Characterization and Immunological Activities of Polysaccharides from Polygonatum sibiricum

Abstract

In this study, we investigated the physicochemical properties and composition of monosaccharidex from Polygonatum sibiricum. Simultaneously, we explored the in vivo and in vitro immunomodulatory activity and mechanism of Polygonatum sibiricum polysaccharide (PSP) activity by monitoring changes in immune organs, immune cells, and cytokines. The average molecular weight (M_w) of PSP was 9.514 × 10⁴ Da. The monosaccharide components of PSP were galactose, rhamnose, arabinose, mannose, and glucose at a molar ratio of 11.72 : 1.78 : 4.15 : 1.00 : 2.48. PSP increased thymus and spleen indices, enhance the proliferative responses of splenocytes, and increased the phagocytosis of mononuclear macrophages. Simultaneously, PSP could recover the body mass of immunosuppressed mice, and increased blood erythrocyte counts in the sera of cyclophosphamide (Cy)-treated and normal mice, whilst blood leukocytes and platelet counts of Cy-treated mice recovered. PSP elevated the CD4⁺/CD8⁺ ratio is a dose-dependent manner and increased the levels of interleukin-2 (IL-2) and tumor necrosis factor-α (TNF-α) in the sera of Cy-treated mice. PSP further enhanced the expression of IL-2 and TNF-α in spleen lymphocytes. Additionally, PSP treatment accelerated the recovery of natural killer cell activity in a dose-dependent manner. Taken together, PSP not only regulated the immune function of normal mice, but participated in the protection against immunosuppression in Cy-treated mice, highlighting its potential as an immunostimulant.

INTRODUCTION

The dried rhizome of Polygonatum sibiricum belonging to the Liliaceae family is a popular and common Chinese herbal medicine and foodstuff¹⁾ Polygonatum sibiricum first appeared in ancient Chinese medicine books around 1000 years ago²⁾ and is used in Chinese medicine to tonify the spleen and nourish the lungs.³⁾ Modern pharmacological tests have demonstrated improved immunity, lower blood glucose levels, lower blood lipids, and anti-tumor, anti-bacterial, and anti-viral activities.⁴⁾ Many active ingredients have been extracted from P. sibiricum including flavones,⁵⁾ alkaloids, steroid saponins,^6,7) polysaccharides and lignins.⁸⁾ P. sibiricum polysaccharides (PSP) are the major crude bio-components extensively used as immunomodulatory agents.

Immunosuppression is a permanent or temporary immune dysfunction that results in a susceptibility to pathogen infection.⁹⁾ Thus, an effective method of prevention and treatment of immunosuppressive disease is required. Traditional Chinese medicine applications for immunomodulation have been verified theoretically and experimentally. Contemporary medical studies agree that traditional Chinese herbs can promote immune function by facilitating the activity and growth of immune cells, thereby promoting antibody synthesis.^10,11)

In this study, we demonstrate the isolation, purification and characterization of PSP with the goal to studying its protective effects against cyclophosphamide (Cy)-induced immunosuppression in addition to its immune-potentiating effects on normal mice. The ultimate goal of this study was to provide a foundation to further the development of PSP as an immunopotentiator.

MATERIALS AND METHODS

Materials

Crude P. sibiricum rhizome was purchased from the P. sibiricum Planting Base, Qijiang District, Chongqing, China. Cy was purchased from Baxter Oncology GmbH (Germany). Levamisole hydrochloride (LH) was obtained from Guangdong Nanguo Pharmaceutical Co. (China). Indian ink was purchased from Shanghai Yuanye Biotechnology Co. (China). Assay kits for lactate dehydrogenase (LDH) were purchased from Nanjing Jiancheng Bioengineering Institute (China). Trizol was obtained from Ambion (Thermo Fisher Scientific, U.S.A.). Anti-mouse antibodies PE CD8 and fluorescein isothiocyanate (FITC) CD4 were purchased from BioLegend (U.S.A.). Lipopolysaccharides (LPS), concanavalin A (ConA) and 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) were purchased from Sigma-Aldrich (U.S.A.). Cytokine (interleukin-2 (IL-2) and tumor necrosis factor-α (TNF-α))-enzyme-linked immunosorbent assay (ELISA) kits were purchased from SinoBestBio Bio-Tech Co. (Shanghai, China). YAC-1 cells were purchased from Boster Biological Technology Co. (Wuhan, China). Total RNA Purification Kits were purchased from Promega Corporation, an affiliate of Promega Biotech Co., Ltd. (Beijing, China). HiScript II Q RT SuperMix for qPCR (+gDNA wiper) in addition to ChamQ Universal SYBR qPCR Master Mixes were purchased from Nanjing Vazyme Biotech Co. Other compounds were of analytical grade and used without additional purification.

Extraction and Purification of Polysaccharides from PSP

P. sibiricum dried rhizome was sliced and ground into powder on a high-speed disintegrator, followed by treatment with petroleum ether overnight to remove grease and facilitate extraction. Polysaccharides were extracted three times (1 h each time) with 10× distilled water at 90°C. Extracts were filtered on a 4000 rpm centrifuge for 10 min. Upper solutions were evaporated under reduced pressure and concentrated 10-fold. Concentrated solutions were diluted 3 times in ethanol and maintained at 4°C overnight for precipitation. Crude polysaccharide powder obtained by freeze-drying was treated with the Sevag reagent (dissolved in 1 : 4 vol% mixture of n-butanol and chloroform) for protein removal after dissolving and dialysis for 24 h in distilled water. After freeze-drying, protein-free polysaccharides fractions were obtained. Supernatants were lyophilized to yield dried PSP powder. Total PSP content was determined using phenol–sulphuric acid, using D-glucose as a standard.

