circACTR2: A Novel Mechanism Regulating High Glucose-Induced Fibrosis in Renal Tubular Cells via Pyroptosis

Abstract

Diabetic kidney disease (DKD) is the leading cause of chronic kidney disease. Current therapies for DKD are insufficient. Therefore, there is an urgent need for identifying new therapies. An increasing number of micro RNAs (miRNAs) and long noncoding RNAs (lncRNAs) have been demonstrated to modulate the progression of diabetic kidney disease. Nevertheless, until now, there have been few reports evaluating the relevance of circular RNAs (circRNAs) in DKD. circRNAs have been reported to regulate the occurrence and development of multiple diseases. In this study, we intended to explore the circRNA expression profiles and determine the role of circRNA in DKD. We identified a series of dysregulated circRNAs in glucose-stressed HK-2 cells using circRNA microarray analysis. Among the candidate circRNAs, we found that circACTR2 was upregulated and may be involved in inflammation and pyroptosis. Knockdown of circACTR2 significantly decreased pyroptosis, interleukin (IL)-1β release and collagen IV and fibronectin production, indicating the effective regulation by circACTR2 of cell death and inflammation. Overall, our study identified a new circRNA, circACTR2, that regulates high glucose-induced pyroptosis, inflammation and fibrosis in proximal tubular cells. The present study preliminarily explores the role of circRNAs in pyroptosis of tubular cells, and provides novel insight into the pathogenesis of DKD and new therapeutic strategies.

INTRODUCTION

Diabetic kidney disease (DKD) is the leading cause of chronic kidney disease. Current therapies for DKD, including glycemic and blood pressure control, are insufficient. Therefore, the development of new treatments in diabetic kidney disease is desperately needed. DKD is characterized by mesangial matrix expansion, podocyte loss and fibrosis. In recent decades, tubular injury and interstitial fibrosis have been considered important features of DKD, which closely correlates with renal dysfunction. Emerging evidence shows that the diabetic mediators, high-glucose and advanced glycation end product (AGE), promote tubular inflammation and fibrosis.^1,2) There is an urgent need for further investigation into the underlying molecular mechanism in DKD to search for novel therapeutic strategies.

The microinflammatory state has been identified as the crucial basis for diabetic kidney disease.³⁾ Pyroptosis, unlike apoptosis, is a form of gasdermin D (GSDMD)-dependent inflammatory programmed cell death. After being cleaved by inflammatory caspase-1, -4, or -5, activated GSDMD translocates to the plasma membrane and oligomerizes to form 12–14 nm pores, ultimately resulting in cell swelling (ballooned pyroptotic bodies), membrane damage, and release of cytoplasmic contents and proinflammatory cytokines.^4–6) Although initially thought to be specific for immune cells, it has been recently shown that pyroptosis can be functional in nonimmune cells and multiple diseases.^4,7,8) Our previous study indicated that pyroptosis is involved in tubular injury in diabetes, as evidenced by GSDMD p30 fragment generation and flow cytometry analysis.⁹⁾ Understanding the molecular cascades regulating pyroptosis will yield additional targets for DKD treatment.

Circular RNAs (circRNAs) are covalently closed loops generated by back-splicing. Different from linear RNAs, circRNAs possess the distinguishing feature of splicing without a free 5′-cap or 3′-tail.¹⁰⁾ For quite a long time, circRNAs were wrongly considered byproducts of genetic transcription with no function.¹¹⁾ Recently, circRNAs have been reported to participate in multiple diseases, especially in cancers.^12,13) However, there are currently few reports about circRNAs in DKD. Investigating the role of circRNAs will be vital for understanding the pathogenesis of DKD and providing new therapeutic targets.

