Gastrodin Inhibits H₂O₂-Induced Ferroptosis through Its Antioxidative Effect in Rat Glioma Cell Line C6

Abstract

Ferroptosis is a form of necrosis caused by iron-induced accumulation of lipid hydroperoxide, involving several molecular events, and has been implicated in Parkinson’s disease. Gastrodin is a component of Gastrodia elata Blume with strong antioxidant activity. We examined whether gastrodin can prevent H₂O₂-induced cytotoxicity in rat glioma cell line C6. For this purpose, C6 cells were pretreated with gastrodin (1, 5, 25 µM) and then exposed to 100 µM H₂O₂. Results showed that pretreatment of C6 cells with gastrodin decreased H₂O₂-induced lactate dehydrogenase (LDH) release and cell death. Moreover, gastrodin decreased intracellular malondialdehyde (MDA) level, whereas increased glutathione peroxidase (GPX) activity and glutathione (GSH) level after H₂O₂ treatment. In addition, treatment of deferoxamine (DFO), ferrostatin-1, and liproxstatin-1 abolished ferroptosis induced by H₂O₂ or erastin pretreatment. Treatment with gastrodin attenuated H₂O₂-induced ferroptosis and decreased lipid reactive oxygen species (ROS) (C11-BODIPY) production in C6 cells. Moreover, gastrodin increased the protein expression of nuclear factor erythroid 2-related factor 2 (Nrf2), GPX4, ferroportin-1 (FPN1), and heme oxygenase-1 (HO-1) in C6 cells treated with H₂O₂. RSL3, a GPX4 inhibitor, inhibited GPX4 protein level in cells co-treated with gastrodin and 100 µM H₂O₂. These findings indicate that gastrodin can inhibit H₂O₂-induced ferroptosis through its antioxidative effect in C6 cells.

INTRODUCTION

Cell death is an integral process in many neurodegenerative diseases (ND), including Parkinson’s disease (PD), Alzheimer’s disease (AD), Huntington’s disease, and Amyotrophic lateral sclerosis, but the mechanisms of cell death associated with neurodegenerative diseases are not very clear.¹⁾ Oxidative stress has been implicated in a variety of pathophysiological conditions such as neurodegenerative disorders, as well as in patients with PD and AD.²⁾ The pharmacological effects of gastrodin (4-hydroxyapatite-4-hydroxyapatite-glucoside) in PD mainly include antioxidation and neuroprotection.^3,4) Oxidative stress is a major cause of cell death as it promotes ferroptosis,⁵⁾ however, its mechanism is unclear. Ferroptosis is a genetically regulated form of necrotic cell death, which promotes iron-dependent lipid peroxidation by inhibiting cysteine/glutamate anti-transporter (system XC-) and glutathione peroxidase 4 (GPX4).^6,7) Ferroptosis has a critical role in various diseases and is an important therapeutic target, but little is known about the mechanisms of ferroptosis associated with PD.^1,7) Studies have shown that H₂O₂ can cause lipid peroxidation.⁸⁾ Other researchers have reported that gastrodin protects against cardiac hypertrophy,^9–11) and inhibits glutamate-induced apoptosis of pheochromocytoma of the rat adrenal medulla (PC12) cells.^12,13) Our group has previously demonstrated that ferrostatin-1 reverses the ferroptosis induced by glutamate in mice hippocampal neuronal (HT-22) cells.¹⁴⁾ Based on previous research findings,^12,15) we inferred that gastrodin may have neuroprotective effects. However, the exact mechanism has not been elucidated. Therefore, we examined whether gastrodin can prevent H₂O₂-induced neurotoxicity in the rat glioma cell line C6 (a widely used model of Parkinson’s disease).²⁾ Notably, we showed that gastrodin confers cytoprotection against the H₂O₂-induced ferroptosis through its antioxidative effect.

MATERIALS AND METHODS

Cell Lines and Culture

C6 cells were purchased from the Cell Bank of the Chinese Academy of Sciences (Shanghai, China). They were cultured in Dulbecco’s modified Eagle’s medium (DMEM)-high glucose (HyClone, South Logan, UT, U.S.A.) supplemented with 10% fetal bovine serum (FBS) (Gibco, Grand Island, NY, U.S.A.), 100 U/mL of penicillin and 100 µg/mL of streptomycin (Beyotime, Shanghai, China) under a humidified environment at 37°C in an incubator with 5% CO₂.

Materials and Cell Death Inhibitors

Gastrodin (purity > 98%) was purchased from Herbest (Baoji, Shanxi, China). 3-(4,5-Dimethyl-2-thiazolyl)-2,5-diphenyl-2H-tetrazolium bromide (MTT) assay kits and trypsin–ethylene diamine tetraacetic acid (EDTA) were obtained from Beyotime. 3% H₂O₂ solution was provided by Anjie Gaoke (Shandong, China). Erastin (#HY-15763), liproxstatin-1 (lip-1) (#HY-12726) and RSL3 (#HY-100218 A) were purchased from MedChem Express (Monmouth Junction, NJ, U.S.A.). Deferoxamine (DFO) was obtained from Sigma-Aldrich (St. Louis, MO, U.S.A.). Ferrostatin-1 (Fer-1) was obtained from Selleck (Shanghai, China). Other chemicals and reagents were of analytical grade.

