responsible for the difference in neurotransmitter phenotype. mRNA expression of the adrenergic neuronal marker, phenylethanolamine N-methyltransferase (PNMT), was detected in neurons cultured in the Neurobasal medium, but not in DMEM (Figs. 3A, B). The expression of PNMT was higher in cells grown in the FCeM-N compared to the Neurobasal medium (Fig. 3A). In addition, protein expression of VGLUT1 in neurons cultured in the FCeM-N and in cerebral cortex of embryonic mice tended to be higher than those cultured in the Neurobasal medium (Fig. 3C). These results suggested that three-dimensional culture using FP001 may promote maturation into excitatory neurons and suppress maturation into inhibitory neurons.

Fig. 3. Effect of the FCeM on Expression of the Markers for Neurotransmitter Phenotype in Cultured Cortical Neurons

Cortical neurons derived from embryonic ICR mice were cultured for 3 d in the Neurobasal medium (A, C) or DMEM (B). Cortical neurons seeded at 7.5 × 10⁵ cells/mL were cultured in the medium without FP001 (white columns; two-dimensional cultures). Cortical neurons seeded at 2.25 × 10⁶ cells/mL were cultured in the FCeM (black columns; three-dimensional cultures). (A, B) Total RNA was then extracted from cortical neurons for quantitative RT-PCR analysis. Each value was normalized by the expression level of 36B4 mRNA and expressed as a relative to the expression of two-dimensional cultures. Each value represents mean ± S.E.M. (n = 4–10). The statistical significance of differences was determined by Student’s t-test. * p < 0.05, significant difference from the corresponding mRNA level in two-dimensional cultures. ND: not detectable; which means that samples were not detected until the end of the PCR reactions. (C) Cortical neurons and cerebral cortices from 15-d-old embryonic ICR mice (dot columns) were homogenized, followed by SDS-PAGE for immunoblotting using the antibodies against VGLUT1 and β-actin. Western blots are shown in left panels. Intensity of each band is normalized by that of β-actin. Each value represents the mean ± S.E.M. (n = 4).

Effects of the FCeM Medium on Neuronal Maturation in Cultured Neurons

Three-dimensional culture using FP001 accelerated the differentiation of HepaRG cells into mature hepatocytes,²²⁾ suggesting that primary culture using FP001 may promote cellular maturation. Therefore, neuronal maturation was next examined in neurons three-dimensionally cultured in the FCeM medium. Expression of the mature neuronal marker, MAP2a,b, and the synapse marker, Synapsin I, in neurons cultured in the FCeM-N was significantly higher than that in neurons cultured in the Neurobasal medium without FP001 (Fig. 4). Expression of MAP2a,b in neurons cultured in the FCeM-N was more similar to that in cerebral cortex of embryonic mice, compared to neurons cultured in the Neurobasal medium (Fig. 4). These results suggested that three-dimensional culture using FP001 may promote neuronal maturation, and neurons in the FP001-containing medium could be cultured in the conditions similar to those in embryonic brain.

Fig. 4. Effect of the FCeM on Expression of the Markers for Neuronal Maturation in Cultured Cortical Neurons

Cortical neurons from ICR mice seeded at 7.5 × 10⁵ and 2.25 × 10⁶ cells/mL were cultured for 3 d in the Neurobasal medium (white columns; two-dimensional cultures) and FCeM-N (black columns; three-dimensional cultures), respectively. Cortical neurons and cerebral cortices from 15-d-old embryonic ICR mice (dot columns) were homogenized, followed by SDS-PAGE for immunoblotting using antibodies against MAP2, Synapsin I, βIII-tubulin, and β-actin. Intensity of each band was normalized against that of β-actin. Each value represents the mean ± S.E.M. (n = 5–6). The statistical significance of differences was determined by one-way ANOVA with the Tukey–Kramer test. * p < 0.05, significant difference from the value obtained in two-dimensional cultures. ^# p < 0.05, significant difference from the value obtained in three-dimensional cultures.