MATERIALS AND METHODS

Cell Culture and Treatments

The immortalized human renal proximal tubular epithelial cell line HK-2 (ATC C, CRL-2190™) was cultured in Dulbecco’s modified Eagle’s medium (DMEM)/F12 (Gibco) with 100 U/mL penicillin and streptomycin and 10% fetal bovine serum at 37°C with 5% CO₂. HK-2 cells were treated with 30 mM glucose with or without VX-765 (30 µM) for 48 h.^14,15)

For silencing of hsa_circRNA_102747, until an 60–70% confluence was reached, HK-2 cells were transfected using the jetPRIME^® transfection reagent (PolyPlus, France) with vectors encoding a small hairpin RNA (shRNA) targeting circRNA_102747 (Sequence 1: GAA AAA CTT TCT GAT CTT ATG GTT TCA AGA GAA CCA TAA GAT CAG AAA GTT TTT CTT TTT T; Sequence 2: GTG GAA AAA CTT TCT GAT CTT ATT TCA AGA GAA TAA GAT CAG AAA GTT TTT CCA CTT TTT T) or a control vector encoding a nontarget shRNA sequence. After transfection according to the manufacturer’s protocol, the cells were exposed to 5.5 or 30 mM of glucose for 48 h, and divided into the following groups: (A) 5.5 mM glucose and nontarget shRNA; (B) 30 mM glucose and nontarget shRNA; (C) 30 mM glucose and circRNA shRNA sequence 1; (D) 30 mM glucose and circRNA shRNA sequence 2.

Circular RNA Microarray Analysis

RNA was isolated using TRIzol reagent (Invitrogen, CA, U.S.A.). NanoDrop ND-1000 was used for RNA quantification. Microarray hybridization was performed following the standard instructions. In short, total RNA was digested with ribonuclease (RNase) R (Epicentre, U.S.A.) to eliminate linear RNA. The enriched circRNAs were amplified and transcribed into cRNA employing a random priming method (Arraystar Super RNA Labeling Kit, Arraystar). The fluorescent cRNA were hybridized onto the Arraystar Human circRNA Array V2 (8 × 15K). The Agilent Scanner G2505C was used to scanned the arrays. The Agilent Feature Extraction software was used to analyze the array images. The R software limma package was utilized for data analysis. Differentially expressed circRNAs were identified through Fold Change filtering. Hierarchical clustering was performed based on distinguishable circRNA expression profiling over 2-fold change.

Quantitative Real-Time PCR

RNA was isolated using TRIzol reagent and the GoScript™ Reverse Transcription System (Promega, U.S.A.) was used to reverse transcription. Then, PCR was performed on the CFX Connect™ Optics Module (Bio-Rad, U.S.A.) in triplicate using the GoTaq^® qPCR and RT-qPCR Systems (Promega) following the standard protocol. All the divergent primers for circRNAs are listed in Table 1. The following primers were used for ACTR2 mRNA detection: forward 5′-GAC TAC ACA TTT GGA CCA GAG A-3′ and reverse 5′-CTT CTC TCT GTT TTT GGT TGG G-3′.

Table 1. Divergent Primers of circRNAs

circRNA	circBase ID	Primer sequence
hsa_circRNA_102747	hsa_circ_0008529	Forward: TGTGCTTTCTGGAGGGTCTACT
		Reverse: TGCCTCATCACCAACCATAAG
hsa_circRNA_104262	hsa_circ_0078617	Forward: GACTTCACAAGCTAATGGATGGTT
		Reverse: GAATCTCCCAATGTGCCCTCT
hsa_circRNA_101504	hsa_circ_0002151	Forward: ATCCAACCCTGAAGATATTTAGAG
		Reverse: TGCAGTGTCCACACCAGCAG
hsa_circRNA_405650	/	Forward: AGCTGGAGAGACTGAAAGAGGT
		Reverse: TAGTAAATTGAAGCCACACTGC
hsa_circRNA_100141	hsa_circ_0007364	Forward: TCACAACCCTACCAATGCTACTC
		Reverse: GAATCGCCATAAATGTGCAAC
hsa_circRNA_405719	/	Forward: AGGTCACGTTGCTAGATACCAT
		Reverse: TCACAATGAAATAGCTCCTTGT
hsa_circRNA_003251	hsa_circ_0003251	Forward: GAAGACGACGACCCACTAAA
		Reverse: CTTCTTTGACTTGAGAAACTGAA
hsa_circRNA_001880	hsa_circ_0001880	Forward: CTATAGAAAGGGGAATCCCTGG
		Reverse: TGTTGTTGTAGTTGTTGCTGTCG
hsa_circRNA_104854	hsa_circ_0087862	Forward: TGTCAATGGGCTATGAACGAGAG
		Reverse: GGACACTGCTTTGGGCATTAAA
hsa_circRNA_105041	hsa_circ_0092125	Forward: TGTTCCGTGAGGACCAGATCTA
		Reverse: ATGTGGTTGGACAGCCGGT