Lactate Dehydrogenase (LDH) Release Assay and Cell Death Inhibitor Assay

C6 cells grown to the logarithmic phase were digested, collected and diluted according to the guidelines description on the LDH assay kit (Beyotime).^16,17) C6 cells were put in a 96-well culture plate (2 × 10⁴ cells/well) and incubated in an incubator with 5% CO₂ for 12 h at 37°C. Each group was tested in 6 multiple wells with each well having a volume of 100 µL. C6 cells in fresh DMEM solution containing different concentrations of gastrodin (1, 5, 25 µM) were exposed to 100 µM H₂O₂ for 12 h. According to the grouping, the cells assigned to the H₂O₂ group were cultured in a DMEM medium containing 100 µM H₂O₂. In the treatment group, fer-1, lip-1, DFO were separately added 1 h before 100 µM H₂O₂. After culturing at 37°C and 5% CO₂ for 12 h, MTT assay was performed as previously described.¹⁸⁾

Transmission Electron Microscopy

C6 cells were seeded in 6-well culture plates (2 × 10⁵ cells/well) and pretreated with gastrodin (25 µM) for 1 h and then exposed to 100 µM H₂O₂. The cells were then incubated for 12 h. Thereafter, they were digested and collected in phosphate buffer saline (PBS). This was followed by immobilization with 2.5% glutaraldehyde in 0.1% sodium chloride buffer. The preparation method comprised the following steps: trimming, preparation of a semi-thin section, positioning, preparation of an ultra-thin section, and dyeing with the lead acid. Finally, they were observed and images captured using the Hitachi-600 (Tokyo, Japan) transmission electron microscope. Cell morphology was analyzed as previously described.¹⁾

Determination of GPX Activity, Intracellular Glutathione (GSH) Levels and Malondialdehyde (MDA) Activity

About 2 × 10⁵ C6 cells were pretreated in a 6-well plates in the presence or absence of gastrodin (1–25 µM) for 1 h prior to exposure to H₂O₂ (100 µM) for 12 h. GPX (Jiancheng, Jiangsu, China) activity and catalase (CAT) (Solarbio, Beijing, China) activity were measured as previously described.^19,20) The intracellular GSH (Beyotime, Shanghai, China) levels were measured as previously described.²¹⁾ MDA (Jiancheng) was tested using thiobarbutiric acid-reactive substances (TBARS) as reported before.²²⁾

Detection of Intracellular Iron Ions

C6 cells cultured in DMEM were washed and removed twice with pre-cooled PBS 2 mL. C6 cells were lysed on a shaking table for 130 min with 200 µL/hole, and then calorimetrically assayed for measured of intracellular iron ion according to the instructions of the kit (Applygen Technologies, Beijing, China). Colorimetric analysis was carried out at 540–580 nm with a multifunctional enzyme marker (ELX800uv, BioTek, Biotek Winooski, VT, U.S.A.).

Reactive Oxygen Species (ROS) Production

Cytoplasmic ROS levels were measured using the C11-BODIPY581/591 (Thermo Fisher Scientific Waltham, MA, U.S.A.) reagent. C6 cells were incubated with C11-BODIPY (581/591) at a final concentration of 10 µM in serum-free DMEM for 30 min at 37°C in the dark. Subsequently, cytoplasmic ROS levels were measured by flow cytometry (Beckman Coulter, Brea, CA, U.S.A.). Quantification of red and green signals was performed with the Image J software (U.S. National Institutes of Health, Bethesda, MD, U.S.A.).

Western Blot Analysis

Total proteins were extracted from C6 cells, and the protein concentrations were measured by bicinchoninic acid (BCA) assay kit (Beyotime). Western blot was performed as previously described.²³⁾ The following primary antibodies used were used: Heme oxygenase-1 (HO-1) (#82206, CST, Dilution: 1 : 1000), GPX4 (ab125066, Abcam, Dilution: 1 : 1000), nuclear factor erythroid 2-related factor 2 (Nrf2) (ab137550, Abcam, Dilution: 1 : 1000), prostaglandin peroxidase synthase 2 (PTGS2) (#12282, CST, Dilution: 1 : 1000), acyl-Coa synthetase long chain family member 4 (ACSL4) (ab155282, Abcam, Dilution: 1 : 10000), ferroportin-1 (FPN1) (ab78066, Abcam, Dilution: 1 : 500), and β-actin (TA-09, ZSGB-BIO, Dilution: 1 : 1000, Beijing, China). The secondary antibodies used were: peroxidase-conjugated goat anti-mouse immunoglobulin G (IgG) (H + L), and peroxidase-conjugated goat anti-rabbit IgG (H + L) which were purchased from ZSGB-BIO (Beijing, China). Digital images of protein bands were captured by Chemidoc XRS (BioRad, Hercules, CA, U.S.A.).