PSP powder was dissolved in deionised water and yields were determined using y phenol–sulphuric acid, with D-glucose as a standard. The yield of polysaccharide Y was calculated as Y (%) = c × v/w, where c is the concentration of polysaccharide in the sample solution (mg/mL), v is the volume of sample solution (mL), and w is the mass of the fresh sample (mg).

PSP powder was dissolved in distilled water and eluted through a diethylaminoethyl (DEAE) cellulose-52 column at a 1 mL/min flow rate using distilled water as a carrier containing 0.05, 0.1, 0.5 and 1.0 mol/L of NaCl. All fractions with similar carbohydrate concentrations (determined using phenol–sulfuric acid technique) were combined. The main solution was passed through chromatography Sephadex G-100 gel columns using distilled water as a carrier. The main polysaccharide fractions were homogeneous (evidenced by a single chromatographical peak) were collected, dialyzed and lyophilized. Thus, a single separated water-soluble neutral polysaccharide fraction (PSP) was obtained and used in subsequent experiments.

Characterization of PSP

Physicochemical Properties

The physicochemical properties of the purified polysaccharides were determined by iodination tests, molisch, phenol–sulfuric acid tests, anthrone reactions, and fehling’s reactions, respectively.¹²⁾

Monosaccharide Composition Determination

Monosaccharide composition was detected using GCMS-QP2010 (Shimadzu Corporation, Japan) using alditol acetates of standard monosaccharides (d-glucose, d-xylose, d-fructose, d-arabinose, d-galactose, l-rhamnose, and d-mannose). GC-MS was performed under the following conditions: column temperature of 80°C for 2 min, increased to 200°C at a rate of 15°C/min, held for 2 min, and increased to 210°C at a rate of 1°C/min. The temperature was increased to 280°C at a rate of 25°C/min and maintained for 6 min. The N₂ carrier gas rate was 1 mL/min.

Molecular Weight Determination

The molecular weight determination of PSP was performed using gel permeation chromatography (GPC) on a SephadexG-100 column (60 × 1.6 cm). Isocratic elution with ultrapure water was performed at a flow rate of 0.6 mL/min. The average molecular weight was detected using calibration curves, established using Dextran standards of known molecular weight (Dextran T-10, T-50, T-100, T-200, T-500, and T-1000).¹³⁾

Spectroscopic Characterization

For spectroscopic analyses, PSP was dissolved in distilled water to 0.5 mg/mL. The solution was then analyzed using UV-VIS spectrophotometer (UV-2700, SHIMADZU, Japan) in the 200–700 nm range. For Fourier transform Infrared spectroscopy measurements were performed and PSP was ground with preliminary-dried KBr powder, which was pressed into 1 mm pellets. Measurements were performed using an IRPrestige-21 spectrophotometer (SHIMADZU) in the 400–4000 cm⁻¹ frequency range.

In Vitro Assessments

Preparation of Mouse Splenocytes

Mice were sacrificed and spleens were collected and minced into homogeneous cell suspensions, followed by filtration through a 200-mesh cell strainer. Erythrocytes in the cell mixture were lysed with ammonium chloride, and splenocytes were washed three times with phosphate buffered saline (PBS) (pH 7.4). Splenocytes were incubated for 2 h in a petri-dish to remove adherent cells such as macrophages. Suspended splenocyte populations were collected and stored at 37°C until use.

Cytotoxicity of PSP against Splenocytes

Splenocytes (5 × 10⁶ cells/100 µL/well) were plated in 96-well plates and treated with PSP at different concentrations. Cells were incubated at 37°C under 5% CO₂ for 48 h and cell proliferation was evaluated by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay, at an absorbance at 570 nm on a microplate reader (Model 680, BIO-RAD). Cell proliferation rates (%) were calculated as the absorbance of the sample treatment group/the absorbance of the control group) ×100%.

Splenocyte Proliferation Induced by T Cell and B Cell Mitogens

Splenocyte proliferation was assessed by MTT assays according to previous studies.¹²⁾ Splenocytes (5 × 10⁶ cells/100 µL/well) were seeded into a 96-well flat-bottom microplate containing ConA (5 µg/mL) or LPS (10 µg/mL). Thereafter, PSP of different concentrations were added to each well. The same volume of RPMI-1640 media was added as a control. After 48 h of incubation at 37°C under 5% CO₂, cell proliferation was evaluated by MTT assays. The absorbance at 570 nm was measured on a microplate reader (Model 680, BIO-RAD).

In Vivo Assessments

Animals

Male Kunming mice (18–22 g, 6–8 weeks old) were provided by the Chongqing Academy of Chinese Materia Medica (China). All mice were free from pathogens. Prior to experiments, animals were kept for at least a week in a controlled environment at 23 ± 3°C with a 12-h dark–light cycle. All mice were provided a standard laboratory diet. This study protocol was approved by the Office of Academic Committee of Southwest University, China.

After one week of adaptation, mice were randomly divided into 10 groups. Each group contained ten mice: 5 groups were normal and 5 groups were immunosuppressed as follows: (1) normal control, (2) positive control (LH 10 mg/kg body weight (b.w.) per day), (3) PSP-L group (intragastrically (i.g.) 100 mg/kg b.w. per day), (4) PSP-M group (i.g. 200 mg/kg b.w./d), (5) PSP-H group (i.g. 400 mg/kg b.w. per day), (6) negative control (Cy), (7) the Cy + LH group, (8) Cy + PSP-LC group, (9) Cy + PSP-MC group, (10) Cy + PSP-HC group. Mice in groups (6) through (10) were treated with 2 intraperitoneal injections of equal doses of Cy (150 mg/kg) on days 1 and 4. Normal saline containing PSP or LH were administered i.g. once a day for 17 d. Model and normal control groups were administered normal saline once per day for 17 d.

Compliance with Ethical Standards

The authors declare that all experiments were compliant with Laboratory animal ethical standards.