Immunoblot Analysis

Cell lysates were extracted using RIPA buffer containing protease inhibitors. Prepared samples were fractionated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and then transferred onto Immobilon-P membranes (Millipore, U.S.A.). Blots were probed with anti-fibronectin (Novus, Cat. No. NBP1-91258) or anti-collagen type IV (Proteintech, Cat. No. 55131-1-AP) antibodies. Blots were developed with the Immobilon Western HRP Substrate (Millipore) using the ChemiDoc™ Touch Imaging System (Bio-Rad).

Flow Cytometry

Pyroptosis was detected using FLICA FAM-YVAD-FMK and propidium iodide (PI) staining after the indicated treatments and transfections following the manufacturer’s protocol (ImmunoChemistry Technologies, U.S.A.). Briefly, cells were incubated with FLICA, an active caspase-1 detection probe. Then, the cells were washed with wash buffer before adding PI for 10 min of incubation in the dark. The population of pyroptotic cells was evaluated by BD Accuri™ C6 Plus (BD Biosciences, U.S.A.). Approximately 1000–5000 cells were analyzed per experimental condition.

Detection of Secretory Interleukin (IL)-1β

An enzyme-linked immunosorbent assay (ELISA) was utilized for the quantitative measurement of secretory IL-1β. Cell culture supernatants was collected after various treatments, and the Human IL-1β Instant ELISA Kit (eBioscience) was used to measure IL-1β following the manufacturer’s instructions.

Lactate Dehydrogenase (LDH) Release Assay

Pyroptosis was also evaluated by assaying the LDH released into the supernatants. The CytoTox96 LDH release kit (Promega) was used to detect LDH. The LDH activity was expressed as a percentage of total LDH in the cell lysate.

Statistics

Student’s t-test was used for comparisons between two groups. ANOVA and Bonferroni t-tests were used for multiple-group comparisons. Statistical values and statistical significance are also reported in the Figure Legends. Data with p < 0.05 were considered statistically significant.

RESULTS

circRNA Expression Profiles in Glucose-Stressed Proximal Tubular Cells

To reveal the potential role of circRNAs in diabetic kidney disease, circRNA microarray assay was performed on renal tubular HK-2 cells. Recently, several studies have indicated that VX-765, a small-molecule caspase-1 inhibitor, is able to prevent inflammasome activation and pyroptosis.^15–17) We employed VX-765 in a microarray assay. In total, 11318 circRNAs were detected in our samples. The distinguishable circRNA expression profiles are demonstrated in cluster heatmaps, including 117 circRNAs between 5.5 and 30 mM glucose group as well as 157 circRNAs between 30 mM glucose and 30 mM glucose + VX-765 group (fold change ≥2.0 and p < 0.05) (Figs. 1A, B). And the scatter plots showed the variation of circRNA expression (Figs. 1C, D). The results showed 54 upregulated circRNAs and 14 downregulated circRNAs in glucose-stressed HK-2 cells with a fold change greater than 2. These expression changes were prevented after VX-765 treatment.

Fig. 1. circRNA Expression Profiles in Glucose-Stressed HK-2 Cells

(A) A heatmap showing the dysregulated circRNAs with a fold change greater than 2 in cells exposed to normal glucose (5.5 mM Glu) or high glucose (30 mM Glu). (B) A heatmap showing the dysregulated circRNAs in high-glucose-treated cells with or without VX-765 administration. High expression levels are depicted in red, low expression levels are depicted in green. The numbers indicate log2 value of normalized intensity. (C, D) Scatter plots showing the variation in circRNA expression. The green lines represent fold-change lines. (Color figure can be accessed in the online version.)

circACTR2 Is Upregulated in Glucose-Stressed HK-2 Cells

Ten significantly dysregulated circRNAs are listed in Table 2, and RT-qPCR was performed to verify their expression (Figs. 2A–J). Among these circRNAs, we screened out an aberrantly regulated circular RNA, hsa_circRNA_102747 (circBase ID: hsa_circ_0008529), that was markedly upregulated in high-glucose-treated HK-2 cells, and treatment of the cells with VX-765 markedly reduced the increased circRNA (Fig. 2A). According to the human reference genome, hsa_circRNA_102747 is derived from the ACTR2 gene (actin related protein 2). ACTR2 is located on chromosome 2p14. Accordingly, we named hsa_circRNA_102747 as “circACTR2.” Schematic structure of hsa_circRNA_102747 was shown in Fig. 2K.

