TP0463518 (TS-143) Ameliorates Peptidoglycan-Polysaccharide Induced Anemia of Inflammation in Rats

Abstract

TP0463518 (TS-143) is a competitive prolyl hydroxylase 1/2/3 pan-inhibitor, and has been shown to specifically stabilize hypoxia-inducible factor-2 alpha in the liver to increase erythropoietin production. While TP0463518 has been shown to improve renal anemia, its effect on anemia of inflammation is still unknown. In this study, we created a rat model of anemia of inflammation by administering peptidoglycan-polysaccharide (PG-PS) to Lewis rats; the PG-PS-treated rats developed anemia within 2 weeks after the PG-PS challenge. The hematopoietic effects of oral TP0463518 administration at 10 mg/kg once daily for 6 weeks were examined in this rat model. The hematocrit values in the TP0463518-treated group increased significantly from 32.8 ± 0.8 to 44.5 ± 2.1% after the treatment, which was comparable to that in the healthy control group. The change of the mean corpuscular volume following TP0463518 treatment was similar to that in the healthy control group up to week 4, and significantly higher than that in the vehicle-treated group. TP0463518 increased divalent metal transporter 1 and duodenal cytochrome b expressions in the intestine. Conversely, TP0465318 did not exert any effects on the expressions of genes involved in iron metabolism in the liver, even though TP0463518 dramatically increased erythropoietin expression. Furthermore, TP0463518 had no effect on the expressions of inflammation markers in the liver. These results suggest that TP0463518 increased iron absorption and improved anemia of inflammation without exacerbating liver inflammation. TP0463518 appears to have an acceptable safety profile and could become a useful new therapeutic option for anemia of inflammation.

INTRODUCTION

Iron deficiency anemia can occur as a result of absolute iron deficiency or functional iron deficiency.¹⁾ In absolute iron deficiency, the total amount of iron in the body is decreased as a result of bleeding, malabsorption of iron, etc. Absolute iron deficiency is treated by intravenous or oral iron supplementation. In contrast, the total amount of iron in the body is sufficient in functional iron deficiency, but the iron is not appropriately distributed. Functional iron deficiency is closely associated with chronic inflammation, because interleukin-1β (IL-1β) and interleukin-6 (IL-6) induce hepcidin, a master regulator of iron metabolism.²⁾ Hepcidin internalizes ferroportin,^3,4) which exports intracellular iron to the outside, reducing iron uptake by the intestine and inhibiting transfer of iron from the liver into the blood. As a result, chronic inflammation is associated with low levels of iron in the blood and excess iron stores in the liver. As the erythropoietin (EPO)-producing capacity of the kidney is intact, conventional erythropoiesis-stimulating agents are ineffective for treating anemia of inflammation, and iron supplementation is associated with the risk of further iron accumulation in the liver; therefore, new therapeutic agents are needed for the treatment of functional iron deficiency.

Hypoxia-inducible factor-2 alpha (HIF-2α) regulates iron metabolism. The expression level of HIF-2α is tightly controlled by prolyl hydroxylase (PHD). Under normoxic conditions, the proline residues in HIF-2α are hydroxylated by PHD, and hydroxylated HIF-2α is degraded through the ubiquitin-proteasome pathway.^5,6) When PHD is inhibited by the depletion of oxygen, HIF-2α escapes hydroxylation and subsequent degradation, and stabilized HIF-2α binds to the hypoxia response element to directly upregulate the genes involved in iron uptake by the intestine (e.g., divalent metal transporter 1 (DMT-1) and duodenal cytochrome b (dCYTb).^7,8) HIF-2α also indirectly downregulates hepcidin expression via induction of cyclin and EPO expressions.^9–12) The role of HIF-2α in maintaining iron homeostasis is supported by the results of studies of PHD-knockout animals and clinical trials of PHD inhibitors, which have demonstrated a decrease in hepcidin levels, increase of gene expressions involved in iron uptake, and an improvement of the serum ferritin levels.^13–19) Therefore, PHD inhibitors are among the therapeutic candidates for the treatment of functional iron deficiency.

TP0463518 (also known as TS-143) is a competitive PHD 1/2/3 pan-inhibitor, and has been shown, in both rats and humans, to specifically stabilize HIF-2α in the liver, to increase EPO production.^20–22) While TP0463518 has been shown to improve renal anemia in 5/6 nephrectomized rats,²²⁾ its effect on functional iron deficiency anemia is still unknown. Therefore, in this study, we examined the effect of TP0463518 on functional iron deficiency anemia associated with inflammation in peptidoglycan-polysaccharide (PG-PS)-treated rats. Our findings showed that TP0463518 ameliorated the anemia through upregulation of the genes involved in iron uptake in the intestine, without aggravating liver inflammation. These findings suggest that TP0463518 can potentially ameliorate anemia of chronic inflammation.