Thymus and Spleen Indices

Following the final drug administration, mice were weighed and sacrificed for the collection of spleens and thymuses. The thymus or spleen index (mg/g) was calculated as the thymus or spleen weight/b.w.

Phagocytic Index

The function of macrophage cells was estimated through carbon clearance tests according to previous studies.¹⁴⁾ Four mice in each group were intravenously injected with diluted Indian ink at a dose of 0.1 mL/10 g b.w. At specific time points (2 and 10 min), 20 µL of blood was collected and mixed with 2 mL of 0.1% Na₂CO₃, followed by measurement of the absorbance’s (OD) at 600 nm. Livers and spleens were then collected and weighed. The phagocytic index (α) was calculated as follows:

  

where A, B, and C are body, liver, and spleen weights, respectively.

Natural Killer (NK) Cell Activity

Splenocytes prepared from each group of mice were used as the effector cells, whilst YAC-1 cells (NK-sensitive cell line) were used as the target cells.¹⁵⁾ Briefly, effector cells (5 × 10⁵ cells/well) were incubated with target YAC-1 cells at a ratio of 50 : 1 in 96-well round-bottom microplates. After 24 h incubation at 37°C under 5% CO₂, LDH was measured using detection kits. NK cell activity was calculated using the following equation:

  

where tests represent experimental LDH release from co-cultured cells, spontaneous is the LDH release resulting from target cells treated with culture medium alone, and maximal represent LDH release from target cells treated with Triton X-100.

Determination of Leukocytes, Erythrocytes, Platelets, CD4⁺ and CD8⁺ T-cell

On day 17, the peripheral blood of all groups was collected for the examination of the treatment effects of leukocytes, erythrocytes, platelets, CD4⁺ and CD8⁺ T-cell contents immediately after mice were sacrificed. Leukocytes, erythrocytes, and platelets were counted with a Coulter Hematology Analyzer. For CD4⁺ and CD8⁺ T-cell measurements, peripheral blood mononuclear cells were isolated by centrifugation and stained with anti-mouse CD4⁺-fluorescein isothiocyanate (FITC) and anti-mouse CD8⁺-PE. Cells were analyzed in a BD FACSVerse™ flow cytometer (BD Biosciences), gated, and 10000 events were acquired.¹⁶⁾

Cytokine Quantification by ELISA

Cytokine IL-2 and TNF-α levels in the mouse spleen lymphocytes were determined according to ELISA kits. IL-2 and TNF-α serum levels were determined from whole blood samples collected on the day of sacrifice from animals killed by removing their eyeballs. Serum was collected by10-min centrifugation at 4000 rpm at 4°C. Serum cytokine levels were analyzed using colorimetry based on the manufacturer-instructions. Absorbances were read on a microplate reader from the corresponding mouse ELISA kits according to the provided instructions. TNF-α and serum IL-2 levels were obtained using calibration curves.

Quantitative Real-Time (qRT)PCR Analysis

The mRNA expression of TNF-α and IL-2 in mouse spleens extracted from each group were detected by qRT-PCR. Tissues were lysed in TRIzol^® and RNA purity and content were analyzed on a micro-spectrophotometer (ND-2000c, Thermo). Total RNA (1 pg to 1 µg) was reverse-transcribed to cDNA using HiScript II Q RT SuperMix for qPCR (+gDNA wiper) Kits.

The mRNA expression of IL-2 and TNF-α were quantified by qRT-PCR using ChamQ™ Universal SYBR^® qPCR Master Mix on a CFX96 Real-Time PCR System (BIO-RAD). The qRT-PCR systems were as follows: Template cDNA 2.0 µL, 2 × ChamQ Universal SYBR qPCR Master Mix 10.0 µL, 10 µM of primer 1 and 10 µM of primer 2 (0.4 µL each) and dd H₂O added to a total volume of 20.0 µL. Thermal cycling was performed as follows: 95°C initial incubation for 30 s for polymerase activation followed by 40 × 10 s at 95°C/30 s at 10 s cycles. The analysis of melting curves was performed after 40 cycles to verify primer specificity (heated from 50 to 60°C) using fluorescence measurements. The primers used for qRT-PCR were shown in Table 1. β-Actin gene was probed as an internal standard.

Table 1. Primer Used in the Study

Gene	Forward (5′→3′)	Reverse (5′→3′)	Product length
β-Actin	GTGCTATGTTGCTCTAGACTTCG	ATGCCACAGGATTCCATACC	174
IL-2	TGAGCAGGATGGAGAATTACAGG	GTCCAAGTTCATCTTCTAGGCAC	120
TNF-α	CCAGACCCTCACACTCACAAA	CTCCACTTGGTGGTTTGCTACG	82

Statistical Analysis

Data are the mean ± standard deviation (S.D.) and were analyzed using SPSS 13.0 software (U.S.A.). Data were compared using a one-way ANOVA. p-Values ≤0.05 or ≤0.01 were deemed statistically significant and extremely significant, respectively.

RESULTS

Characterization of PSP

Physicochemical Analysis

The polysaccharide extraction rates were 21.25%. The obtained PSP was brown and water soluble. Iodination tests (+), molisch (+), phenol–sulfuric acid test (+), anthrone reaction (+), and fehling’s reaction (+), confirmed that the PSP was composed of polysaccharides. The monosaccharide composition of PSP contained galactose, rhamnose, arabinose, mannose, and glucose, with a molar ratio of 11.72 : 1.78 : 4.15 : 1.00 : 2.48. The average molecular weight of PSP was 9.514 × 10⁴ Da, according to the calibration curves using standard dextrans.

