Isosteviol Sodium Attenuates High Fat/High Cholesterol-Induced Kidney Dysfunction by Inhibiting Inflammation, Oxidative Stress and Apoptosis

Abstract

The sodium salt of isosteviol (STVNa) is a beyerane diterpene synthesized through acid hydrolysis of stevioside. STVNa improves multiple types of tissue injuries. However, it is not known how isosteviol sodium affects high-fat and high cholesterol diet (HFD)-induced kidney. Therefore, in this study we examined the potential molecular mechanism underlying STVNa mediated protective effect against high fat/high cholesterol-induced kidney dysfunction in HFD-induced kidney injury. Sprague-Dawley (SD) rats were allocated into six groups: the normal group, HFD group and HFD treated with three doses of STVNa, fenofibrate treatment group. The results indicated that HFD induced kidney injury evident by a 60% increase in serum creatinine (CRE) leves. In addition, there was a significant accumulation of triglycerides (approx. 60%), fatty acids (approx. 50%) and total cholesterol (approx. 2.5 fold) in the kidneys. STVNa inhibited HFD-induced kidney injury evident by reducing the increased levels of serum CRE. Specifically, STVNa attenuated HFD-induced kidney injury by inhibiting inflammation, oxidative stress, and apoptosis. These findings indicate that STVNa has a therapeutic potential for HFD-induced kidney dysfunction. The mechanisms of this pharmacological effect are through the inhibition of inflammation, oxidative stress and apoptosis.

INTRODUCTION

Obesity is an independent risk factor for kidney disease concern now.^1,2) The obesity may be linked to risks of hypertension, type 2 diabetes and cardiovascular diseases.³⁾ Obesity has been associated with lipid accumulation, inflammation and oxidative stress in kidney tissues.⁴⁾ Western countries’ dietary patterns are characterized by high-fat foods which are trigger for the development of metabolic disease, such as obesity, hyperlipemia, chronic kidney disease (CKD) and so on.⁵⁾ High-fat diets lead to a positive fat balance and lipid accumulation which can be harmful to normal body functions.⁶⁾ However, to the best of our knowledge, there are no effective therapeutic strategies currently.

Isosteviol is a widely known sweetener which was isolated from the herb Stevia rebaudiana. STVNa is the sodium salt of isosteviol which has been reported to inhibit the production of reactive oxygen species (ROS) as well as mitochondrial membrane potential (MMP) in post-ischemic reperfusion injury.⁷⁾ Our previous studies also demonstrated that STVNa suppresses nuclear factor-kappaB (NF-κB)-mediated inflammation and apoptosis in other disease models.⁸⁾ However, the therapeutic effect of STVNa on kidney injure has not been reported.

Inflammation, oxidative stress and apoptosis are important pathogenic processes in kidney dysfunction. Here, we aimed to examine the protective influence of STVNa against high fat high cholesterol diet (HFD)-induced kidney injury as well as its underlying molecular mechanisms. Further, the study investigated whether STVNa could alleviate renal damage in rats induced by HFD through the suppression of inflammation, oxidative stress and apoptosis.

MATERIALS AND METHODS

Animals

Five to six-weeks of age rats weighing old adult male Sprague-Dawley (SD) rats, (weighing 80–100 g) were purchased from the Animal Research Centre of Guangzhou University of Chinese Medicine (Guangzhou, China). The rats were reared in separate cages (3–4 rats per cage) under 12/12-h light/darkness cycles and kept a stable temperature environment (22 ± 2°C). At the same time, food and water were provided normally. Subsequently, the animals were randomly divided into six groups: normal group (Normal; n = 12), a high-fat/high-cholesterol group (HFD; n = 12), a HF diet supplemented with STVNa at 1/10/20 mg/kg/d/(HF-NR, n = 12), and a fenofibrate treatment group (positive control; n = 12). Animal experiments were approved by the Institutional Animal Care and Use Committee of Sun Yat-sen University.

STVNa Administration

The Chemical Development Laboratories of Key Biological Pharmaceutical Company (Dongguan, China) supplied STVNa for this work. The high-fat and high-cholesterol diet were purchased from the Mao Si Bei Ke biotechnology company (Beijing. China). For the dose–response experiment, the rats were assigned to 6 groups: Normal (n = 12), HFD (n = 12), and STVNa (1, 10, 20 mg/kg, n = 12 per group) dissolved in the same volume of vehicle. Fenofibrate (Sigma, St. Louis, MO, U.S.A.), 100 mg/kg/d dissolved in 1% sodium carboxymethyl cellulose, was used as a positive drug to ensure the sensitivity of this model.