Effects of the FCeM on Sensitivity to Glutamate in Cultured Neurons

Since the data of mRNA (Figs. 3A, B) and protein expression (Fig. 3C) may suggest that glutamatergic neurons may be increased by culturing neurons in the FCeM, we next investigated whether culturing in the FCeM affects the sensitivity of neurons to glutamate. Exposure to 100–1000 µM glutamate for 24 h minimally changed MTT reduction in neurons cultured in the Neurobasal medium (Fig. 5A). On the other hand, exposure to 300 µM or higher concentration of glutamate significantly enhanced MTT reduction in neurons cultured in the FCeM-N (Fig. 5B). These results suggested that three-dimensional culture using FP001 may increase mitochondrial activity in response to glutamate. On the other hand, exposure to 100 µM H₂O₂ for 24 h significantly suppressed MTT reduction regardless of the presence of FP001 (Fig. 5), indicating that both of the cultured neurons are responsive to oxidative stress induced by H₂O₂.

Fig. 5. Effect of the FCeM on the Sensitivity to Glutamate in Cultured Cortical Neurons

Cortical neurons from ICR mice seeded at 7.5 × 10⁵ and 2.25 × 10⁶ cells/mL were cultured for 3 d in the Neurobasal medium (A; two-dimensional cultures) and FCeM-N (B; three-dimensional cultures), respectively. The cortical neurons were then exposed to 100–1000 µM glutamate or 100 µM H₂O₂ for 24 h, and mitochondrial activity was measured via MTT assay. Each value was normalized by the control value obtained in the absence of glutamate or H₂O₂ and represents mean ± S.E.M. (n = 8–9). The statistical significance of differences was determined by one-way ANOVA with the Tukey–Kramer test. * p < 0.05, significant difference from the control value.

DISCUSSION

The present study demonstrated that neurons can be three-dimensionally cultured in the FCeM (Figs. 1, 2). There have been many studies that have reported using embedding culture method for conventional three-dimensional neuronal culture.^13–15) In embedding culture, however, gels or fibers, used as scaffolds, may obstruct the diffusion of compounds added into the medium and the collection of cells aside from gels or fibers. This may provide difficulty in evaluating the activity of compounds in the neurons. On the other hand, the viscosity of the FCeM is almost equal to that of water,^18,19) and the compounds added can easily diffuse in the medium. Furthermore, since neurons can be easily separated from FP001 by centrifugation, the cells can be easily isolated. In fact, in the present study, we evaluated the effect of glutamate, added into the medium, on MTT reduction ability of neurons (Fig. 5). Expression of various neuronal markers in neurons cultured in the FCeM was also examined by quantitative PCR and Western blotting (Figs. 3, 4). Thus, by mixing the functional polymer, FP001, into the culture medium, a novel three-dimensional culture system for neurons facilitating easier drug addition and cell collection was constructed. In vitro models of neurodegenerative disorders have previously been produced by the addition of neurotoxins into the medium.^23–25) FP001 may be used as a scaffold to produce such in vitro pathological models using three-dimensional cultured neurons. Furthermore, in vitro neurodegenerative disorder model using FP001 may be applied to the assay of neuroprotective effects induced by the addition of drugs.

The expression of the matured neuronal marker, MAP2a,b, and the synapse formation marker, Synapsin I, in neurons three-dimensionally cultured in the FCeM was significantly higher than that in neurons two-dimensionally cultured in FP001-free medium (Fig. 4), suggesting that culture using FP001 may promote neuronal maturation and synapse formation. Neurons extend neurites, connect to other neurons, and form synapses. The synapse formation is one of the key processes in the formation of neuronal networks.^26,27) In three-dimensionally cultured neurons, neurites are extended in the vertical direction along with the planar direction (Fig. 1), and neurons may interact with other neurons not only in a plane, but also in a stereoscopic manner. Thereby, synapse formation may be promoted in three-dimensionally cultured neurons. It might be also noteworthy that the expression pattern of MAP2a,b in three-dimensionally cultured neurons was more similar to that in the mouse embryonic cerebral cortex, compared to neurons two-dimensionally cultured in the FP001-free medium (Fig. 4). Certain clinically used drugs, such as selective serotonin reuptake inhibitors and β2 stimulants, exhibit neurotoxicity in the embryonic brain as adverse effects.^28,29) The three-dimensional neuronal culture using FP001 may be employed for the evaluation of neurotoxicity in the embryonic brain.