UV-vis and Fourier Transform (FT)IR Analyses

PSP showed no absorption at 260 and 280 nm confirming an absence of nucleic acids and proteins. FTIR absorption bands for PSP are shown in Fig. 1. PSP showed strong yet broad absorption in the 2500–3600 cm⁻¹ range. Bands at 3372 cm⁻¹ were assigned to O–H stretching vibrations.¹⁷⁾ Peaks at 1366 and 2934 cm⁻¹ were indicative of C–H bending and stretching vibrations of –CH_x (x = 1–3), respectively.¹⁸⁾ The presence of C–H and O–H groups indicated inter- and intra-molecular interactions of the polysaccharides chains.¹⁹⁾ Bands at 1645 cm⁻¹ were assigned to COO-stretching.²⁰⁾ Typically, the 800–1300 cm⁻¹ region was considered a “fingerprint”: bands located between these frequencies were typically dependent on molecular vibrations and structures. Bands at 1128 and 1028 cm⁻¹ corresponded to the stretching of glycosidic bonds in the pyranoid ring.²¹⁾ Absorption at 932 and 820 cm⁻¹ were characteristic of β- and α-configurations, respectively.¹³⁾ Bands at 820 cm⁻¹ were typical for α-D-galactopyranose. Thus, PSP displayed absorption spectra that was typical for polysaccharides.¹⁴⁾

Fig. 1. FTIR Spectrum of Polysaccharides

In Vitro Assessments

Cytotoxicity of PSP against Splenocytes

The cytotoxicity of PSP to splenocytes was evaluated by MTT assays (Fig. 2). After 48 h incubation, cell viability increased at PSP concentrations ranging from 10–320 µg/mL. A further increase in PSP concentrations were shown to decrease cell viability, but PSP showed minimal toxicity to splenocytes. Therefore, PSP could promote cell proliferation at specific concentrations.

Fig. 2. Effects of the PSP on Splenocyte Proliferation in Vitro

Splenocytes were isolated from mice and cultured with PSP (10–1280 µg/mL) for 48 h. Cell proliferation was evaluated by MTT assay. Data are the mean ± S.D. (n = 3).

Effects of PSP on Splenocyte Proliferation

PSP led to the dose-dependent proliferation of splenocytes, that was most pronounced at 320 µg/mL (Fig. 3). Upon combination with T-cell (ConA) or B-cell mitogens (LPS), PSP could further enhance the proliferative responses of splenocytes. In addition, treatment with PSP plus ConA caused higher proliferation rates than cells treated with PSP plus LPS.

Fig. 3. Effects of PSP on the Proliferation of ConA- or LPS-Stimulated Splenocytes

PSP enhances the proliferation of splenocytes stimulated with PSP (10–320 µg/mL) in the presence of ConA (5 µg/mL) or LPS (10 µg/mL) for 48 h in vitro. Cell proliferation was evaluated by MTT assays at 570 nm. Data are presented as the mean ± S.D. (n = 3). Differences were considered statistically significant at the * p< 0.05 and ** p < 0.01 level.

In Vivo Assessments

PSP Protects against Thymus and Spleen Atrophy in Cy-Treated Mice

As shown in Table 2, mice in all groups gained weight over the 17 d study period. Cy treatment did not influence body weight, which may be due to the extended interval dosing of Cy.

Table 2. Body Weight, Spleen and Thymus Indices in Mice (Mean ± S.D., n = 6)

Group	Initial weight (g)	Terminal weight (g)	Spleen index (mg/g)	Thymus index (mg/g)
NC	19.14 ± 1.02	25.17 ± 1.75	2.168 ± 0.029	2.780 ± 0.190
LH	19.56 ± 1.54	25.36 ± 1.28	2.283 ± 0.215	2.916 ± 0.437
PSP (100 mg/kg)	19.38 ± 1.47	25.34 ± 1.19	2.342 ± 0.496	2.749 ± 0.045
PSP (200 mg/kg)	19.07 ± 1.85	26.17 ± 1.54	2.942 ± 0.356a)	2.998 ± 0.206
PSP (400 mg/kg)	19.53 ± 1.10	25.96 ± 1.62	3.665 ± 0.489a)	3.111 ± 0.228a)
Cy	19.27 ± 1.09	23.49 ± 1.87	1.625 ± 0.122a)	2.081 ± 0.022a)
Cy + LH	19.82 ± 1.39	25.02 ± 1.17	3.136 ± 0.058ab)	2.425 ± 0.202b)
Cy + PSP (100 mg/kg)	19.71 ± 1.29	23.73 ± 1.77	2.826 ± 0.279ab)	2.172 ± 0.108a)
Cy + PSP (200 mg/kg)	19.58 ± 1.63	24.89 ± 1.39	3.390 ± 0.331ab)	2.451 ± 0.203ab)
Cy + PSP (400 mg/kg)	19.45 ± 1.67	24.92 ± 1.61	3.420 ± 0.040ab)	2.789 ± 0.037b)

NC, normal control; LH, levamisole hydrochloride (positive control); Cy, Cy-treated mice; PSP, Polygonatum sibiricum polysaccharides; a) p < 0.05 vs. normal mice. b) p < 0.05 vs. Cy-treated mice administrated of saline.

After Cy treatment, thymus and spleen indices substantially decreased in comparison to normal mice. When immunosuppressed mice were treated with LH (positive control), both the thymus and spleen indices increased to higher spleen indices that normal levels. In comparison, treatment with PSP could increase the spleen index in immunosuppressed and normal mice. Additionally, the thymus index in Cy-treated mice was enhanced by PSP treatment. High-doses of PSP therefore influenced the thymus index in normal mice.

PSP Activates Macrophage Phagocytosis in Cy-Treated Mice

The influence of PSP on phagocytic activity was assessed using carbon clearance methods (Fig. 4). The phagocytic index of Cy-induced mice decreased substantially in comparison to normal mice, indicating that Cy treatment successfully induced immunosuppression in mice. Moreover, mice treated with PSP showed a substantial phagocytic index relative to normal and Cy-treated mice. Phagocytic activity was reestablished to levels that were similar and in some cases higher than normal levels in Cy-treated mice, demonstrating that PSP improves macrophage functions in normal and Cy-treated groups. Taken together, these findings reveal that PSP could improve non-specific immune functions and counteract the immunosuppressive effects induced by Cy.