Quantitative Real Time (qRT)-PCR

According to previous reports,²⁴⁾ C6 cells were seeded in 6-well plates (2.5 × 10⁵), and then treated with gastrodin (1, 5, 25 µM) in the presence or absence of 100 µM H₂O₂. Total RNA was extracted from the HT-22 cells with TRIzol reagent (BRL, Grand Island, NY, U.S.A.). The RNA was reverse-transcribed into cDNA using the reverse transcription system in 20 µL reaction according to the manufacturer’s instructions. qRT-PCR was performed to amplify the cDNA using the 2× SYBR Green PCR Master Mix (Bimake, Houston, TX, U.S.A.). The following primers (Invitrogen, Carlsbad, CA, U.S.A.) were used (Table 1).

Table 1. Sequence of the Gene Primers

Gene name	Forward prime (5′ to 3′)	Reverse prime (5′ to 3′)
β-Actin	CCCATCTATGAGGGTTACGC	TTTAATGTCACGCACGATTTC
GPX4	CCCATTCCCGAGCCTTTCAACC	GGATGCACACAAGCCCAGGAAC

Statistical Analysis

Data are presented as mean ± standard deviation (S.D.) from 3 independent experiments. Comparison between groups was conducted by one-way ANOVA and Student’s t-test using GraphPad Prism 6.0 software (La Jolla, CA, U.S.A.). A p value <0.05 was considered to be statistically significant.

RESULTS

H₂O₂ Induces Ferroptosis in C6 Cells

We evaluated the toxicity of H₂O₂ treatment on C6 cells. Treatment with H₂O₂ at a final concentration of 100 µM for 12 h decreased the cell viability to 51.7 ± 1.55% compared with the control group (p < 0.01, Fig. 1A). Thus, these concentrations (100 µM H₂O₂) and period (12 h) were used in the subsequent tests. The toxicity of H₂O₂ was suppressed by fer-1, lip-1, and DFO (ferroptosis inhibitor), which prevented accumulation of lipid peroxides (Fig. 1B). As shown in Fig. 1C, the effects of erastin or H₂O₂ on cell viability were abolished by ferrostatin-1 treatment. We also found that H₂O₂-induced ferroptosis was strongly suppressed by fer-1, DFO, and lip-1. These results show, at least partially, that the H₂O₂-induced cell death due to ferroptosis, was particularly related to lipid ROS.

Fig. 1. H₂O₂ Induced Ferroptosis in C6 Cells

(A) C6 cells were cultured with different concentrations of H₂O₂ for varied durations and then assessed with MTT assay; (B) Viability of C6 cells treated with 100 µM H₂O₂, ferrostatin-1 (Fer-1, 12 µM), liproxstatin-1 (Lip-1, 38 nM), deferoxamine (DFO, 100 µM) for 12 h; (C) Viability of C6 cells co-treated with ferrostatin-1 (fer-1) 12 µM, and erastin (30 µM) or H₂O₂ (100 µM) for 12 h; Values are means ± S.D. of 3 independent experiments. (A) ** p < 0.01, * p < 0.05 compared with the control group; (B) (C) ^## p < 0.01, compared with the control group; * p < 0.05, ** p < 0.01, compared with the H₂O₂-treated or erastin-treated group.

Gastrodin Suppresses H₂O₂-Induced Ferroptosis

To determine the protective effect of gastrodin pretreatment on H₂O₂-induced injury to C6 cells, the cell viability was tested with MTT assay. As shown in Fig. 2A, H₂O₂ decreased cell viability and these effects were alleviated by 25 μΜ gastrodin treatment. In addition, 100 µM H₂O₂ increased the release of LDH which was suppressed by 1–25 µM gastrodin (Fig. 2B). We initially examined on the chronic effect of H₂O₂ on cell morphology because alteration of the cell shape is considered as an index of toxicity (Fig. 2C). C6 cells of the control group showed neuronal net shape and high branch process; C6 cells treated with 100 µM H₂O₂ lost the neurite-like shape and exhibited broader intercellular gaps. However, the morphology of cells treated with 1, 5, 25 µM gastrodin was characterized by extensive branching and intact intercellular joints. Mounting evidence suggests that FPN1 regulates ferroptosis.²⁵⁾ Here, we found that 100 µM H₂O₂ treatment decreased the FPN1 protein expression (Fig. 2D). Further tests were performed to identify the mechanism of the cytoprotective effect of gastrodin. We found that the levels of ACSL4 and cyclooxygenase 2 (COX2) were increased by 100 µM H₂O₂, but treatment with (1–25 µM) gastrodin reversed this effect (Figs. 2E, F). Ferrizine colorimetry can be used to quantify iron ions in cells. As shown in Fig. 2G, the increase in iron ion concentration by H₂O₂ was decreased by gastodin pretreatment. One to twenty five micro molar gastrodin blocked these morphologic changes induced by 100 µM H₂O₂ (Fig. 2H). Therefore, it can be deduced that gastrodin has protective effects on ferroptosis induced by H₂O₂.