Glutamate is a major excitatory neurotransmitter that regulates brain functions, such as learning and memory, in the central nervous system.^30,31) Excessive activation of glutamate receptor due to elevation of extracellular glutamate concentration causes excitotoxicity in neurons and is involved in the onset and/or development of neurodegenerative diseases including Alzheimer’s and Parkinson’s diseases.^32,33) The mRNA expression of the glutamatergic neuronal marker, VGLUT1, in neurons three-dimensionally cultured in FP001-containing medium was higher than that in two-dimensionally cultured neurons without FP001 (Fig. 3), suggesting that neuronal culture using FP001 may promote neurotransmission of glutamatergic neurons. Indeed, MTT reduction activity was minimally altered by the addition of glutamate into the medium in two-dimensionally cultured neurons without FP001 (Fig. 5A), but was significantly enhanced after the exposure to 300–1000 µM glutamate in neurons three-dimensionally cultured with FP001 (Fig. 5B). Under the present experimental conditions, neurotoxicity seemed to not be induced by exposure to high concentration of glutamate (Fig. 5). Glutamate neurotoxicity is triggered by excessive influx of Ca²⁺ into intracellular space through N-methyl-D-aspartate (NMDA) receptor channels^34,35) and usually evoked at the concentrations of 50–100 µM glutamate in mature neurons.^36,37) On the other hand, glutamate does not induce excitotoxicity in immature neurons.^36–38) Such difference could be due to the differences in the NMDA receptor subunits expressed between mature and immature neurons.^39,40) Since immature neurons cultured for 3 d were used in the present study, excitotoxicity by glutamate might not be induced (Fig. 5). In the early stages of brain development, glutamate is thought to be neurotrophically active,^41,42) and may act as a neurotrophin in neurons cultured with FP001, which may abundantly include glutamatergic neurons (Fig. 5B). This result also suggested that in vitro experimental system similar to the embryonic brain may be constructed by three-dimensional culture using FP001, compared to two-dimensional one. Since abnormalities in the formation of neuronal networks in the embryonic period are involved in the onset of various neuropsychiatric disorders,⁴²⁾ three-dimensionally cultured neurons using FP001 are expected to become an effective analytical tool for elucidation of the onset mechanisms of neuropsychiatric disorders.

Although expression pattern of the mature neuronal marker, MAP2a,b, in neurons that are three-dimensionally cultured may be similar to that in the embryonic brain neurons (Fig. 4), it would be an important research topic in the future to investigate whether the properties of the neurons cultured in the FCeM for a long period are similar to those of the adult brain neurons. Nevertheless, it would be difficult to change the medium without disrupting the three-dimensionally formed neuronal networks, because the viscosity of the FCeM is almost equal to that of water,^18,19) and no gelation was found in the medium containing FCeM during the culture period in the present study (data not shown). Such problem in the medium change may be solved by constructing the system in another chamber separated by a membrane, which permeates water-soluble solutes in the medium, next to the chamber of neurons three-dimensionally cultured, and the second chamber would be used for supplying necessary substance and/or removing unnecessary medium. Furthermore, to mimic the environment of the living brain, it would be preferable to co-culture the neurons with other surrounding cells, such as astrocytes and microglia. In fact, co-culture of neurons with glial cells promotes formation of matured functional synapse.^43–45) Thus, the present study provided the first step for three-dimensional primary culture of neurons showing neuronal maturation in presence of FP001, and further studies are required to construct a three-dimensional culture model resembling the adult brain.