Study Design

The specific process of establishing the model and administration schedule is presented in Fig. 1.

Fig. 1. Experimental Protocol for the Induction of Kidney Injure and STVNa Administration in SD Rats

Firstly, the rats were separated into 2 groups. One group (n = 60) received high fat/high cholesterol diet while the control group (n = 12) was fed the standard diet for 5 weeks. Then, the high cholesterol/high fat diet-fed rats were further separated into 5 groups (n = 12 per group). The rats from the HFD, HFD + STVNa and HFD + Fenofibrate groups were fed high fat. Different doses of STVNa, fenofibrate or normal saline was performed by gavage for 5 weeks. Normal rats were sensitized and challenged with the equivalent of normal saline. STVNa: isosteviol sodium.

Hemoxylin and Eosin Staining and Periodic Acid-Schiff Staining

The kidney tissues were isolated from euthanized rats and fixed in 4% formaldehyde for 24 h. The tissues were cut into 5 µm thick sections after embedding in paraffin. Next, they were stained with hematoxylin and eosin (H&E) for evaluation of general morphology and periodic acid-Schiff staining deposition of glycogen. The morphology of the tissue blocks was visualized under the Ziess microscope (Zeiss, Oberkochen, Germany).⁹⁾

Total sera cholesterol (TC), non-esterified fatty acids (NEFA) and total triglycerides (TG) were measured using the corresponding assay kits. Approximately 50 mg of the kidney tissues were harvested from each rat, placed in 1.5 mL micro centrifuge tubes and homogenized in 500 µL of PBS. The homogenates were incubated at room temperature (r.t.) for 5 min. Thereafter, they were separated by centrifugation at 12000 rpm for 5 min at 4°C. Approximately 300 µL of the supernatant was transferred into micro centrifuge tubes and quantification of TG, TC, and NEFA levels performed.

Assessment of Kidney Function

By measuring serum levels of creatinine (CRE), and uric acid (UA) to evaluate the kidney function. Briefly, blood was collected using a 20-gauge needle and centrifuged at 3000 rpm for ten minutes at 4°C. Serum levels of CRE and UA were measured using commercial kits (Nanjing Jiancheng Bioengineering Institute, Jiangsu, China).

Measurements of Malondialdehyde (MDA)/Glutathione (GSH) and Superoxide Dismutase (SOD) Activities in Kidney

To determine kidney levels of GSH, SOD, and MDA, the supernatant of the homogenized kidney tissues for analysis was collected by centrifugation at 4000 rpm for 10 min at 4°C. The concentration of proteins was quantified with the bicinchoninic acid (BCA) kit (Ding Guo, Beijing, China). MDA, GSH and SOD activities were detected using MDA, GSH Assay Kit-WST and SOD Assay Kit-WST (Nanjing Jiancheng Bioengineering Institute) according to the manufacturer’s protocols.¹⁰⁾

Real-Time PCR

Frozen kidney (−80°C) samples were homogenized, Total RNA samples were prepared by using trizol reagent (Songshu, Guangzhou, China), and quantitatively measured using nano drop2000 (Thermo, U.S.A.). Primers for tumor necrosis factor-α (TNF-α), interleukin-1 beta (IL-1β), interleukin-6 (IL-6), Bcl2-associated X protein (Bax), B-cell CLL/lymphoma 2 (Bcl-2) were composed by Generay company (as shown in Table 1). Quantitative (q)PCR reactions were run for 40 cycles and the target genes amplified by qPCR using RT-PCR kit (Vazyme, NanJing, China) according to the manufacturer’s protocol and the paper.¹⁰⁾

Table 1. List of Primers Used for Real-Time PCR

Gene	Forward primer (5′→3′)	Reverse primer (5′→3′)
BCL2	CCAGCGTGTGTGTGCAAGTGTAAAT	ATGTCAATCCGTAGGAATCCCAACC
BAX	GCTGATGGCAACTTCAACTG	GATCAGCTCGGGCACTTTAG
IL1β	CTTCCCCAGGGCATGTTAAG	ACCCTGAGCGACCTGTCTTG
IL6	TTCCATCCAGTTGCCTTCTTG	TTGGGAGTGGTATCCTCTGTGA
TNFα	ATGGCCTCCCTCTCATCAGT	CTTGGTGGTTTGCTACGACG
GADPH	AGCCAAAAGGGTCATCATCT	GGGGCCATCCACAGTCTTCT