MATERIALS AND METHODS

Reagents

2-[[1-[[6-(4-Chlorophenoxy)pyridin-3-yl]methyl]-4-hydroxy-6-oxo-2,3-dihydropyridine-5-carbonyl]amino]acetic acid (TP0463518, Fig. 1) was synthesized at Taisho Pharmaceutical Co., Ltd., according to a previously described method.²³⁾ PG-PS was purchased from Becton, Dickinson and Company.

Fig. 1. Chemical Structure of TP0463518

Animal Experiment Protocols

All animal experiment protocols were approved by the Animal Committee of Taisho Pharmaceutical Co., Ltd., and all the animal experiments were conducted with the approval of the committee. The animals were reared in cages maintained at a room temperature and humidity level of 23 ± 3 °C and 50 ± 20%, respectively, under a light–dark cycle of 12–12 h. Food and water were made freely available to the animals.

Eight-week-old female Lewis rats (Charles River Laboratories Japan) were divided randomly into two groups: the healthy control group and the anemia group. The anemia group received an intraperitoneal injection of PG-PS at the dose of 15 mg/kg to cause anemia, and the healthy control group received the same volume of saline. When the rats became 10 weeks old, the anemic rats were randomly assigned to two groups: the vehicle-treated group and the TP0463518-treated group, while ensuring that the variance and mean hemoglobin levels remained balanced between the groups. The healthy control group and vehicle-treated group received oral administration of 0.5% methylcellulose, and the TP0463518-treated group received oral administration of 10 mg/kg of TP0463518 once daily for 6 weeks. Blood samples were collected from the tail vein every week into tubes containing ethylenediaminetetraacetic acid (EDTA), and the reticulocyte counts, hematocrit values, hemoglobin levels, red blood cell counts, and mean corpuscular volume (MCV) in the samples were measured using ADVIA 2120i (Siemens Healthcare Diagnostics, Tokyo, Japan). At week 6, the rats were anesthetized with isoflurane and blood samples were collected from the abdominal vein. While a part of each blood sample was mixed into an aliquot containing EDTA, the remaining part was left to stand at room temperature to allow clot formation. The blood samples were then centrifuged (2130 × g, 10 min, 4 °C or room temperature) to obtain the plasma and serum samples. Then, the rats were euthanized by exsanguination and the liver and duodenum were removed. Small pieces of the organs were immersed in RNAlater solution overnight at 4 °C, then stored at -80 °C until the mRNA extraction.

Determination of the Plasma Iron and Transferrin Saturation (TSAT)

The plasma iron levels and unsaturated iron binding capacity (UIBC) were measured in a HITACHI 7180 automatic biochemical analyzer. The total iron binding capacity (TIBC) was calculated as the sum of the plasma iron concentration and the UIBC. TSAT was calculated as the ratio of the plasma iron concentration to the TIBC.

Measurement of mRNA

The pieces of liver and duodenum were homogenized using Tissue Lyser (Qiagen, Venlo, Netherlands) and mRNAs were extracted using the RNeasy Plus Mini Kit (Qiagen), in accordance with the instructions in the manufacturer’s manual. The samples were reverse-transcribed using the High Capacity RNA-to-cDNA kit (Thermo Fisher Scientific, Waltham, MA, U.S.A.). The mRNA levels were determined using Fast SYBR Green PCR Master Mix and the ABI 7500 Fast Real-Time PCR System (Thermo Fisher Scientific). The primer sequences are listed in Table 1. The PCR conditions were as follows: 95 °C for 20 s, followed by 40 cycles of 95 °C for 3 s and 60 °C for 30 s. The expression level of each target gene was normalized by that of an internal standard gene (hypoxanthine-guanine phosphoribosyltransferase (HPRT)). The relative expression levels of the relevant mRNAs in the liver and duodenum were calculated as the ratios to those in the healthy control group.