Acknowledgments

The authors would like to thank Mr. Yuichi Tanaka in Kanazawa University for technical assistance. This work was partially supported by a Grant-in-Aids for Scientific Research to NN [16K08266] and to YK [17K19482] from the Ministry of Education, Culture, Sports, Science and Technology of Japan.

Conflict of Interest

The authors declare no conflict of interest. Yukio Kato serves as a consultant to Nissan Chemical Industries, Ltd.

REFERENCES

• 1) Palop JJ, Mucke L. Amyloid-beta-induced neuronal dysfunction in Alzheimer’s disease: from synapses toward neural networks. Nat. Neurosci., 13, 812–818 (2010).
• 2) Voineskos D, Rogasch NC, Rajji TK, Fitzgerald PB, Daskalakis ZJ. A review of evidence linking disrupted neural plasticity to schizophrenia. Can. J. Psychiatry, 58, 86–92 (2013).
• 3) Chaudhury D, Liu H, Han MH. Neuronal correlates of depression. Cell. Mol. Life Sci., 72, 4825–4848 (2015).
• 4) Canter RG, Penney J, Tsai LH. The road to restoring neural circuits for the treatment of Alzheimer’s disease. Nature, 539, 187–196 (2016).
• 5) Dulla CG, Coulter DA, Ziburkus J. From Molecular circuit dysfunction to disease: case studies in epilepsy, traumatic brain injury, and Alzheimer’s disease. Neuroscientist, 22, 295–312 (2016).
• 6) Hogberg HT, Bressler J, Christian KM, Harris G, Makri G, O’Driscoll C, Pamies D, Smirnova L, Wen Z, Hartung T. Toward a 3D model of human brain development for studying gene/environment interactions. Stem Cell Res. Ther., 4 (Suppl. 1), S4 (2013).
• 7) Ribeiro A, Balasubramanian S, Hughes D, Vargo S, Powell EM, Leach JB. β1-Integrin cytoskeletal signaling regulates sensory neuron response to matrix dimensionality. Neuroscience, 248, 67–78 (2013).
• 8) Dingle YT, Boutin ME, Chirila AM, Livi LL, Labriola NR, Jakubek LM, Morgan JR, Darling EM, Kauer JA, Hoffman-Kim D. Three-dimensional neural spheroid culture: an in vitro model for cortical studies. Tissue Eng. Part C Methods, 21, 1274–1283 (2015).
• 9) Mani SA, Guo W, Liao MJ, Eaton EN, Ayyanan A, Zhou AY, Brooks M, Reinhard F, Zhang CC, Shipitsin M, Campbell LL, Polyak K, Brisken C, Yang J, Weinberg RA. The epithelial–mesenchymal transition generates cells with properties of stem cells. Cell, 133, 704–715 (2008).
• 10) Hubbard KS, Gut IM, Lyman ME, Tuznik KM, Mesngon MT, McNutt PM. High yield derivation of enriched glutamatergic neurons from suspension-cultured mouse ESCs for neurotoxicology research. BMC Neurosci., 13, 127 (2012).
• 11) Ashton RS, Banerjee A, Punyani S, Schaffer DV, Kane RS. Scaffolds based on degradable alginate hydrogels and poly(lactide-co-glycolide) microspheres for stem cell culture. Biomaterials, 28, 5518–5525 (2007).
• 12) Purcell EK, Singh A, Kipke DR. Alginate composition effects on a neural stem cell-seeded scaffold. Tissue Eng. Part C Methods, 15, 541–550 (2009).
• 13) Allodi I, Guzmán-Lenis MS, Hernàndez J, Navarro X, Udina E. In vitro comparison of motor and sensory neuron outgrowth in a 3D collagen matrix. J. Neurosci. Methods, 198, 53–61 (2011).