Table 2. 10 Significantly Dysregulated circRNAs

circRNA	Gene symbol	Fold changea)	Fold changeb)
hsa_circRNA_102747	ACTR2	5.85	−7.77
hsa_circRNA_104262	MAP3K4	5.13	−2.79
hsa_circRNA_101504	PDIA3	3.75	−3.07
hsa_circRNA_405650	MTCL1	2.99	−3.53
hsa_circRNA_100141	PTP4A2	2.80	−2.36
hsa_circRNA_405719	PTPRS	−6.37	5.92
hsa_circRNA_003251	WNK1	−3.42	5.44
hsa_circRNA_001880	RAD23B	−2.94	4.25
hsa_circRNA_104854	RAD23B	−2.22	3.23
hsa_circRNA_105041	G6PD	−2.01	3.09

a) 30 mM Glu vs. 5.5 mM Glu; b) 30 mM Glu + VX-765 vs. 30 mM Glu.

Fig. 2. RT-qPCR Was Performed to Verify the Expression of 10 Significantly Dysregulated circRNAs

(A–J) Graphs representing the expression of 10 dysregulated circRNAs. Among these circRNAs, circRNA_102747 and circRNA_405650 had significant differences. (K) Schematic structure of circRNA_102747 showing its splicing event and the target sequence of shRNA. Data from at least three separate experiments are shown. Data are the means ± standard error of the mean (S.E.M.). * p < 0.05. NG, normal glucose; HG, high glucose; NS, not significant. (Color figure can be accessed in the online version.)

Knockdown of circACTR2 Inhibits Pyroptosis and Fibrosis

To confirm that circACTR2 is essential for pyroptosis in tubular epithelial cells of diabetic kidney disease, we knocked down circACTR2 expression by transfection of specific shRNA sequences in cultured HK-2 cells. Effective reduction of circACTR2 expression was verified by RT-qPCR (Figs. 3A, B). Subsequent flow cytometry analysis revealed that downregulation of circACTR2 during high-glucose stimulation reduced pyroptosis (FLICA⁺ and PI⁺ cells) in HK-2 cells (Fig. 2E). Pyroptosis was also evaluated by assaying PI uptake as well as LDH release, a hallmark of lytic cell death (Figs. 2C, F). We also found that inhibition of circACTR2 markedly attenuated the release of mature IL-1β into the medium in glucose-stressed HK-2 cells (Fig. 2D). Furthermore, western blots showed that knockdown of circACTR2 strikingly reduced collagen IV and fibronectin formation (Figs. 2G–I). Collectively, these observations suggest that aberrant expression of circACTR2 in tubular cells is an important step in the regulation of pyroptosis and cell survival in high-glucose exposure.

Fig. 3. Knockdown of circACTR2 Inhibits the Effects of High Glucose on Cultured HK-2 Cells

(A) ACTR2 mRNA level is not affected by circACTR2 shRNA. (B) Knockdown of circACTR2 in HK-2 cells was verified by RT-qPCR. (C) LDH release is inhibited by circACTR2 knockdown. (D) Graph representing the level of IL-1β in the supernatant of HK-2 cells. (E) A flow cytometry analysis showing that circACTR2 knockdown reduces pyroptosis in high-glucose-treated HK-2 cells. (F) Cell death was measured by PI staining. (G–I) Immunoblots showing the expression of fibronectin and collagen IV. Results are representative of at least three independent experiments. Data from at least three separate experiments are shown as the means ± S.E.M. * p < 0.05, ** p < 0.01, *** p < 0.001. NG, normal glucose; HG, high glucose; IL, interleukin; NT shRNA, nontarget shRNA sequence; sh1, shRNA sequence 1; sh2, shRNA sequence 2.