Table 1. Primer Sequences

	Gene		Sequence (5′ to 3′)
Rat	HPRT	F	TTGTTGGATATGCCCTTGACT
		R	CCGCTGTCTTTTAGGCTTTG
	dCYTb	F	TCTGGACTCCTCCTCTTTGG
		R	TCTGGTGGGAATGAATGGT
	DMT1	F	GCTGAGCGAAGATACCAGCG
		R	TGTGCAACGGCACATACTTG
	ferroportin	F	TTGCAGGAGTCATTGCTGCTA
		R	TGGAGTTCTGCACACCATTGAT
	hepcidin	F	GAAGGCAAGATGGCACTAAGCA
		R	TCTCGTCTGTTGCCGGAGATAG
	MCP-1	F	AGCATCCACGTGCTGTCTC
		R	GATCATCTTGCCAGTGAATGAG
	IL-1β	F	TGTGATGAAAGACGGCACAC
		R	CTTCTTCTTTGGGTATTGTTTGG
	TNFα	F	TCAGTTCCATGGCCCAGAC
		R	GTTGTCTTTGAGATCCATGCCATT
	TGFβ	F	GCTGAACCAAGGAGACGGAATA
		R	ACCTCGACGTTTGGGACTGA
	EPO	F	ACCAGAGAGTCTTCAGCTTCA
		R	GAGGCGACATCAATTCCTTC

Western Blotting

The duodenal tissue samples were homogenized in radioimmunoprecipitation assay buffer containing a protease inhibitor cocktail, and the homogenates were sonicated for 20 s and left to stand on ice for 30 min. The homogenates were then centrifuged (14500 × g, 15 min, 4 °C) and the supernatants collected. The protein concentrations in the supernatants were measured using the bicinchoninic acid method. The supernatants were mixed with sample buffer and incubated for 5 min at 95 °C. Then, 40 µg of protein was separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and blotted on to polyvinylidene difluoride membranes. The membranes were blocked with 5% skim milk and incubated with the primary antibodies (anti-DMT1 antibody from Cell Signaling Technology, Danvers, MA, U.S.A., and anti-dCYTb and anti-vinculin antibodies from Abcam, Cambridge, U.K.) overnight at 4 °C, followed by incubation with the secondary antibody conjugated with horseradish peroxidase (Abcam) for 1 h at room temperature. The membranes were visualized and quantified using an enhanced-chemiluminescence (Cytiva, Marlborough, MA, U.S.A.) and FUSION imaging system (Vilber-Lourmat, Marne-la-Vallée, France).

Enzyme-Linked Immunosorbent Assay (ELISA)

The tumor necrosis factor α (TNFα) and IL-6 levels in the liver were measured according to a previously reported method, with slight modification.²⁴⁾ The liver tissue specimens were homogenized in 5 volumes of Tris-buffered saline containing 5 mM EDTA, 1% Triton X100, and a protease inhibitor cocktail. The homogenates were centrifuged at 11000 × g for 5 min at 4 °C, and the TNFα and IL-6 levels in the supernatants were measured using ELISA kits (R&D Systems, Minneapolis, MN, U.S.A.).

Plasma ferritin levels were measured using the Rat ferritin ELISA kit (Kamiya Biomedical Company, Seattle, WA, U.S.A.), and the serum EPO and hepcidin levels were measured using the rat EPO and hepcidin ELISA kits (BioLegend, San Diego, CA, U.S.A. and Novus Biologicals, Centennial, CO, U.S.A.), respectively, in accordance with the instructions in the respective manufacturers’ manuals.

Statistics

Data shown are the means ± standard errors of the mean (S.E.M.). As the mRNA expression levels increased exponentially, the means and S.E.M. were calculated after logarithmic transformation of the mRNA expression levels. The statistical significances of differences were determined by two-way repeated measures ANOVA for time-course studies or Student’s t-test for comparisons between two groups, using SAS 9.2. Statistical significance was defined as p < 0.05.