Fig. 4. Effects of PSP on the Phagocytic Index of Normal Mice (A) and Cy-Induced Mice (B)

Data are the means ± S.D. of six mice. NC, normal control; LH, levamisole hydrochloride (positive control); Cy, Cy-treated mice; PSP, Polygonatum sibiricum polysaccharides. Data are the mean ± S.D. of four mice. * p < 0.05 and ** p < 0.01 vs. normal mice. ^# p < 0.05 and ^## p < 0.01 vs. Cy-treated mice.

Effects of PSP on NK Cell Activity

The cytotoxic activity of splenocytes against NK cell-sensitive YAC-1 cells was next investigated. As shown in Fig. 5, in comparison with normal mice, the activity of splenic NK cells was critically inhibited in Cy-treated mice. Following LH (positive control) treatment, NK cell activity increased to normal levels. Treatment with PSP at a dose of 200 or 400 mg/kg/d could further enhance NK cell activity, in the absence of immune enhancement at lower doses. PSP could promote NK cell activity in normal mice at intermediate or high doses.

Fig. 5. Effects of PSP on NK Cell Activity in Normal (A) and Cy-Treated Mice (B)

Splenocytes prepared from each group of mice were used as effector cells, whilst YAC-1 cells (NK-sensitive cell line) were used as the target cells. Effectors:targets = 50 : 1. NC, normal control; LH, levamisole hydrochloride (positive control); Cy, Cy-treated mice; PSP, Polygonatum sibiricum polysaccharides. Data are the mean ± S.D. of six mice. * p < 0.05 and ** p < 0.01 vs. normal mice. ^# p < 0.05 and ^## p < 0.01 vs. Cy-treated mice.

Effects of PSP on Leukocytes, Erythrocytes, Platelets, CD4⁺ and CD8⁺ T-Cells in the Peripheral Blood

The immunomodulatory effects of PSP were further examined at the cellular level. Peripheral leukocytes, erythrocytes, and platelets counts in Cy-treated mice significantly decreased when compared to normal mice (Table 3). Following PSP treatment, the number of peripheral cells increased in a dose-dependent manner. Treatment with PSP at doses of 400 mg/kg/d restored erythrocyte counts to normal levels. Both PSP and LH did not affect peripheral blood cell counts in normal mice.

Table 3. Effects of PSP on the Numbers of Leukocytes (10⁹/L), Erythrocytes (10¹²/L), Platelets (10¹¹/L), CD4+ and CD8+ T-Cells in the Peripheral Blood (Mean ± S.D., n = 6)

Group	Leukocytes (109)	Erythrocytes (1012)	Platelet (1011)	CD4+ (%)	CD8+ (%)	CD4+/CD8+
NC	7.28 ± 0.45	4.24 ± 0.42	5.59 ± 0.36	59.57 ± 0.59	27.18 ± 0.75	2.19 ± 0.57
LH	7.29 ± 0.67	4.28 ± 0.87	5.62 ± 0.89	62.29 ± 1.19	21.42 ± 1.57a)	2.91 ± 1.08a)
PSP (100 mg/kg)	7.28 ± 0.39	4.25 ± 0.41	5.56 ± 0.75	60.87 ± 1.56	23.24 ± 0.46	2.62 ± 0.72a)
PSP (200 mg/kg)	7.30 ± 0.14	4.22 ± 0.56	5.63 ± 0.86	62.49 ± 1.19	21.27 ± 0.89a)	2.94 ± 0.75a)
PSP (400 mg/kg)	7.26 ± 0.21	4.23 ± 0.73	5.54 ± 0.53	61.84 ± 1.59	22.63 ± 1.75a)	2.73 ± 1.58a)
Cy	6.69 ± 0.57a)	3.87 ± 0.42a)	4.82 ± 0.93a)	31.27 ± 1.46a)	52.19 ± 1.26a)	0.60 ± 1.42a)
Cy + LH	7.20 ± 0.75ab)	4.23 ± 0.79b)	5.41 ± 0.28ab)	58.86 ± 0.29b)	24.45 ± 0.76b)	2.41 ± 0.39ab)
Cy + PSP (100 mg/kg)	6.87 ± 0.19ab)	3.95 ± 0.54ab)	5.19 ± 0.57ab)	54.77 ± 1.52ab)	31.35 ± 0.52b)	1.75 ± 0.67ab)
Cy + PSP (200 mg/kg)	7.10 ± 0.71ab)	4.12 ± 0.29ab)	5.27 ± 0.85ab)	64.93 ± 0.28ab)	22.17 ± 1.97ab)	2.93 ± 1.79ab)
Cy + PSP (400 mg/kg)	7.18 ± 0.92ab)	4.25 ± 0.63b)	5.45 ± 0.36ab)	62.58 ± 0.56b)	21.08 ± 1.59ab)	2.97 ± 1.20ab)

NC, normal control; LH, levamisole hydrochloride (positive control); Cy, Cy-treated mice; PSP, Polygonatum sibiricum polysaccharides; a) p < 0.05 vs. normal mice. b) p < 0.05 vs. Cy-treated mice administrated of saline.

Immunophenotypes were evaluated by determining the counts of CD4⁺ and CD8⁺ T lymphocytes by flow cytometry (Table 3). Compared to normal mice, the percentage of CD4⁺ T-cells and CD4⁺/CD8⁺ ratio in Cy-treated mice markedly decreased. Following PSP treatment, the CD4⁺/CD8⁺ ratio increased in a dose-dependent manner. Treatment with PSP at doses of 200 or 400 mg/kg/d significantly upregulated CD4⁺/CD8⁺ ratio to 2.93 or 2.97, respectively, which exceeded that of LH treatment. In normal mice, both PSP and LH treatments led to increased CD4⁺/CD8⁺ ratio compared to the NC group. These results suggest that PSP can alleviate the immunosuppression induced by Cy.