Fig. 2. Effect of Gastrodin on H₂O₂-Induced Toxicity in C6 Cells

(A) The effect of gastrodin on the viability of C6 cells after treatment with 100 µM H₂O₂ as detected by MTT assay; (B) Effect of gastrodin on LDH leakage rate in C6 cells treated with 100 µM H₂O₂; (C) Morphological changes of C6 cells after treatment with 100 µM H₂O₂ or 25 µM gastrodin for 12 h (Scale bar: 100×); a: Control group; b: 100 µM H₂O₂ group_; c: 1 µM gastrodin + 100 µM H₂O₂ group_; d: 5 µM gastrodin + 100 µM H₂O₂ group; e: 25 µM gastrodin + 100 µM H₂O₂ group. (D, E, F) C6 cells were pretreated with 1–25 µM gastrodin and then with 100 µM H₂O₂ for 12h. The cell lysates were analyzed by Western blot with the indicated antibodies; (G) Changes in Fe²⁺ concentration as detected by intracellular iron ion colorimetry assay after treatment with H₂O₂ (100 µM) or gastrodin (1–25 µM); (H) The transmission electron microscopy was used to observe the mitochondria (Scale bar: 200 nm); Values are means ± S.D. of 3 independent experiments. ^## p < 0.01, compared with the control group; * p < 0.05, ** p < 0.01, compared with the H₂O₂-treated group.

Gastrodin Reduces the Production of ROS and Lipid Peroxidation in H₂O₂-Treated C6 Cells

Lipid peroxidation has been identified as the primary cause of ferroptosis. Therefore, we examined the effects of H₂O₂-treatment on lipid peroxidation in C6 cells. Using C11-BODIPY (581/591) probe, we showed that H₂O₂-induced death was accompanied by lipid accumulation, and this was strongly inhibited by gastrodin (Figs. 3A, B). To investigate whether gastrodin could inhibit oxidative stress induced by H₂O₂, the MDA level, GSH level, GPX activity and CAT activity were measured. Pretreatment with 100 µM H₂O₂ significantly increased intracellular MDA concentration in C6 cells, which was reversed by gastrodin treatment (Fig. 3C). As expected, the level of H₂O₂-induced GSH, GPX, CAT activity were significantly increased with gastrodin treatment (Figs. 3D–F). These results further showed that gastrodin activated the antioxidant system in C6 cells, indicating that GSH metabolism may be regulated by gastrodin.

Fig. 3. Effects of Gastrodin on 100 μM H₂O₂-Induced ROS and Lipid Peroxidation Level

(A, B) The effect of gastrodin on lipid ROS level in H₂O₂-treated C6 cells was assessed by C11-BODIPY; (C, D, F, H) The effect of gastrodin on MDA, GPX, GSH and CAT activity in C6 cells after treatment with 100 µM H₂O₂; Values are means ± S.D. of 3 independent experiments. ^## p < 0.01, compared with the control group; * p < 0.05, ** p < 0.01, compared with the H₂O₂ treated group.

Gastrodin Inhibits H₂O₂-Induced Ferroptosis in C6 Cells by Restoring GPX4 Activity

GPX4 is a selenocysteine-containing enzyme that converts lipid hydroperoxides to lipid alcohols, making it a master regulator of ferroptotic signaling. To further investigate the mechanism of ferroptosis regulation by gastrodin, we measured the expression level of GPX4 in C6 cells. In Figs. 4A–C, H₂O₂ treatment reduced the expression of GPX4 along with Nrf2 and HO-1, which is an unexpected result considering that ROS including H₂O₂ is a potent promoter of Nrf2 expression and transcriptional activity. More importantly, gastrodin (1–25 µM) pretreatment reversed the decrease of their expression. Moreover, compared to 100 µM H₂O₂, it was observed that gastrodin treatment increased GPX4 mRNA expression by 100 µM H₂O₂-induced (Fig. 4D). RSL3 (#HY-100218A, MedChem Express, Monmouth Junction, NJ, U.S.A.), is an inhibitor of GPX4. Cells were treated with this inhibitor to assess whether the effects of gastrodin were mediated by GPX4 activation. The results showed that compared with the gastrodin and H₂O₂ group, the RSL 3 with gastrodin and H₂O₂ group could reduce the cell viability (p < 0.05) (Fig. 4E). As shown in Fig. 4F, the GPX4 protein level was decreased by RSL3 group compared with that of gastrodin and 100 µM H₂O₂ (p < 0.01). We also found that Nrf2 and HO-1 protein likely mediated the protective effect of gastrodin against H₂O₂-induced ferroptosis (Figs. S1A, B). Collectively, these results suggest that gastrodin inbibits H₂O₂-induced ferroptosis by restoring GPX4 activity.