Western Blot Analyses

Kidney tissues were lysed with cold RIPA Lysis buffer (Ding Guo) containing 1 mM protease and phosphatase inhibitor cocktail (Ding Guo). The concentration of the proteins was quantified using the Bicinchoninic acid (BCA) assay (Ding Guo) after centrifugation at 12000 rpm for 5 min. Proteins separated by sodium dodecyl sulfate (SDS)-polyacrylamide gels were transferred to polyvinylidene difluoride (PVDF) membranes (Millipore, U.S.A.). Then, the membranes were incubated overnight at 4°C with the following primary antibodies: rabbit monoclonal anti-glyceraldehyde-3-phosphate dehydrogenase (GAPDH) antibody (diluted 1 : 5000, Abcam, Cambridge, U.K.), rabbit monoclonal anti-NFκB antibody (diluted 1 : 1500, Genetex, Zeeland, MI, U.S.A.), rabbit monoclonal anti-P-NFκB antibody (diluted 1 : 1000, Genetex), rabbit monoclonal anti-Bax antibody (diluted 1 : 1000, Abcam), rabbit monoclonal anti-Bcl2 antibody (diluted 1 : 1000, Affinity, Tokyo, Japan). Further incubation with secondary HRP-goat anti-rabbit antibody (diluted 1 : 5000, Affinity) was done for 45 min at r.t. Then, the membranes were washed thrice with TBST buffer (Ding Guo) at r.t. for 10 min. The ECL chemiluminescence kit (ASPEN, U.S.A.) was used to examine the binding affinity and the bands were visualized using Image Lab Software (Bio-Rad, Hercules, CA, U.S.A.).¹¹⁾

Statistical Analyses

Data was processed using GraphPad Prism5.0 Software (GraphPad Software, Inc., U.S.A.). One-way ANOVA with Tukey’s multiple comparison test was used to analyze the means of different groups. A p-value of less than 0.05 was considered as statistically significant.

RESULTS

Kidney Morphology and Lipid Content Changes

The morphological changes after the HFD diet were administered for 5 weeks as shown in Fig. 2a. Nuclear pyknosis and inflammatory cell infiltration in the HFD group at 5weeks indicated that the kidney injury model was successfully established.

Fig. 2. The Impact of HFD Treatment on Morphological Changes and Serum Parameters at Five Weeks

(a) Hematoxylin and eosin (H&E) staining images of the kidney (magnification: ×400, scale bar = 50 µm); (b) TC and TG content; (c) NEFA content (n = 6, ^# p < 0.05, ^## p < 0.01 vs. the normal group). HFD: high-fat high cholesterol diet; H&E staining: hemoxylin and eosin staining; TC: Triglycerides; TG: total cholesterol; NEFA: non-esterified fatty acids. (Color figure can be accessed in the online version.)

HFD animals exhibited higher plasma levels of triglycerides (F = 38.17, p < 0.05), cholesterol (F = 29.23, p < 0.05) (Fig. 2b) and non-esterified fatty acids (NEFA) (F = 35.76, p < 0.05) (Fig. 2c).

Effects of STVNa on Body Weight (BW) and Kidney Function

Animals fed normally exhibited lower weight than the one of HFD group. The bodyweight of rats in STVNa group was smaller relative to that of rats in the HFD group and fenofibrate treatment group (Fig. 3b). However, there was no significant change after treatment with STVNa and fenofibrate.

Fig. 3. Effects of STVNa Treatment on Weight and Kidney Function

(a) H&E staining images of kidney (magnification: ×200, scale bar = 100 µm); (b) KW/BW at age of 10th week; (c) The level of UA; (d) The level of CRE. All data are expressed as mean ± standard error of the mean (S.E.M.) (n = 6 for each group). ^## p < 0.01 vs. the normal group; * p < 0.05, ** p < 0.01 vs. the HFD group. HFD: high fat diet; H&E staining: hemoxylin and eosin staining, BW: body weight, KW: kidney weight, UA: uric acid; CRE: creatinine; Fen: fenofibrate. (Color figure can be accessed in the online version.)