DISCUSSION

It was estimated that the prevalence of diabetes mellitus (DM) was up to 9.1%, affecting 425 million people in 2017, with 12% of global health expenditure spent on DM.¹⁸⁾ DKD is currently considered an inflammatory disease, and inflammasome activation has recently been implicated in DKD.¹⁹⁾ Chronic sterile inflammation and release of cytokines have been demonstrated in DKD. The identification of new molecular mechanisms underlying the immune response has prompted many researchers to explore the involvement of these mechanisms in sustained inflammation in DKD.²⁰⁾ Our study delineated a critical role of circRNA in glucose-induced inflammation and fibrosis in proximal tubular cells.

Noncoding RNAs (ncRNAs) have attracted more attention than ever.^21,22) With their extraordinary structure, circRNAs are conferred remarkable tolerance to exonuclease degradation and have a much longer half-life than other linear RNAs.¹³⁾ Increasing investigations have revealed the biological functions of circRNAs that include acting as a miRNA or even a lncRNA sponge in the regulation of transcription,²³⁾ acting as an RNA binding protein (RBP) sponge,²⁴⁾ and directly regulating the transcription process by interacting with mRNAs.²⁵⁾ Although plenty of miRNAs and lncRNAs have been reported to regulate diabetic kidney disease development, the potential role of circRNAs in DKD remains unclear. In the present study, we screened out dysregulated circRNAs in HK-2 cells using circRNA microarray analysis. As VX-765 has been demonstrated to regulate pyroptosis by inhibiting caspase-1, these aberrantly expressed circRNAs may participate in DKD by regulating pyroptosis. Among the candidate circRNAs, we found that circACTR2 was upregulated in cells exposed to high glucose and may be involved in inflammation and pyroptosis.

More recently, the lytic inflammatory cell death pyroptosis has been described. Determining the molecular cascades that regulate pyroptosis will yield more novel approaches to treat diseases.²⁶⁾ Pyroptosis is also a promising therapeutic target for DKD. To confirm the involvement of circACTR2 in the development of DKD, silencing of circACTR2 was performed using shRNA transfection. Because pyroptosis is a lytic form of cell death mediated by caspase-1, -4 or -5, we detected pyroptosis using FLICA FAM-YVAD-FMK and PI staining. circACTR2 knockdown significantly suppressed the percentage of pyroptotic cells, IL-1β release and collagen IV and fibronectin production, suggesting the effective regulation by circACTR2 of cell death and inflammation. With the high stability, evolutionary conservation, and spatial and temporal specificity of circRNA expression,²⁷⁾ circACTR2 has potential to be a promising therapy to precisely target DKD.

The competing endogenous RNA (ceRNA) hypothesis is based on abundant studies and has elucidated how RNAs regulate gene expression through competitive binding to miRNAs and constructing a complex posttranscriptional regulatory network.^28,29) circRNAs have emerged as critical regulators in diseases by sponging miRNA. For instance, circRNA LRP6 contributes to high-glucose-induced inflammation and extracellular matrix accumulation in mesangial cells by sponging miR-205.¹⁰⁾ circPTN regulates proliferation activity in glioma by targeting miR-145-5p/miR-330-5p.³⁰⁾ Accumulating evidence points to the potential role of miRNAs in DKD progression.³¹⁾ It is reasonable to speculate that circACTR2 may regulate DKD by sponging miRNA or other targets, which encourages continued exploration of circACTR2 in the pathogenesis of DKD.

In conclusion, our study identified the new circRNA circACTR2 that regulates high glucose-induced pyroptosis, inflammation and fibrosis in renal tubular cells. These data reveal that circACTR2 plays a vital role in cell survival of diabetic tubular cells. Furthermore, this research encourages continued exploration of circACTR2 as a promising biomarker and therapeutic target for DKD.

Acknowledgments

This work was supported by Grants from the Natural Science Foundation of China (No. 81770724), the Chinese National Key Technology R and D Program, Ministry of Science and Technology (Nos. 2017YFC0907601, 2017YFC0907602, and 2017YFC0807603), and the Shenyang Science and Technology Innovation Talent Support Program (No. RC170172).