Influence of PSP on IL-2 and TNF-α Serum Levels and the mRNA Expression of IL-2 and TNF-α

TNF-α and IL-2 serum levels in the mice treated with different PSP concentrations were evaluated relative to Cy-treated mice and normal control groups, respectively. Cy treatment alone substantially decreased IL-2 and TNF-α levels compared to normal mice (Figs. 6A, B). Treatment with high- and intermediate-doses of PSP recovered IL-2 levels in comparison to Cy-treated model groups. This recovery was not observed in low doses of PSP. Compared to normal control groups, the injection of PSP increased IL-2 levels in a dose-dependent manner, particularly at doses of 200 and 400 mg/kg. Decreases in serum TNF-α levels were substantial in groups administered Cy alone. The additional use of PSP at 200 and 400 mg/kg doses facilitated this decline. Furthermore, groups treated with 200 and 400 mg/kg also demonstrated enhanced TNF-α levels compared to the normal group.

Fig. 6. Effects of PSP on Serum Cytokines (IL-2, TNF-α) Levels and IL-2, TNF-α mRNA Expression in the Spleen Tissues of Mice

(A. IL-2 levels; B: TNF-α levels; C: IL-2 mRNA expression; D: TNF-α mRNA expression). Serum IL-2 and TNF-α levels of each mice were measured using ELISA kits. mRNA expression levels of IL-2 and TNF-α were quantified by qRT-PCR. NC, normal control; LH, levamisole hydrochloride (positive control); Cy, Cy-treated mice; PSP, Polygonatum sibiricum polysaccharides. Six animals per data point per group were used in the experiments. Values are the mean values. Error bars indicate the standard deviation. * p < 0.05 vs. normal mice, and ^# p< 0.05 vs. Cy-treated mice.

Substantial differences were observed in the relative mRNA expression of TNF-α and IL-2 in each group. The values were substantially lower in the Cy group compared to the normal control group. Groups treated with 100 and 200 mg/kg PSP showed higher expression of IL-2 mRNA than the Cy-group. However, the relative expression of IL-2 mRNA in PSP-treated groups remained lower than the normal control group (Fig. 6C). IL-2 expression in the groups treated with 400 mg/kg PSP increased to normal levels. Meanwhile, treatment with 200 and 400 mg/kg PSP substantially increased IL-2 expression compared to the normal control. No differences between the groups treated with 100 mg/kg PSP, normal control and/or Cy groups were observed in terms of the mRNA expression of TNF-α (Fig. 6D). Expression in groups treated with 200 and 400 mg/kg PSP were substantially higher than the Cy group. Simultaneously, the relative expression of TNF-α mRNA was noticeably higher compared to the normal control group and high-dose PSP group.

DISCUSSION

This study demonstrates the isolation of polysaccharides from P. sibiricum (PSP) with the goal of evaluating their in vitro and in vivo immunomodulatory activity. We demonstrate that PSP has immunoregulatory effects on normal mice and facilitates the recovery of immunosuppression in mice treated with Cy.

As a well-known alkylating agent, Cy is an important chemotherapeutic agent used in tumor therapy. Cy can be used as an immunosuppressant and its mechanism is similar to that of virus immunosuppression.²²⁾ Cy damages DNA, interferes with the propagation and differentiation of T and B cells, kills immune cells and restrains cellular and humoral immune responses.^10,23) Additionally, the spleen and thymus are essential organs that play an important role in non-specific immunity. Thus, both immune function and prognosis can be assessed using thymus and spleen indices.²⁴⁾ Animals treated with CY are often used as immune deficiency or immunosuppression models. For this purpose, we implemented Cy for the creation of an immunosuppressive animal model.

LH is an immune-modulating agent which can stimulate depressed T-cell activity and enhance B lymphocyte function in immune-depressed patients. So it is often used an immunostimulant agent to enhance immune response in mice.^25,26)

The immune organ index indirectly reflects the body’s immune function, so spleen and thymus indices were measured. The results revealed that both the thymus and spleen indices increased in immunosuppressed mice after PSP treatment, revealing the immune-regulating capacity capacity of PSP.

T- and B-cells from the spleen and the proliferation of lymphocytes directly reflect cellular immunity in animals.^10,23) Both B- and T-lymphocytes participate in immune response regulation.¹²⁾ Lymphocyte proliferation assays are a reliable alternative to direct measurements of immune function. It is known that T-cells can proliferate in response to stimulation with ConA, whilst B-cells can undergo mitosis after incubation with LPS.^22,27) Both T-cells and B-cells are critical for the regulation of immune responses. Previous studies have shown that Eucommia ulmoides polysaccharides in combination with ConA or LPS can promote lymphocyte proliferation in vitro.¹²⁾ Our data suggest that treatment with PSP plus ConA or LPS can significantly regulate the activity of splenocytes.

The phagocytic activity of the reticuloendothelial system is typically evaluated through carbon particle removal rates from the bloodstream²⁸⁾: the faster this removal, the higher the phagocytic activity.²⁹⁾ The function of macrophages was evaluated by carbon clearance tests performed in each group of mice. We found that PSP could substantially enhance macrophage phagocytosis in a dose-dependent manner. Thus, PSP has the capacity to improve the functions of macrophages in response to Cy.

NK cells form the first line of defense against physiological innate immunity and play a role in connecting non-specific and specific immunity.³⁰⁾ NK cell activity was measured through LDH release assays, used to evaluate the method through which PSP influenced non-specific cell-mediated immunity. Following Cy treatment, NK cell activity in mice was substantially reduced, suggesting that the immunosuppressed model was successfully established. Through treatment with PSP at an appropriate dose, NK cell activity in Cy-treated mice recovered to near normal levels.