Fig. 4. Gastrodin Increased GPX4 Activation in H₂O₂-Treated C6 Cells

(A, B, C) The level of GPX4, Nrf2 and HO-1 protein after pretreatment with 100 µM H₂O₂ followed by 1–25 µM gastrodin in C6 cells. The effects were analyzed by Western blot using the indicated antibodies; (D) The mRNA level of GPX4 after pretreatment with 100 µM H₂O₂ followed by 1–25 µM gastrodin; (E, F) C6 cells were pretreated with 30 µM RSL3 in the presence or absence of gastrodin, or treated with 100 µM H₂O₂ for 12h and then analyzed by MTT assay and Western blot; Values are means ± S.D. of 3 independent experiments. ^## p < 0.01, compared with the control group; * p < 0.05, ** p < 0.01, compared with the H₂O₂ treated group or H₂O₂ + gastrodin treat group.

DISCUSSION

Parkinson’s disease is the most common neurodegenerative disorder after Alzheimer’s disease.²⁶⁾ Therefore, development of drugs with better curative effects for this disease therapy is urgently needed. Ferroptosis has been implicated in neurodegenerative diseases. In this study, we used neuronal C6 cells to explore the mechanisms of H₂O₂-induced ferroptosis. We found that 25 µM gastrodin treatment and other ferroptosis inhibitors (lip-1, fer-1 and DFO), inhibited the H₂O₂-induced ferroptosis. We also demonstrate that H₂O₂-induced ferroptosis is accompanied with mitochondrial swelling and loss of the cristae,²⁷⁾ and these morphological changes are inhibited by 25 µM gastrodin treatment. It was reported that accumulation of iron is common among various pathological conditions of the central nervous system,^1,28,29) suggesting that iron-related cell death and lipid peroxidation may be associated with the loss of dopaminergic neurons in PD. Iron is one of the essential elements of human body, which plays an important role in human metabolism and health. Intracellular iron ion colorimetry showed that H₂O₂ increased the Fe²⁺ concentrations in C6 cells, and this effect was decreased by gastrodin pretreatment. FPN1 is a cross-membrane iron export protein. FPN1 regulates iron uptake and export processes and hence determines cell death due to ferroptosis.^30,31) Deficiency of FPN1 leads to the accumulation of iron. Also, the Fenton reaction increases the production of lipid ROS, which causes the ferroptosis.³²⁾ Indeed, low expression of FPN1 led to high intracellular iron concentration and accelerated ferroptosis in C6 cells. Thus, FPN1 determines the fate of C6 cells by balancing intracellular iron levels. However, the potential role of FPN1 in H₂O₂-induced ferroptosis in C6 cells has not been fully explored. Furthermore, a recent study employed insertional mutagenesis and found that ACSL4 may be involved in lipid metabolism, and is required for GPX4-inactivation-dependent ferroptosis induction.³³⁾ Degradation of GPX4 promoted lipid peroxidation in ferroptosis.³⁴⁾ Here, treatment of C6 cells with 100 µM H₂O₂ reduced the protein levels of GPX4, and this effect was inhibited by gastrodin. In addition, it has been reported that RSL3 triggers ferroptosis by binding and inactivating GPX4.³⁵⁾ Therefore, RSL3 can induce lipid peroxidation.^35,36) PTGS2 is one of the key enzymes involved in the synthesis of prostaglandins,³⁷⁾ it increases the activity of peroxidase and the level of ROS thereby balancing oxidation status in the body. The up-regulation of PTGS2 (COX2) is considered to be a marker of ferroptosis.³⁸⁾ In the present study, results reveal that H₂O₂ up-regulated the protein level of PTGS2 in C6 cells, and this effect was suppressed by gastrodin.