Author Contributions

Study design, Qiuling Fan and Si Wen; study development, Si Wen and Shuangliang Li; methodology & data analysis, Si Wen and Lulu Li; writing-original draft, Si Wen; writing—review & editing, Qiuling Fan.

Conflict of Interest

The authors declare no conflict of interest.

REFERENCES

• 1) Shahzad K, Bock F, Dong W, et al. Nlrp3-inflammasome activation in non-myeloid-derived cells aggravates diabetic nephropathy. Kidney Int., 87, 74–84 (2015).
• 2) Yiu WH, Wong DW, Wu HJ, Li RX, Yam I, Chan LY, Leung JC, Lan HY, Lai KN, Tang SC. Kallistatin protects against diabetic nephropathy in db/db mice by suppressing AGE-RAGE-induced oxidative stress. Kidney Int., 89, 386–398 (2016).
• 3) Qiu YY, Tang LQ. Roles of the NLRP3 inflammasome in the pathogenesis of diabetic nephropathy. Pharmacol. Res., 114, 251–264 (2016).
• 4) McKenzie BA, Mamik MK, Saito LB, Boghozian R, Monaco MC, Major EO, Lu JQ, Branton WG, Power C. Caspase-1 inhibition prevents glial inflammasome activation and pyroptosis in models of multiple sclerosis. Proc. Natl. Acad. Sci. U.S.A., 115, E6065–E6074 (2018).
• 5) Shi J, Zhao Y, Wang K, Shi X, Wang Y, Huang H, Zhuang Y, Cai T, Wang F, Shao F. Cleavage of GSDMD by inflammatory caspases determines pyroptotic cell death. Nature, 526, 660–665 (2015).
• 6) Kayagaki N, Stowe IB, Lee BL, et al. Caspase-11 cleaves gasdermin D for non-canonical inflammasome signalling. Nature, 526, 666–671 (2015).
• 7) Yang F, Qin Y, Wang Y, Meng S, Xian H, Che H, Lv J, Li Y, Yu Y, Bai Y, Wang L. Metformin inhibits the NLRP3 inflammasome via AMPK/mTOR-dependent effects in diabetic cardiomyopathy. Int. J. Biol. Sci., 15, 1010–1019 (2019).
• 8) Miao N, Yin F, Xie H, Wang Y, Xu Y, Shen Y, Xu D, Yin J, Wang B, Zhou Z, Cheng Q, Chen P, Xue H, Zhou L, Liu J, Wang X, Zhang W, Lu L. The cleavage of gasdermin D by caspase-11 promotes tubular epithelial cell pyroptosis and urinary IL-18 excretion in acute kidney injury. Kidney Int., 96, 1105–1120 (2019).
• 9) Wang Y, Zhu X, Yuan S, Wen S, Liu X, Wang C, Qu Z, Li J, Liu H, Sun L, Liu F. TLR4/NF-kappaB signaling induces GSDMD-related pyroptosis in tubular cells in diabetic kidney disease. Front. Endocrinol. (Lausanne), 10, 603 (2019).
• 10) Chen B, Li Y, Liu Y, Xu Z. circLRP6 regulates high glucose-induced proliferation, oxidative stress, ECM accumulation, and inflammation in mesangial cells. J. Cell. Physiol., 234, 21249–21259 (2019).
• 11) Hu W, Han Q, Zhao L, Wang L. Circular RNA circRNA_15698 aggravates the extracellular matrix of diabetic nephropathy mesangial cells via miR-185/TGF-beta1. J. Cell. Physiol., 234, 1469–1476 (2019).
• 12) Song YZ, Li JF. Circular RNA hsa_circ_0001564 regulates osteosarcoma proliferation and apoptosis by acting miRNA sponge. Biochem. Biophys. Res. Commun., 495, 2369–2375 (2018).
• 13) Yu T, Wang Y, Fan Y, Fang N, Wang T, Xu T, Shu Y. CircRNAs in cancer metabolism: a review. Journal of Hematology & Oncology, 12, 90 (2019).
• 14) Flores J, Noel A, Foveau B, Lynham J, Lecrux C, LeBlanc AC. Caspase-1 inhibition alleviates cognitive impairment and neuropathology in an Alzheimer’s disease mouse model. Nat. Commun., 9, 3916 (2018).