H&E staining was used to examine morphological changes in the 10th week after high-fat/high cholesterol diet (Fig. 3a). Clear structures were exhibited in the normal group, whereas the high-fat diet treated group exhibited shrinkage, nuclear pyknosis, and enlargement of the intercellular space. Rats showed less extensive damage with multiple STVNa treatments and fenofibrate treatment group. In particular, rats treated with the 10 mg/kg STVNa showed significantly improvement.

The UA and CRE levels were elevated in HFD-fed rats relative to the normal group. However, UA and CRE levels (F = 14.91, p < 0.05) were significantly lower in the STVNa group relative to HFD group. Fenofibrate also decreased serum UA and CRE levels in HFD-fed rats. However, there were no significant change between HFD group and fenofibrate group on serum UA level (Figs. 3c, d).

Effect of STVNa on Oxidative Stress in Kidney

Total MDA level (F = 107.3, p < 0.05) and SOD inhibition ratio (F = 265.8, p < 0.05) of kidney tissues were increased in HFD group as compared with those in the normal group, however, those in the group treated with STVNa or fenofibrate were significantly decreased (Figs. 4a, b). Animals fed with HFD exhibited a marked reduction in GSH levels while STVNa treatment led to a significant elevation in GSH levels (F = 37.89, p < 0.05). All these molecular markers of oxidative stress were significantly inhibited by STVNa treatment (Fig. 4c). However, there were no significant differences between HFD group and fenofibrate treatment groups on the level of GSH.

Fig. 4. Effects of STVNa on Oxidative Stress in Kidney

(a) The level of MDA (mmol/mgprot); (b) SOD inhibition ratio; (c) The level of GSH (µmol/mgprot). All data are represented as mean ± S.E.M. (n = 6 for each group). ^## p < 0.01, ^### p < 0.001, vs. the normal group; * p < 0.05, ** p < 0.01, *** p < 0.001, vs. the HFD group. HFD: high fat diet; MDA: malondialdehyde; SOD: superoxide dismutase; GSH: glutathione; Fen: fenofibrate.

Effects of STVNa on Lipid Accumulation in Kidney

To illustrate the effect of STVNa treatment on glycogen and glomerular expansion, morphological analysis revealed that rats fed with HFD developed a remarkable increase in glomerular area and glycogen content (Figs. 5a, b). However, quantitative analysis of the PAS-positive matrix revealed that treatment with STVNa reduced the increase in glomerular area and glycogen content (F = 13.145, p < 0.05), and the fenofibrate showed the same trend drawn from results.

Fig. 5. Effects of STVNa on Renal Morphology and Metabolic Parameters

(a) PAS staining images of kidney (magnification: ×400, scale bar = 100 µm); (b) Semi-quantification of PAS; (c) The level of TG and TC (mmol/gprot); (d) The level of NEFA (mmol/gprot). Data are expressed as mean ± S.E.M. (n = 6 for each group). * p < 0.05, ** p < 0.01, *** p < 0.001, vs. the HFD group; ^# p < 0.05, ^### p < 0.001, vs. the normal group. HFD: high fat diet; PAS: periodic acid-Schiff staining; TC: Triglycerides; TG: total cholesterol; NEFA: nonesterified fatty acid; Fen: fenofibrate. (Color figure can be accessed in the online version.)

To determine the effect of STVNa treatment on lipid storage, we measured the content of TG, TC and NEFA in kidney tissue. As illustrated in Figs. 5c and d, the results showed that the plasma levels of non-esterified fatty acids (NEFA) (F = 86.71, p < 0.0001) (Fig. 5d), triglycerides and cholesterol were higher in rats fed on HFD diet (Fig. 5c) relative to rats fed on normal diet at 10 weeks. These were attributed to the effects of STVNa treatment. The content of TG, TC and NEFA were also significantly decreased by treatment with fenofibrate.

Effect of STVNa on Cell Apoptosis in Kidey

RT-PCR assays revealed increased expression of Bax (F = 16.12, p < 0.05) and a reduced expression of Bcl-2 level (F = 20.65, p < 0.05) in the HFD group relative to the normal group, and the STVNa treatment restored these alterations (Figs. 6a, b). To further confirm the anti-apoptotic effects of STVNa, Western bolt was performed, and the data were illustrated in Figs. 6c, e. Compared with the rats in normal group, increased protein expression of Bax and a reduced expression of Bcl-2 were observed in the HFD-induced rats. However, STVNa treatment played a major role in suppressing Bax expression (F = 19.83, p < 0.05) and inducing Bcl-2 expression (F = 25.85, p < 0.05).