Oxidative stress is a major cause of cellular injury in many human diseases including neurodegenerative disorders. Hydrogen peroxide, superoxide, and hydroxyl radical contribute to oxidative damage in cells causing considerable ferroptosis. Thus, decreasing excess ROS or inhibiting ROS production may prevent ferroptosis. Cystine/Glutamate reverse carriers transport cysteine (Cys2) and glutamate. System XC- plays an important role in the synthesis of GSH.³⁹⁾ GSH depletion activates lipoxygenase, inhibits GPX4 activity and triggers lipid peroxidation.⁴⁰⁾ Our results show that gastrodin increased the level of GSH and the activity of GPX. Further, the oxidation of endogenous lipids was determined by measuring MDA in C6 cells treated with gastrodin or H₂O₂. TBARS assay showed that MDA level was higher in H₂O₂-treated cells than in control cells. Cotreatment with gastrodin and H₂O₂ inhibited MDA accumulation, confirming lipid peroxidation which was suppressed by the specific ferroptosis inhibitor. CAT is very important enzyme in protecting the cell from oxidative damage by ROS.²⁰⁾ Our results show that gastrodin increased the activity of CAT by H₂O₂-induced. Gastrodin is a compound isolated from Gastrodia elata root and has strong antioxidant activity. Nrf2-mediated HO-1 expression was demonstrated to play a key role against oxidative stress. Gastrodin-induced HO-1 and Nrf2 expression is involved in protection of liver sinusoidal endothelial cells (LSECs) from H₂O₂-induced oxidative injury.⁴¹⁾ Ferroptosis is a form of regulated necrotic cell death controlled by GPX4.⁴²⁾ Most of the antioxidant enzymes and iron metabolism proteins, such as GPX4, ferroportin (FPN), HO-1, and ferritin, are transcriptionally regulated by Nrf2 and involved in iron availability and ferroptosis.⁴³⁾ The inactivation, inhibition and Nrf2 knock-down enhance ferroptosis in cells.³²⁾ Ferroptosis was enhanced by erastin in HO-1 knockout hepatocellular carcinoma cells (HNC).⁴⁴⁾ In the previous research,¹⁴⁾ it was also reported that the expression of GPX4, Nrf2, HO-1, FPN was associated with ferroptosis. Our results further showed that gastrodin induced GPX4, Nrf2 and HO-1 expression to protect C6 cells from H₂O₂-induced ferroptosis. Gastrodin pretreatment effectively reduced H₂O₂-induced oxidative damage, indicating gastrodin is a potential antioxidant that reduced cytotoxic ROS. In summary, these findings support the hypothesis that H₂O₂ induces ferroptosis through its antioxidative effect. The role of gastrodin in ferroptosis presents a new perspective for understanding PD. Thus, further studies are required to identify specific genes affected in response to H₂O₂-induced ferroptosis.

Acknowledgments

This work was supported by Opening Project of Zhejiang Provincial Preponderant and Characteristic Subject of Key University (Traditional Chinese Pharmacology) and Zhejiang Chinese Medical University (No. ZYAOXZD2019007).

Author Contributions

Ting Jiang: conducted experiments, writing of the manuscript draft. Jun Chu: reviewed the manuscript; Hejuntao Chen: performed cell culture; Hui Cheng: reviewed literature and edited the manuscript; Jingjing Su: performed data analysis; Xuncui Wang: performed Western blotting, data analysis; Yin Cao: reviewed and revised the manuscript; Shasha Tian: performed Western blotting, revised the manuscript; Qinglin Li: designed the experiments, reviewed the manuscript. All authors agreed to interpretation of data, the final manuscript, its content, and gave consent to the submission of this manuscript for publication.

Conflict of Interest

The authors declare no conflict of interest.

Supplementary Materials

The online version of this article contains supplementary materials.