RESULTS

Effects of TP0463518 on Anemia of Inflammation

To examine whether TP0463518 ameliorates anemia of inflammation, the hematopoietic effects of TP0463518 were examined, as illustrated in Fig. 2A. There were no significant differences in the body weight measured after TP0463518 treatment among the groups (Fig. 2B). The hematocrit values, hemoglobin levels and red blood cell counts in the PG-PS-treated group at 2 weeks after PG-PS administration were significantly lower than those in the healthy control group, indicating that the PG-PS-treated rats had developed anemia (Figs. 2D–F). Then, the PG-PS-treated rats were divided into vehicle-treated and TP0463518-treated groups. The reticulocyte count in the vehicle-treated group increased transiently, to reach the peak at week 2, and then returned to a level similar to that in the healthy control group by week 6. The reticulocyte count in the TP0463518-treated group, on the other hand, increased significantly as compared to that in the vehicle-treated group (Fig. 2C). The hematocrit value in the TP0463518-treated group increased significantly from 32.8 ± 0.8% prior to TP063518 treatment to 44.5 ± 2.1% after 6 weeks of treatment, which was comparable to the hematocrit value in the healthy control group (Fig. 2D). The hemoglobin levels and red blood cell counts in the TP0463518-treated group were higher than those in the vehicle-treated group throughout the experimental period, although the differences were not statistically significant (Figs. 2E, F). At the end of the study, there was no statistically significant difference in the serum EPO concentration between the healthy control group and the vehicle-treated group (10.8 ± 2.1 vs. 33.8 ± 15.1 pg/mL). However, TP0463518 treatment significantly increased the serum EPO concentration (117.9 ± 14.4 pg/mL, p < 0.01).

Fig. 2. A Scheme of the Experiments (A) and Effects of TP0463518 on the (B) Body Weight, (C) Reticulocyte Count, (D) Hematocrit, (E) Hemoglobin, (F) Red Blood Cell Count, and (G) ΔMCV in the PG-PS Rats

Diamonds, healthy rats; open circles, vehicle-treated PG-PS rats; filled circles, 10 mg/kg of TP0463518-treated PG-PS rats. Data are presented as the mean values ± S.E.M. n = 5–6. Two-way repeated measures ANOVA was performed. ^## p < 0.01 and ^### p < 0.001 as compared to the corresponding time-courses in the healthy control rats; * p < 0.05 and ** p < 0.01 as compared to the corresponding time-courses in the vehicle-treated PG-PS rats.

As the baseline MCV was not balanced among the groups, the baseline MCV in each rat was subtracted from the MCV at every time point and the values were analyzed as ΔMCV. The ΔMCV was significantly lower in the vehicle-treated group as compared to the healthy control group. On the other hand, the ΔMCV in the TP0463518-treated group was similar to that in the healthy control group up to week 4 and significantly higher than that in the vehicle-treated group (Fig. 2G). Change in mean corpuscular hemoglobin from the baseline (ΔMCH) was also significantly lower in the vehicle-treated group as compared to the healthy control group. The ΔMCH in the TP0463518-treated group was higher than that in the vehicle-treated group up to week 4, but the difference was not statistically significant (data not shown).

Measurement of Iron-Related Parameters

As the ΔMCV in the TP0463518-treated group was higher than that in the vehicle-treated group, we also analyzed the changes in the iron-related parameters at the end of the study. PG-PS treatment reduced the plasma iron levels and TSAT (Figs. 3A, B), and increased the plasma ferritin levels (Fig. 3C). However, TP0463518 treatment of the PG-PS-treated rats for 6 weeks had no significant effects on the plasma iron levels, TSAT, or plasma ferritin levels.

Fig. 3. Effects of TP0463518 on the (A) Plasma Iron, (B) TSAT, and (C) Plasma Ferritin in the PG-PS Rats

Data are presented as the mean values ± S.E.M. n = 5–6. Student’s t-test was performed. ^# p < 0.05 and ^### p < 0.001 as compared with the corresponding values in the healthy control rats.

Effects of TP0463518 on the Expressions of Genes Involved in Iron Metabolism

To investigate the effects of TP0463518 on iron metabolism, we analyzed the expression levels of iron metabolism-related genes. The mRNA and protein levels of dCYTb in the duodenum were lower in the vehicle-treated group than in the healthy control group (Figs. 4A, D). On the other hand, the dCYTb mRNA/protein expression levels were significantly increased in the TP0463518-treated group. The mRNA expression level of DMT1 in the duodenum was lower in the vehicle-treated group than in the healthy control group, and significantly increased in the TP0463518-treated group (Fig. 4B). This trend was also observed for the DMT1 protein level (Fig. 4E). The mRNA expression levels of ferroportin in the duodenum were significantly lower in the vehicle-treated group than in the healthy control group, however, the expression levels of ferroportin were not increased in the TP0463518-treated group either (Fig. 4C).

Fig. 4. Effects of TP0463518 on the Expression Levels of Genes Involved in Iron Metabolism in the Duodenum and the Liver

The mRNA expression levels of (A) dCYTb, (B) DMT1, and (C) ferroportin, and the protein expression levels of (D) dCYTb and (E) DMT1 were analyzed in the duodenum. (F) Serum hepcidin concentration. The mRNA expression levels of (G) DMT1, (H) ferroportin, and (I) hepcidin were analyzed in the liver. Data are presented as the mean values ± S.E.M. n = 5–6. Student’s t-test was performed. ^# p < 0.05, ^## p < 0.01 and ^### p < 0.001 as compared with the corresponding values in the healthy control rats. * p < 0.05, ** p < 0.01 and *** p < 0.001 as compared with the corresponding values in the vehicle-treated PG-PS rats.