Fig. 6. Effects of STVNa on the Cell Apoptosis Expression and Gene Expression

(a) Bax mRNA levels in the kidney. (b) Bcl-2 mRNA levels in the kidney. (c) The protein level of Bax, Bcl2, and GADPH assessed by Western blotting. (d) Bax and (e) Bcl2 expression was measured and presented in bar graph. All data are expressed as mean ± S.E.M. (n = 6 for each group). * p < 0.05, ** p < 0.01, *** p < 0.001, vs. the HFD group; ^# p < 0.05, ^### p < 0.001, vs. the normal group. HFD: high fat diet.

Effect of STVNa on Kidney Inflammation

IL-1β, IL-6, and TNF-α are essential inflammatory mediators involved in inflammatory response. Therefore, we evaluated the quantitative expressions of IL-1β, IL-6, and TNF-α genes controlling inflammation by real-time PCR array. The results showed the expression of genes involved in inflammation signaling were up regulated in the HFD group, while STVNa treatment reduced the expression of these inflammatory mediators (F = 11.08, F = 18.50, F = 35.75, p < 0.05) (Figs. 7a–c).

Fig. 7. Effects of STVNa on the Expression of Inflammatory Cytokines

(a) IL1β mRNA level in the kidney tissue. (b) The mRNA level of IL6 in the kidney tissue. (c) TNFα mRNA level in the kidney tissue. (d) The NFκB, P-NFκB, and GADPH protein expression evaluated by Western blotting. (e) Bar graph showing P-NFκB/NFκB expression ratio. All data are expressed as mean ± S.E.M. (n = 6 for each group). * p < 0.05, ** p < 0.01, *** p < 0.001, vs. the HFD group; ^# p < 0.05, ^## p < 0.01, ^### p < 0.001, vs. the Normal group. HFD: high fat diet.

Furthermore, the protein levels of NFκB and p-NFκB were determined by Western blot. The results indicated that the protein level of p-NFκB and the p-NFκB/NFκB expression ratio were significantly increased in the HFD group while the expression of p-NFκB and p-NFκB/NFκB expression ratio (F = 21.45, p < 0.05) were down regulated in the kidney tissues of the rats treated with STVNa (Figs. 7d, e).

DISCUSSION

Isosteviol, a common natural sweetener, has antitumor and anti-inflammatory activities.^12,13) HFD feeding induces the metabolic syndrome such as hyperinsulinemia, hyperlipidemia, impaired renin angiotensin-aldosterone activity, oxidative stress, and insulin resistance. Reduced insulin sensitivity is more likely to lead to chronic kidney disease than other metabolic complications in the kidney. This study used the model of HFD fed rat to investigate whether STVNa could alleviate insulin resistance and explored the mechanism by which STVNa prevents apoptosis, inflammation, and oxidative stress in high-fat/high cholesterol diet-induced kidney injury and whether the NF-κB pathway is involved.

Based on the findings, a high-fat/high cholesterol diet rats anomalies in a significant rise in high fat and kidney tissue pathological changes. In the present study, hemoxylin and eosin staining results indicate that STVNa or fenofibrate treatment can improve kidney function and reduce infiltrative inflammatory cells. Numerous studies have identified MDA as a reliable biomarker of oxidative balance since it directly reflects the levels of ROS. GSH and SOD are essential antioxidant enzymes capable of scavenging free radicals and maintaining biosynthesis, cellular immunity among other functions.^14,15) Both enzymes possess a number of important physiological functions.^16,17) Therefore, in this study, MDA and GSH content were measured. The findings report that GSH content in the kidney tissue increased significantly with STVNa treatment, while SOD and MDA enzyme activity decreased obviously. SOD and MDA enzyme activity were also significantly inhibited by fenofibrate treatment. These results indicate that STVNa and fenofibrate can effectively improve the kidney antioxidant capacity. However, STVNa has a better antioxidant effect compared to fenofibrate. Previous studies have similarly demonstrated the cardiomyopathy (DCM) effects of STVNa, focusing on the suppression of pathological processes DCM and inhibiting extracellular signal-regulated kinase (ERK) 1/2 phosphorylation to reduce the cardiac tissue oxidative stress.¹⁰⁾ Our findings are consistent with previous findings and the mechanism underlying improved antioxidant ability may inhibit ROS production and ERK signaling pathways.