• 15) Audia JP, Yang XM, Crockett ES, Housley N, Haq EU, O’Donnell K, Cohen MV, Downey JM, Alvarez DF. Caspase-1 inhibition by VX-765 administered at reperfusion in P2Y12 receptor antagonist-treated rats provides long-term reduction in myocardial infarct size and preservation of ventricular function. Basic Res. Cardiol., 113, 32 (2018).
• 16) Do Carmo H, Arjun S, Petrucci O, Yellon DM, Davidson SM. The caspase 1 inhibitor VX-765 protects the isolated rat heart via the RISK pathway. Cardiovasc. Drugs Ther., 32, 165–168 (2018).
• 17) Feng J, Li M, Wei Q, Li S, Song S, Hua Z. Unconjugated bilirubin induces pyroptosis in cultured rat cortical astrocytes. J. Neuroinflammation, 15, 23 (2018).
• 18) Federation ID. “IDF Diabetes Atlas Eighth Edition 2017.”: ‹http://www.idf.org/diabetesatlas›.
• 19) Wada J, Makino H. Inflammation and the pathogenesis of diabetic nephropathy. Clin. Sci., 124, 139–152 (2013).
• 20) Wada J, Makino H. Innate immunity in diabetes and diabetic nephropathy. Nat. Rev. Nephrol., 12, 13–26 (2016).
• 21) Jiang MM, Mai ZT, Wan SZ, Chi YM, Zhang X, Sun BH, Di QG. Microarray profiles reveal that circular RNA hsa_circ_0007385 functions as an oncogene in non-small cell lung cancer tumorigenesis. J. Cancer Res. Clin. Oncol., 144, 667–674 (2018).
• 22) Hua F, Li CH, Chen XG, Liu XP. Long noncoding RNA CCAT2 knockdown suppresses tumorous progression by sponging miR-424 in epithelial ovarian cancer. Oncol. Res., 26, 241–247 (2018).
• 23) Hansen TB, Jensen TI, Clausen BH, Bramsen JB, Finsen B, Damgaard CK, Kjems J. Natural RNA circles function as efficient microRNA sponges. Nature, 495, 384–388 (2013).
• 24) Du WW, Yang W, Chen Y, Wu ZK, Foster FS, Yang Z, Li X, Yang BB. Foxo3 circular RNA promotes cardiac senescence by modulating multiple factors associated with stress and senescence responses. Eur. Heart J., 38, 1402–1412 (2017).
• 25) Zhang Y, Zhang XO, Chen T, Xiang JF, Yin QF, Xing YH, Zhu S, Yang L, Chen LL. Circular intronic long noncoding RNAs. Mol. Cell, 51, 792–806 (2013).
• 26) Place DE, Kanneganti TD. Cell death-mediated cytokine release and its therapeutic implications. J. Exp. Med., 216, 1474–1486 (2019).
• 27) Zhang XO, Wang HB, Zhang Y, Lu X, Chen LL, Yang L. Complementary sequence-mediated exon circularization. Cell, 159, 134–147 (2014).
• 28) He R, Liu P, Xie X, Zhou Y, Liao Q, Xiong W, Li X, Li G, Zeng Z, Tang H. circGFRA1 and GFRA1 act as ceRNAs in triple negative breast cancer by regulating miR-34a. Journal of Experimental & Clinical Cancer Research, 36, 145 (2017).
• 29) Tay Y, Rinn J, Pandolfi PP. The multilayered complexity of ceRNA crosstalk and competition. Nature, 505, 344–352 (2014).
• 30) Chen J, Chen T, Zhu Y, Li Y, Zhang Y, Wang Y, Li X, Xie X, Wang J, Huang M, Sun X, Ke Y. circPTN sponges miR-145-5p/miR-330-5p to promote proliferation and stemness in glioma. Journal of Experimental & Clinical Cancer Research, 38, 398 (2019).
• 31) Li Y, Gu Y, Tang N, Liu Y, Zhao Z. miR-22-notch signaling pathway is involved in the regulation of the apoptosis and autophagy in human ovarian cancer cells. Biol. Pharm. Bull., 41, 1237–1242 (2018).