• 14) Smith I, Haag M, Ugbode C, Tams D, Rattray M, Przyborski S, Bithell A, Whalley BJ. Neuronal-glial populations form functional networks in a biocompatible 3D scaffold. Neurosci. Lett., 609, 198–202 (2015).
• 15) Puschmann TB, de Pablo Y. Zande’n, Liu J, Pekny M. A novel method for three-dimensional culture of central nervous system neurons. Tissue Eng. Part C Methods, 20, 485–492 (2014).
• 16) Chandrasekaran R, Thailambal VG. The influence of calcium ions, acetate and L-glycerate groups on the gellan double-helix. Carbohydr. Polym., 12, 431–442 (1990).
• 17) Nitta Y, Nishinari K. Gelation and gel properties of polysaccharides gellan gum and tamarind xyloglucan. J. Biol. Macromol., 5, 47–52 (2005).
• 18) Otsuji TG, Bin J, Yoshimura A, Tomura M, Tateyama D, Minami I, Yoshikawa Y, Aiba K, Heuser JE, Nishino T, Hasegawa K, Nakatsuji N. A 3D sphere culture system containing functional polymers for large-scale human pluripotent stem cell production. Stem Cell Reports, 2, 734–745 (2014).
• 19) Aihara A, Abe N, Saruhashi K, Kanaki T, Nishino T. Novel 3-D cell culture system for in vitro evaluation of anticancer drugs under anchorage-independent conditions. Cancer Sci., 107, 1858–1866 (2016).
• 20) Nakamichi N, Taguchi T, Hosotani H, Wakayama T, Shimizu T, Sugiura T, Iseki S, Kato Y. Functional expression of carnitine/organic cation transporter OCTN1 in mouse brain neurons: possible involvement in neuronal differentiation. Neurochem. Int., 61, 1121–1132 (2012).
• 21) Nakamichi N, Kambe Y, Oikawa H, Ogura M, Takano K, Tamaki K, Inoue M, Hinoi E, Yoneda Y. Protection by exogenous pyruvate through a mechanism related to monocarboxylate transporters against cell death induced by hydrogen peroxide in cultured rat cortical neurons. J. Neurochem., 93, 84–93 (2005).
• 22) Higuchi Y, Kawai K, Kanaki T, Yamazaki H, Chesné C, Guguen-Guillouzo C, Suemizu H. Functional polymer-dependent 3D culture accelerates the differentiation of HepaRG cells into mature hepatocytes. Hepatol. Res., 46, 1045–1057 (2016).
• 23) Bao XQ, Kong XC, Kong LB, Wu LY, Sun H, Zhang D. Squamosamide derivative FLZ protected dopaminergic neuron by activating Akt signaling pathway in 6-OHDA-induced in vivo and in vitro Parkinson’s disease models. Brain Res., 1547, 49–57 (2014).
• 24) Zhang Z, Lai D, Wang L, Yu P, Zhu L, Guo B, Xu L, Zhou L, Sun Y, Lee SM, Wang Y. Neuroprotective effects of the andrographolide analogue AL-1 in the MPP⁺/MPTP-induced Parkinson’s disease model in vitro and in mice. Pharmacol. Biochem. Behav., 122, 191–202 (2014).
• 25) Plaschke K, Kopitz J. In vitro streptozotocin model for modeling Alzheimer-like changes: effect on amyloid precursor protein secretases and glycogen synthase kinase-3. J. Neural Transm., 122, 551–557 (2015).
• 26) Colón-Ramos DA. Synapse formation in developing neural circuits. Curr. Top. Dev. Biol., 87, 53–79 (2009).
• 27) Chen SY, Cheng HJ. Functions of axon guidance molecules in synapse formation. Curr. Opin. Neurobiol., 19, 471–478 (2009).
• 28) Simpson KL, Weaver KJ, de Villers-Sidani E, Lu JY, Cai Z, Pang Y, Rodriguez-Porcel F, Paul IA, Merzenich M, Lin RC. Perinatal antidepressant exposure alters cortical network function in rodents. Proc. Natl. Acad. Sci. U.S.A., 108, 18465–18470 (2011).