Oxidative stress is an important pathogenic mechanism of metabolic syndrome which induces inflammation.^18,19) In the present study, there was a marked increase in glomerular surface area and inflammatory cells infiltration in the HFD which indicated the presence of severe pathology. Moreover, glomerular expand and glomerular mesangial matrix increased HFD model group rats. The obvious increment of the mesangial cell number was not detected. However, the pathological damage degree was improved with STVNa and fenofibrate treatment. Though the metabolism of uric acid in rodents is different from mammals, various studies have shown that increased serum levels of uric acid have been associated with the onset and development of chronic kidney disease.^20–22) STVNa can reduce the level of serum creatinine and uric acid obviously in this study. However, fenofibrate also can reduce the levels of uric acid and serum creatinine to some extent. Our results indicate that both STVNa and fenofibrate can exhibit an obvious protective effect against kidney injury and improve kidney function, but the effect of fenofibrate is significantly weaker than STVNa.

Previous studies have reported that the accumulation of ROS can damage the cell structure and activate the mitochondrial apoptotic pathway. Elevated pro-apoptotic protein Bax and decreased anti-apoptotic protein Bcl-2 induces apoptotic cascades.²³⁾ Excessive apoptosis has been observed in metabolic syndrome and also demonstrated in kidney injury animal models.^24,25) Therefore, inhibition of apoptosis attenuates the symptoms of kidney injury. Consistently, our results showed that the expression of Bax (pro-apoptotic protein) was remarkably upregulated while Bcl-2 (anti-apoptotic protein) was decreased in the HFD group in comparison to the normal group implying activation of apoptosis. Following, the administration of STVNa, Bax expression was inhibited while Bcl-2 expression was enhanced. Therefore, STVNa may exert anti-apoptotic effects.

Many previous studies show that metabolic disease is associated with CKD which induces an inflammatory response.^26,27) Moreover, other studies demonstrate that HFD leads to metabolic syndrome which is the major factor to cause kidney failure.²⁸⁾ Rat KW/BW in the HFD group was significantly higher in comparison to that in the normal group in this study. Conversely, the weight of rats fed on STVNa was lower than those fed on HFD, and there is no change in weigh between the fenofibrate treatment group and HFD group. The present results suggest that STVNa could prevent weight gain depending on the dose. Moreover, the periodic acid-schiff staining data reveals that the glycogen content of kidney is significantly increased after consumption of a high-fat diet, but reduced with the STVNa or fenofibrate treatment. Additionally, the PAS score in the HFD group is significantly higher than that in the normal group. By contrast, rats in the STVNa and fenofibrate groups exhibit a considerable decrease in the pathological score in comparison to the HFD group. In a word, kidney injury significantly decreases following STVNa administration. In addition, content of TG, TC, and NEFA is markedly elevated in rats fed on HFD diet relative to those fed on normal diet. Notably, STVNa treatment is able to significantly reverse this phenomenon and fenofibrate has a similar effect. The results indicates that STVNa may ameliorate metabolic syndrome and it’s renal protective function may be the consequences of whole body effects and be used to treat kidney injury induced by HFD.

IL-1β, IL-6 and TNF-α are important pro-inflammatory cytokines which play an important role in various diseases.^29,30) Therefore, this study investigated whether STVNa could improve inflammatory response induced by HFD by determining the relative expression levels of key factors (IL-1β, IL-6 and TNF-α). The mRNA levels of TNF-α and IL-1β, and IL-6 were significantly downregulated in the normal group as compared with those in the HFD group and STVNa treatment significantly decreased the expression levels of these factors. Furthermore, IL-1β、IL-6, and TNF-α have been reported to be associated with the NF-κB signaling pathway which is one of the classic inflammatory signaling pathways.^31,32) Therefore, analysis of the NF-κB and p-NF-κB expression reveal strong evidence that they were elevated in rats fed on HFD diet relative to those of the normal group and markedly reduced following STVNa administration. The present results suggest that kidney injury caused by HFD activates the NF-κB signaling pathway and STVNa treatment suppresses the expression of NF-κB. It demonstrates that STVNa effectively inhibits the inflammatory response.

In conclusion, STVNa can regulate lipid metabolism and attenuate kidney injury by decreasing inflammation and apoptosis through the NF-κB and Bax/Bcl2 signaling pathways, respectively. The current study suggests that STVNa may have therapeutic potential for metabolic syndrome associated kidney dysfunction by inhibiting inflammation, oxidative stress and apoptosis. However, the exact molecular mechanisms require further investigation.