As a chemotherapeutic agent, Cy can cause cytotoxicity to healthy cells and induce side effects such as immunosuppression. Our findings showed that Cy could reduce peripheral leukocytes, erythrocytes, and platelet levels, consistent with other studies.^15,22) As expected, the administration of PSP restored peripheral cell counts at the same levels of LH.

CD4⁺ T cells are auxiliary T lymphocytes, the main functions of which are to enhance the anti-infection effects mediated by phagocytes and to enhance the humoral immune responses mediated by B cells. CD8⁺ T cells are suppressive/lethal T lymphocytes, that directly kill target cells. The maintenance of normal immune function depends on a relatively stable proportion of T lymphocyte subsets, particularly the CD4⁺/CD8⁺ ratio. Previous studies have shown that the CD4⁺/CD8⁺ ratio in immunosuppressed mice were lower than those of normal mice.^22,31) In this study, PSP increased the CD4⁺/CD8⁺ ratio compared to the model group, indicating that PSP could restore the immunosuppression induced by Cy treatment.

Cytokines are key to cell-to-cell communication in the immune system, which typically occurs through the coordination of lymphoid, inflammatory and hematopoietic cells.^28,32) Different cytokines interact and influence the synthesis of other cytokines. TNF-α is critical for differentiation and proliferation, and is typically generated by the majority of immune cells. Its role in host defense systems enables its to induce the expression of other inflammatory and immunoregulatory mediators to neutralize cancerous cells.³³⁾ IL-2 is a cytokine produced in T-cells that is necessary for cell proliferation, growth and differentiation.¹⁵⁾ Our results showed that PSP not only stimulates the secretion and expression of IL-2 and TNF-α in splenic lymphocytes, but promotes the secretion of serum cytokines in animal experiments in vivo. qRT-PCR confirmed that PSP could promote the expression of both TNF-α and IL-2 at the gene level, further validating our in vivo data. Taken together, these data suggest that PSP regulates immune enhancement through its ability to regulate cytokine secretion.

CONCLUSION

In summary, PSP was extracted with distilled water, and purified on a DEAE cellulose-52 and Sephadex G-100 column. The monosaccharides in PSP were galactose, rhamnose, arabinose, mannose, and glucose. The average molecular weight of PSP was 9.514 × 10⁴ Da. Normal mice and Cy-immunosuppressed mice were used as animal models. By monitoring the changes in immune organs, immune cell numbers and cytokines, the in vivo immune activity of PSP was evaluated in detail. PSP notably increased spleen and thymus organ indices, suggesting its ability to enhance immune organ function in mice. From the perspective of immune factors, PSP could regulate lymphocyte subsets and increase the expression of cytokines in vivo, providing essential immune modulating function. At the level of immune cells, PSP not only significantly increased the phagocytosis of mononuclear macrophages, but promoted T/B lymphocyte proliferation in the spleen of mice. Thus, it was inferred that PSP plays an active regulatory role in both cellular and humoral immune functions to activate both non-specific and specific immune responses both in vivo and in vitro. These results lay a foundation for the extensive application of PSP as a powerful immunomodulator to prevent and to treat immunosuppressive disease.

Acknowledgments

We acknowledge the support from the Innovative Special Project for Social and People’s Livelihood of Chongqing: the functional component development technology and application of Polygonatum sibiricum (cstc2016shmszx00014).

Conflict of Interest

The authors declare no conflict of interest.