REFERENCES

• 1) Ito K, Eguchi Y, Imagawa Y, Akai S, Mochizuki H, Tsujimoto Y. MPP+induces necrostatin-1- and ferrostatin-1-sensitive necrotic death of neuronal SH-SY5Y cells. Cell Death Discov., 3, 17013 (2017).
• 2) Lou H, Jing X, Ren D, Wei X, Zhang X. Eriodictyol protects against H₂O₂-induced neuron-like PC12 cell death through activation of Nrf2/ARE signaling pathway. Neurochem. Int., 61, 251–257 (2012).
• 3) Zhan H-D, Zhou H-Y, Sui Y-P, Du X-L, Wang W, Dai L, Sui F, Huo H-R, Jiang T-L. The rhizome of Gastrodia elata Blume—An ethnopharmacological review. J. Ethnopharmacol., 189, 361–385 (2016).
• 4) Tsai C-F, Huang C-L, Lin Y-L, Lee Y-C, Yang Y-C, Huang N. The neuroprotective effects of an extract of Gastrodia elata. J. Ethnopharmacol., 138, 119–125 (2011).
• 5) Stockwell BR, Friedmann Angeli JP, Bayir H, et al. Ferroptosis: a regulated cell death nexus linking metabolism, redox biology, and disease. Cell, 171, 273–285 (2017).
• 6) Yang WS, Stockwell BR. Ferroptosis: death by lipid peroxidation. Trends Cell Biol., 26, 165–176 (2016).
• 7) Dixon SJ, Lemberg KM, Lamprecht MR, Skouta R, Zaitsev EM, Gleason CE, Patel DN, Bauer AJ, Cantley AM, Yang WS, Morrison B 3rd, Stockwell BR. Ferroptosis: an iron-dependent form of nonapoptotic cell death. Cell, 149, 1060–1072 (2012).
• 8) Siddique YH, Ara G, Afzal M. Estimation of lipid peroxidation induced by hydrogen peroxide in cultured human lymphocytes. Dose Response, 10, 1–10 (2012).
• 9) Zhang C, Du F, Shi M, Ye R, Cheng H, Han J, Ma L, Cao R, Rao Z, Zhao G. Ginsenoside Rd protects neurons against glutamate-induced excitotoxicity by inhibiting Ca(2+) influx. Cell. Mol. Neurobiol., 32, 121–128 (2012).
• 10) Shu C, Chen C, Zhang DP, Guo H, Zhou H, Zong J, Bian Z, Dong X, Dai J, Zhang Y, Tang Q. Gastrodin protects against cardiac hypertrophy and fibrosis. Mol. Cell. Biochem., 359, 9–16 (2012).
• 11) Chen P, Li J, Huo Y, Lu J, Wan L, Yang Q, Huang J, Gan R, Guo C. Adenovirus-mediated expression of orphan nuclear receptor NR4A2 targeting hepatic stellate cell attenuates liver fibrosis in rats. Scientific Reports, 6, 33593 (2016).
• 12) Jiang G, Hu Y, Liu L, Cai J, Peng C, Li Q. Gastrodin protects against MPP(+)-induced oxidative stress by up regulates heme oxygenase-1 expression through p38 MAPK/Nrf2 pathway in human dopaminergic cells. Neurochem. Int., 75, 79–88 (2014).
• 13) Qiu C-W, Liu Z-Y, Hou K, Liu S-Y, Hu Y-X, Zhang L, Zhang F-L, Lv K-Y, Kang Q, Hu W-Y, Ma N, Jiao Y, Bai W-J, Xiao Z-C. Wip1 knockout inhibits neurogenesis by affecting the Wnt/β-catenin signaling pathway in focal cerebral ischemia in mice. Exp. Neurol., 309, 44–53 (2018).
• 14) Chu J, Liu CX, Song R, Li QL. Ferrostatin-1 protects HT-22 cells from oxidative toxicity. Neural Regeneration Research, 15, 528–536 (2020).
• 15) Jiang G, Wu H, Hu Y, Li J, Li Q. Gastrodin inhibits glutamate-induced apoptosis of PC12 cells via inhibition of CaMKII/ASK-1/p38 MAPK/p53 signaling cascade. Cell. Mol. Neurobiol., 34, 591–602 (2014).
• 16) Wang Z, Ding Y, Wang X, Lu S, Wang C, He C, Wang L, Piao M, Chi G, Luo Y, Ge P. Pseudolaric acid B triggers ferroptosis in glioma cells via activation of Nox4 and inhibition of xCT. Cancer Lett., 428, 21–33 (2018).
• 17) Chan FK, Moriwaki K, De Rosa MJ. Detection of necrosis by release of lactate dehydrogenase activity. Methods Mol. Biol., 979, 65–70 (2013).
• 18) Jiang L, Kon N, Li T, Wang SJ, Su T, Hibshoosh H, Baer R, Gu W. Ferroptosis as a p53-mediated activity during tumour suppression. Nature, 520, 57–62 (2015).
• 19) Mason RP, Casu M, Butler N, Breda C, Campesan S, Clapp J, Green EW, Dhulkhed D, Kyriacou CP, Giorgini F. Glutathione peroxidase activity is neuroprotective in models of Huntington’s disease. Nat. Genet., 45, 1249–1254 (2013).
• 20) Liu T, Liu WH, Zhao JS, Meng FZ, Wang H. Lutein protects against beta-amyloid peptide-induced oxidative stress in cerebrovascular endothelial cells through modulation of Nrf-2 and NF-kappaB. Cell Biol. Toxicol., 33, 57–67 (2017).
• 21) Kumar H, Kim IS, More SV, Kim BW, Bahk YY, Choi DK. Gastrodin protects apoptotic dopaminergic neurons in a toxin-induced Parkinson’s disease model. Evid. Based Complement. Alternat. Med., 2013, 514095 (2013).
• 22) Gaschler MM, Andia AA, Liu H, et al. FINO2 initiates ferroptosis through GPX4 inactivation and iron oxidation. Nat. Chem. Biol., 14, 507–515 (2018).
• 23) Gao M, Monian P, Quadri N, Ramasamy R, Jiang X. Glutaminolysis and transferrin regulate ferroptosis. Mol. Cell, 59, 298–308 (2015).