Acknowledgments

This study was supported in part by the National Natural Science Foundation of China (31601089), the Science and Technology Planning Project of Guangzhou (No. 201904010232). The authors are grateful to Key Biopharmaceutical Co. Ltd. for supplying STV-Na. The authors thank Professor Jiming Ye (Director for Postgraduate Research Group Leader, Lipid biology and Metabolic Disease School of Health and Biomedical Sciences RMIT University, Melbourne, Victoria, Australia) for providing linguistic assistance.

Author Contributions

Ying Mei conducted the study and wrote the manuscript. Wen Tan and Xiaoou Sun designed the project. Yihe Kuai participated in histological procedure. All authors have approved the final manuscript. Therefore, all authors have full access to all the data in the study and take responsibility for the integrity and security of the data.

Conflict of Interest

The authors declare no conflict of interest.

REFERENCES

• 1) Amann K, Benz K. Structural renal changes in obesity and diabetes. Semin. Nephrol., 33, 23–33 (2013).
• 2) Maric-Bilkan C. Obesity and diabetic kidney disease. Med. Clin. North Am., 97, 59–74 (2013).
• 3) Caramori ML, Mauer M. Diabetes and nephropathy. Curr. Opin. Nephrol. Hypertens., 12, 273–282 (2003).
• 4) Solini A, Ferrannini E. Pathophysiology, prevention and management of chronic kidney disease in the hypertensive patient with diabetes mellitus. J. Clin. Hypertens., 13, 252–257 (2011).
• 5) Schieppati A, Remuzzi G. Chronic renal diseases as a public health problem: epidemiology, social, and economic implications. Kidney Int. Suppl., 68, S7–S10 (2005).
• 6) Fioretto P, Steffes MW, Sutherland DE, Goetz FC, Mauer M. Reversal of lesions of diabetic nephropathy after pancreas transplantation. N. Engl. J. Med., 339, 69–75 (1998).
• 7) Sun X, Yang Y, Xie Y, Shi X, Huang L, Tan W. Protective role of STVNa in myocardial ischemia reperfusion injury by inhibiting mitochondrial fission. Oncotarget, 9, 1898–1905 (2018).
• 8) Zhang H, Sun X, Xie Y, Zan J, Tan W. Isosteviol sodium protects against permanent cerebral ischemia injury in mice via inhibition of NF-κB–mediated inflflammatory and apoptotic responses. J. Stroke Cerebrovasc. Dis., 26, 2603–2614 (2017).
• 9) Xu S, Luo W, Xu X, Qian Y, Xu Z, Yu W, Shan X, Guan X, Lum H, Zhou H, Wang Y. MD2 blockade prevents oxLDL-induced renal epithelial cell injury and protects against high-fat-diet-induced kidney dysfunction. J. Nutr. Biochem., 70, 47–55 (2019).
• 10) Tang S, Liu X, Ye J, Hu T, Yang Y, Han T, Tan W. Isosteviol ameliorates diabetic cardiomyopathy in rats by inhibiting ERK and NF-κB signaling pathways. J. Endocrinol., 238, 47–60 (2018).
• 11) Shi X, Li D, Wang Y, Liu S, Qin J, Wang J, Ran J, Zhang Y, Huang Q, Liu X, Zhou J, Liu M. Discovery of centrosomal protein 70 as an important player in the development and progression of breast cancer. Am. J. Pathol., 187, 679–688 (2017).
• 12) Chan P, Xu DY, Liu JC, Chen Y, Tomlinson B, Huang W, Cheng J. The effect of stevioside on blood pressure and plasma catecholamines in spontaneously hypertensive rats. Life Sci., 63, 1679–1684 (1998).
• 13) Gregersen S, Jeppesen PB, Holst JJ, Hermansen K. Antihyperglycemic effects of stevioside in type 2 diabetic subjects. Metabolism, 53, 73–76 (2004).
• 14) Yang RL, Shi YH, Hao GW, Li W, Le GW. Increasing oxidative stress with progressive hyperlipidemia in human: relation between malondialdehyde and atherogenic index. J. Clin. Biochem. Nutr., 43, 154–158 (2008).