REFERENCES

• 1) Sun LR, Li X, Wang SX. Two new alkaloids from the rhizome of Polygonatum sibiricum. J. Asian Nat. Prod. Res., 7, 127–130 (2005).
• 2) Zeng GF, Zhang ZY, Lu L, Xiao DQ, Xiong CX, Zhao YX, Zong SH. Protective effects of Polygonatum sibiricum polysaccharide on ovariectomy-induced bone loss in rats. J. Ethnopharmacol., 136, 224–229 (2011).
• 3) China Pharmacopoeia Committee Pharmacopoeia of the People’s Republic of China. Chemical Industry Press, Beijing (2010).
• 4) Liu L, Dong Q, Dong XT, Fang JN, Ding K. Structural investigation of two neutral polysaccharides isolated from rhizome of Polygonatum sibiricum. Carbohydr. Polym., 70, 304–309 (2007).
• 5) Wang J, Lu CS, Liu DY, Xu YT, Zhu Y, Wu HH. Constituents from Polygonatum sibiricum and their inhibitions on the formation of advanced glycosylation end products. J. Asian Nat. Prod. Res., 18, 697–704 (2016).
• 6) Ahn MJ, Kim CY, Yoon KD, Ryu MY, Cheong JH, Chin YW, Kim J. Steroidal. saponins from the rhizomes of Polygonatum sibiricum. J. Nat. Prod., 69, 360–364 (2006).
• 7) Hu CY, Xu DP, Wu YM, Ou SY. Triterpenoid saponins from the rhizome of Polygonatum sibiricum. J. Asian Nat. Prod. Res., 12, 801–808 (2010).
• 8) Sun LR, Li X. Studies on chemical constituents of Polygonatum sibiricum (II). Zhongcaoyao, 32, 586–588 (2001).
• 9) Liang M, Zhao Q, Liu G, Yang S, Zuo X, Cui G, Zhong S, Sun J, Liu J, Zhu R. Pathogenicity of Bordetella avium under immunosuppression induced by Reticuloendotheliosis virus in specific-pathogen-free chickens. Microb. Pathog., 54, 40–45 (2013).
• 10) Fan Y, Lu Y, Wang D, Liu J, Song X, Zhang W, Zhao X, Nguyen TL, Hu Y. Effect of epimedium polysaccharide-propolis flavone immunopotentiator on immunosuppression induced by cyclophosphamide in chickens. Cell. Immunol., 281, 37–43 (2013).
• 11) Zhang Y, Yang S, Zhao X, Yang Y, Li B, Zhu F, Zhu R. Immune enhancement of Taishan Robinia pseudoacacia polysaccharide on recombinant Proteus mirabilis OmpA in chickens. Int. Immunopharmacol., 22, 236–241 (2014).
• 12) Feng H, Fan J, Song Z, Du X, Chen Y, Wang J, Song G. Characterization and immunoenhancement activities of Eucommia ulmoides polysaccharides. Carbohydr. Polym., 136, 803–811 (2016).
• 13) Xu Y, Cai F, Yu Z, Zhang L, Li X, Yang Y, Liu G. Optimisation of pressurised water extraction of polysaccharides from blackcurrant and its antioxidant activity. Food Chem., 194, 650–658 (2016).
• 14) Chen JR, Yang ZQ, Hu TJ, Yan ZT, Niu TX, Wang L, Cui DA, Wang M. Immunomodulatory activity in vitro and in vivo of polysaccharide from Potentilla anserina. Fitoterapia, 81, 1117–1124 (2010).
• 15) Yu Q, Nie SP, Wang JQ, Liu XZ, Yin PF, Huang DF, Li WJ, Gong DM, Xie MY. Chemoprotective effects of Ganoderma atrum polysaccharide in cyclophosphamide-induced mice. Int. J. Biol. Macromol., 64, 395–401 (2014).
• 16) Cui HX, Li T, Wang LP, Su Y, Xian CJ. Dioscorea bulbifera polysaccharide and cyclophosphamide combination enhances anti-cervical cancer effect and attenuates immunosuppression and oxidative stress in mice. Sci. Rep., 6, 19185 (2016).
• 17) Han L, Suo Y, Yang Y, Meng J, Hu N. Optimization, characterization, and biological activity of polysaccharides from Berberis dasystachya Maxim. Int. J. Biol. Macromol., 85, 655–666 (2016).
• 18) Wang Y, Liu X, Zhang J, Liu G, Liu Y, Wang K, Yang M, Cheng H, Zhao Z. Structural characterization and in vitro antitumor activity of polysaccharides from Zizyphus jujuba cv. Muzao. RSC Adv., 5, 7860–7867 (2015).
• 19) Zhang Z, Kong F, Ni H, Mo Z, Wan JB, Hua D, Yan C. Structural characterization, α-glucosidase inhibitory and DPPH scavenging activities of polysaccharides from guava. Carbohydr. Polym., 144, 106–114 (2016).
• 20) Šandula J, Kogan G, Kačuráková M, Machová E. Microbial (1→3)-β-D-glucans, their preparation, physico-chemical characterization and immunomodulatory activity. Carbohydr. Polym., 38, 247–253 (1999).
• 21) Chai Y, Zhao M. Purification, characterization and anti-proliferation activities of polysaccharides extracted from Viscum coloratum (Kom.). Nakai. Carbohydr. Polym., 149, 121–130 (2016).
• 22) Wang H, Wang M, Chen J, Tang Y, Dou J, Yu J, Xi T, Zhou C. A polysaccharide from Strongylocentrotus nudus eggs protects against myelosuppression and immunosuppression in cyclophosphamide-treated mice. Int. Immunopharmacol., 11, 1946–1953 (2011).
• 23) Gong Y, Wu J, Li ST. Immuno-enhancement effects of Lycium ruthenicum Murr. polysaccharide on cyclophosphamide-induced immunosuppression in mice. Int. J. Clin. Exp. Med., 8, 20631–20637 (2015).
• 24) Mei YX, Chen HX, Zhang J, Zhang XD, Liang YX. Protective effect of chitooligosaccharides against cyclophosphamide-induced immunosuppression in mice. Int. J. Biol. Macromol., 62, 330–335 (2013).
• 25) Renoux G. The general immunopharmacology of levamisole. Drugs, 20, 89–99 (1980).
• 26) Chen LY, Lin YL, Chiang BL. Levamisole enhances immune response by affecting the activation and maturation of human monocyte-derived dendritic cells. Clin. Exp. Immunol., 151, 174–181 (2008).
• 27) Marits P, Wikström AC, Popadic D, Winqvist O, Thunberg S. Evaluation of T and B lymphocyte function in clinical practice using a flow cytometry based proliferation assay. Clin. Immunol., 153, 332–342 (2014).
• 28) Dashputre NL, Naikwade NS. Immunomodulatory activity of Abutilon indicum linn on albino mice. Int. J. Pharm. Sci. Res., 1, 178–184 (2010).
• 29) Thakur M, Bhargava S, Dixit VK. Immunomodulatory activity of Chlorophytum borivilianum Sant. F. Evid. Based Complement. Alternat. Med., 4, 419–423 (2007).
• 30) Krug A, French AR, Barchet W, Fischer JA, Dzionek A, Pingel JT, Orihuela MM, Akira S, Yokoyama WM, Colonna M. TLR9-dependent recognition of MCMV by IPC and DC generates coordinated cytokine responses that activate antiviral NK cell function. Immunity, 21, 107–119 (2004).
• 31) Huyan XH, Lin YP, Gao T, Chen RY, Fan YM. Immunosuppressive effect of cyclophosphamide on white blood cells and lymphocyte subpopulations from peripheral blood of Balb/c mice. Int. Immunopharmacol., 11, 1293–1297 (2011).
• 32) Liu XC, Zhu ZY, Tang YL, Wang MF, Wang Z, Liu AJ, Zhang YM. Structural properties of polysaccharides from cultivated fruit bodies and mycelium of Cordyceps militaris. Carbohydr. Polym., 142, 63–72 (2016).
• 33) Qiao D, He X, Wei C, Xia L, Bao L. Effects of Hyriopsis cumingii polysaccharides on mice immunologic receptor, transcription factor, and cytokine. J. Food Sci., 81, H1288–H1294 (2016).