• 29) Witter FR, Zimmerman AW, Reichmann JP, Connors SL. In utero beta 2 adrenergic agonist exposure and adverse neurophysiologic and behavioral outcomes. Am. J. Obstet. Gynecol., 201, 553–559 (2009).
• 30) Nakanishi S. Molecular diversity of glutamate receptors and implications for brain function. Science, 258, 597–603 (1992).
• 31) Pál B. Involvement of extrasynaptic glutamate in physiological and pathophysiological changes of neuronal excitability. Cell. Mol. Life Sci., 75, 2917–2949 (2018).
• 32) Meldrum BS. Glutamate as a neurotransmitter in the brain: review of physiology and pathology. J. Nutr., 130 (Suppl.), 1007S–1015S (2000).
• 33) Kalia LV, Kalia SK, Salter MW. NMDA receptors in clinical neurology: excitatory times ahead. Lancet Neurol., 7, 742–755 (2008).
• 34) Choi DW. Ionic dependence of glutamate neurotoxicity. J. Neurosci., 7, 369–379 (1987).
• 35) Choi DW, Koh JY, Peters S. Pharmacology of glutamate neurotoxicity in cortical cell culture: attenuation by NMDA antagonists. J. Neurosci., 8, 185–196 (1988).
• 36) Choi DW, Maulucci-Gedde M, Kriegstein AR. Glutamate neurotoxicity in cortical cell culture. J. Neurosci., 7, 357–368 (1987).
• 37) Zhang J, Haddad GG, Xia Y. δ-, but not μ- and κ-, opioid receptor activation protects neocortical neurons from glutamate-induced excitotoxic injury. Brain Res., 885, 143–153 (2000).
• 38) Monnerie H, Shashidhara S, Le Roux PD. Effect of excess extracellular glutamate on dendrite growth from cerebral cortical neurons at 3 days in vitro: involvement of NMDA receptors. J. Neurosci. Res., 74, 688–700 (2003).
• 39) Didier M, Xu M, Berman SA, Saido TC, Bursztajn S. Involvement of three glutamate receptor epsilon subunits in the formation of N-methyl-D-aspartate receptors mediating excitotoxicity in primary cultures of mouse cerebellar granule cells. Neuroscience, 78, 1129–1146 (1997).
• 40) Mizuta I, Katayama M, Watanabe M, Mishina M, Ishii K. Developmental expression of NMDA receptor subunits and the emergence of glutamate neurotoxicity in primary cultures of murine cerebral cortical neurons. Cell. Mol. Life Sci., 54, 721–725 (1998).
• 41) Haydar TF, Wang F, Schwartz ML, Rakic P. Differential modulation of proliferation in the neocortical ventricular and subventricular zones. J. Neurosci., 20, 5764–5774 (2000).
• 42) Kirischuk S, Sinning A, Blanquie O, Yang JW, Luhmann HJ, Kilb W. Modulation of neocortical development by early neuronal activity: physiology and pathophysiology. Front. Cell. Neurosci., 11, 379 (2017).
• 43) Ullian EM, Sapperstein SK, Christopherson KS, Barres BA. Control of synapse number by glia. Science, 291, 657–661 (2001).
• 44) Hu R, Cai WQ, Wu XG, Yang Z. Astrocyte-derived estrogen enhances synapse formation and synaptic transmission between cultured neonatal rat cortical neurons. Neuroscience, 144, 1229–1240 (2007).
• 45) Jones EV, Cook D, Murai KK. A neuron-astrocyte co-culture system to investigate astrocyte-secreted factors in mouse neuronal development. Methods Mol. Biol., 814, 341–352 (2012).