• 15) Ponce-Canchihuamán JC, Pérez-Méndez O, Hernández-Muñoz R, Torres-Durán PV, Juárez-Oropeza MA. Protective effffects of Spirulina maxima on hyperlipidemia and oxidative-stress induced by lead acetate in the liver and kidney. Lipids Health Dis., 9, 35 (2010).
• 16) Singh U, Kumar S, Dhakal S. Study of oxidative stress in hypercholesterolemia. Int. J. Con-temp. Med. Res., 4, 1204–1207 (2017).
• 17) Smathers RL, Galligan JJ, Stewart BJ, Petersen DR. Overview of lipid peroxidation products and hepatic protein modifification in alcoholic liver disease. Chem. Biol. Interact., 192, 107–112 (2011).
• 18) Terevinto A, Ramos A, Castroman G, Cabrera MC, Saadoun A. Oxidative status, in vitro iron-induced lipid oxidation and superoxide dismutase, catalase and glutathione peroxidase activities in rhea meat. Meat Sci., 84, 706–710 (2010).
• 19) Vasant RA, Narasimhacharya A. Antidotal activity of Averrhoa carambola (Star fruit) on fluoride induced toxicity in rats. Interdiscip. Toxicol., 7, 103–110 (2014).
• 20) Kanbay M, Jensen T, Solak Y, Le M, Roncal-Jimenez C, Rivard C, Lanaspa MA, Nakagawa T, Johnson RJ. Uric acid in metabolic syndrome: From an innocent bystander to a central player. Eur. J. Intern. Med., 29, 3–8 (2016).
• 21) Roumeliotis S, Roumeliotis A, Dounousi E, Eleftheriadis T, Liakopoulos V. Dietary antioxidant supplements and uric acid in chronic kidney disease: a review. Nutrients., 11, 1911 (2019).
• 22) Borghi C, Rosei EA, Bardin T, Dawson J, Dominiczak A, Kielstein JT, Manolis AJ, Perez-Ruiz F, Mancia G. Serum uric acid and the risk of cardiovascular and renal disease. J. Hypertens., 33, 1729–1741, discussion, 1741 (2015).
• 23) Liu T, Han Y, Zhou T, Zhang R, Chen H, Chen S, Zhao H. Mechanisms of ROS-induced mitochondria-dependent apoptosis underlying liquid storage of goat spermatozoa. Aging, 11, 7880–7898 (2019).
• 24) Maes ME, Schlamp CL, Nickells RW. BAX to basics: How the BCL2 gene family controls the death of retinal ganglion cells. Prog. Retin. Eye Res., 57, 1–25 (2017).
• 25) Pfeffer CM, Singh ATK. Apoptosis: a target for anticancer therapy. Int. J. Mol. Sci., 19, 448 (2018).
• 26) Aladaileh SH, Abukhalil MH, Saghir SA, Hanieh H, Alfwuaires MA, Almaiman AA, Bin-Jumah M, Mahmoud AM. Galangin activates Nrf2 signaling and attenuates oxidative damage, inflflammation, and apoptosis in a rat model of cyclophosphamide-induced hepatotoxicity. Biomolecules, 9, 346 (2019).
• 27) Schwingshackl L, Hoffmann G. Comparison of effects of long-term low-fat vs. high-fat diets on blood lipid levels in overweight or obese patients: a systematic review and meta-analysis. J. Acad. Nutr. Diet., 113, 1640–1661 (2013).
• 28) Chen H, Fu Y, Jiang X, Li D, Qin W, Zhang Q, Lin D, Liu Y, Tan C, Huang Z, Liu Y, Chen D. Arabinoxylan activates lipid catabolism and alleviates liver damage in rats induced by high-fat diet. J. Sci. Food Agric., 98, 253–260 (2018).
• 29) Opal SM, DePalo VA. Anti-inflammatory cytokines. Chest, 117, 1162–1172 (2000).
• 30) Singh S, Facciorusso A, Singh AG, Vande Casteele N, Zarrinpar A, Prokop LJ, Grunvald EL, Curtis JR, Sandborn WJ. Singh AG4. Obesity and response to anti-tumor necrosis factor-α agents in patients with select immune-mediated inflammatory diseases: a systematic review and meta-analysis. PLOS ONE, 13, e0195123 (2018).
• 31) Nennig SE, Schank JR. The role of NFkB in drug addiction: beyond inflammation. Alcohol Alcohol., 52, 172–179 (2017).
• 32) Rosette C, Agan FJ, Rosette N, Moro L, Mazzetti A, Hassan C, Gerloni M. Rifamycin SV exhibits strong anti-inflammatory in vitro activity through pregnane X receptor stimulation and NFκB inhibition. Drug Metab. Pharmacokinet., 34, 172–180 (2019).