• 24) Zhu G, Wang X, Wu S, Li Q. Involvement of activation of PI3K/Akt pathway in the protective effects of puerarin against MPP + -induced human neuroblastoma SH-SY5Y cell death. Neurochem. Int., 60, 400–408 (2012).
• 25) Fang X, Wang H, Han D, Xie E, Yang X, Wei J, Gu S, Gao F, Zhu N, Yin X, Cheng Q, Zhang P, Dai W, Chen J, Yang F, Yang H-T, Linkermann A, Gu W, Min J, Wang F. Ferroptosis as a target for protection against cardiomyopathy. Proc. Natl. Acad. Sci. U.S.A., 116, 2672–2680 (2019).
• 26) Lew MF, Yeung Y. Parkinson’s Disease. Reference Module in Biomedical Sciences. Elsevier, the Netherlands (2014).
• 27) Lewerenz J, Ates G, Methner A, Conrad M, Maher P. Oxytosis/ferroptosis—(re-) emerging roles for oxidative stress-dependent non-apoptotic cell death in diseases of the central nervous system. Frontiers in Neuroscience, 12, 214 (2018).
• 28) Chen Q, Chen Y, Zhang Y, Wang F, Yu H, Zhang C, Jiang Z, Luo W. Iron deposition in Parkinson’s disease by quantitative susceptibility mapping. BMC Neurosci., 20, 23 (2019).
• 29) Ndayisaba A, Kaindlstorfer C, Wenning GK. Iron in neurodegeneration—cause or consequence? Front Neurosci, 13, 180 (2019).
• 30) Yanatori I, Richardson DR, Imada K, Kishi F. Iron export through the transporter ferroportin 1 is modulated by the iron chaperone PCBP2. J. Biol. Chem., 291, 17303–17318 (2016).
• 31) Geng N, Shi BJ, Li SL, Zhong ZY, Li YC, Xua WL, Zhou H, Cai JH. Knockdown of ferroportin accelerates erastin-induced ferroptosis in neuroblastoma cells. Eur. Rev. Med. Pharmacol. Sci., 22, 3826–3836 (2018).
• 32) Xie Y, Hou W, Song X, Yu Y, Huang J, Sun X, Kang R, Tang D. Ferroptosis: process and function. Cell Death Differ., 23, 369–379 (2016).
• 33) Dixon SJ, Winter GE, Musavi LS, Lee ED, Snijder B, Rebsamen M, Superti-Furga G, Stockwell BR. Human haploid cell genetics reveals roles for lipid metabolism genes in nonapoptotic cell death. ACS Chem. Biol., 10, 1604–1609 (2015).
• 34) Wu Z, Geng Y, Lu X, Shi Y, Wu G, Zhang M, Shan B, Pan H, Yuan J. Chaperone-mediated autophagy is involved in the execution of ferroptosis. Proc. Natl. Acad. Sci. U.S.A., 116, 2996–3005 (2019).
• 35) Yang WS, SriRamaratnam R, Welsch ME, Shimada K, Skouta R, Viswanathan VS, Cheah JH, Clemons PA, Shamji AF, Clish CB, Brown LM, Girotti AW, Cornish VW, Schreiber SL, Stockwell BR. Regulation of ferroptotic cancer cell death by GPX4. Cell, 156, 317–331 (2014).
• 36) Dixon SJ, Lemberg KM, Lamprecht MR, Skouta R, Zaitsev EM, Gleason CE, Patel DN, Bauer AJ, Cantley AM, Yang WS, Morrison B 3rd, Stockwell BR. Ferroptosis: an iron-dependent form of nonapoptotic cell death. Cell, 149, 1060–1072 (2012).
• 37) Wang H, An P, Xie E, Wu Q, Fang X, Gao H, Zhang Z, Li Y, Wang X, Zhang J, Li G, Yang L, Liu W, Min J, Wang F. Characterization of ferroptosis in murine models of hemochromatosis. Hepatology, 66, 449–465 (2017).
• 38) Li Q, Han X, Lan X, Gao Y, Wan J, Durham F, Cheng T, Yang J, Wang Z, Jiang C, Ying M, Koehler RC, Stockwell BR, Wang J. Inhibition of neuronal ferroptosis protects hemorrhagic brain. JCI Insight, 2, e90777 (2017).
• 39) Wang Y, Chen M, Zhang Y, Huo T, Fang Y, Jiao X, Yuan M, Jiang H. Effects of realgar on GSH synthesis in the mouse hippocampus: Involvement of system XAG-, system XC-, MRP-1 and Nrf2. Toxicol. Appl. Pharmacol., 308, 91–101 (2016).
• 40) Liu DS, Duong CP, Haupt S, Montgomery KG, House CM, Azar WJ, Pearson HB, Fisher OM, Read M, Guerra GR, Haupt Y, Cullinane C, Wiman KG, Abrahmsen L, Phillips WA, Clemons NJ. Inhibiting the system xC-/glutathione axis selectively targets cancers with mutant-p53 accumulation. Nat. Commun., 8, 14844 (2017).
• 41) Zhang H, Yuan B, Huang H, Qu S, Yang S, Zeng Z. Gastrodin induced HO-1 and Nrf2 up-regulation to alleviate H₂O₂-induced oxidative stress in mouse liver sinusoidal endothelial cells through p38 MAPK phosphorylation. Braz. J. Med. Biol. Res., 51, 1–10 (2018).
• 42) Doll S, Proneth B, Tyurina YY, et al. ACSL4 dictates ferroptosis sensitivity by shaping cellular lipid composition. Nat. Chem. Biol., 13, 91–98 (2017).
• 43) Kajarabille N, Latunde-Dada GO. Programmed cell-death by ferroptosis: antioxidants as mitigators. Int. J. Mol. Sci., 20, 4968 (2019).
• 44) Sun X, Ou Z, Chen R, Niu X, Chen D, Kang R, Tang D. Activation of the p62-Keap1-NRF2 pathway protects against ferroptosis in hepatocellular carcinoma cells. Hepatology, 63, 173–184 (2016).