Unlike the case in the duodenum, the DMT1 mRNA expression levels in the liver were higher in the vehicle-treated group than in the healthy control group, and the TP0463518-treated group showed no change of the DMT1 mRNA expression level in the liver either (Fig. 4G). Neither PG-PS treatment nor TP0463518 exerted any effects on the mRNA expression levels of hepcidin and ferroportin (Figs. 4H, I). The serum hepcidin concentration also remained unchanged in all the groups (Fig. 4F).

Effects of TP0463518 on the Expression Levels of Genes Involved in Inflammation

As PG-PS induces inflammation in the liver, we investigated the expression levels of genes involved in inflammation at the end of the study. The mRNA expression levels of monocyte chemoattractant protein-1 (MCP-1), IL-1β, TNFα, and transforming growth factor β (TGFβ) in the liver were higher in the vehicle-treated group than in the healthy control group (Figs. 5A–D). No changes in the mRNA expression levels of MCP-1, IL-1β, TNFα and TGFβ in the liver were observed in the TP0463518-treated group. The protein levels of TNFα and IL-6 were also increased in the liver of the vehicle-treated group (Figs. 5E, F). TP0463518 treatment had no effect on the expression levels of TNFα and IL-6.

Fig. 5. Effects of TP0463518 on the (A) MCP-1, (B) IL-1β, (C) TNFα, and (D) TGFβ Gene Expressions, and on the (E) TNFα and (F) IL-6 Protein Levels in the Liver

Data are presented as the mean values ± S.E.M. n = 5–6. Student’s t-test was performed. ^## p < 0.01 and ^### p < 0.001 as compared with the corresponding values in the healthy control rats.

Effect of TP0463518 on the Expression Level of EPO

TP0463518 treatment had no effects on the expression levels of either genes involved in iron metabolism or those involved in inflammation in the liver in this study, whereas in a previous study, we showed that TP0463518 induced EPO expression in the liver.²²⁾ Therefore, to examine the effect of TP0463518 treatment on the expression of EPO in the liver, we examined the EPO mRNA expression level in the liver. PG-PS treatment significantly increased the EPO mRNA expression in the liver as compared to the level in the healthy control rats (Fig. 6). TP0463518 treatment further increased the EPO mRNA expression in the liver.

Fig. 6. Effect of TP0463518 on the EPO Expression in the Liver

Data are presented as the mean values ± S.E.M. n = 5–6. Student’s t-test was performed. ^## p < 0.01 as compared with the corresponding value in the healthy control rats. ** p < 0.01 as compared with the corresponding value in the vehicle-treated PG-PS rats.

DISCUSSION

We previously reported that TP0463518, a competitive PHD 1/2/3 pan-inhibitor, induced EPO expression specifically in the liver and improved anemia in 5/6 nephrectomized rats.²²⁾ In this study, we investigated whether TP0463518 improved the anemia of inflammation induced by PG-PS in Lewis rats. Two weeks after the PG-PS challenge, the rats developed severe anemia, with an increase of the reticulocyte count, consistent with previous reports.^25,26) Administration of TP0463518 further increased the reticulocyte count, possibly via inducing EPO production, and also improved the hematocrit values, which became comparable to those in the healthy control group. The ΔMCV was markedly reduced by the PG-PS treatment, whereas the ΔMCV in the TP0463518-treated group was higher than that in the vehicle-treated group throughout the experimental period, indicating that more iron was utilized for erythropoiesis in this group. These results were consistent with a previous report that PHD inhibitors improved PG-PS-induced anemia.^13,27) We further investigated the effects of TP0463518 on the iron metabolism in the liver and intestine. While PG-PS treatment reduced the plasma iron levels and TSAT values, TP0465318 treatment had no effect on these parameters. PG-PS treatment increased the plasma ferritin concentration, possibly via inducing DMT1 expression in the liver. TP0465318 treatment had no effects on the serum ferritin levels or expressions levels of genes involved in iron metabolism in the liver, even though TP0463518 dramatically increased the EPO expression in the liver. On the other hand, in the intestine, TP0463518 treatment increased the expression levels of dCYTb and DMT1. The promoter region of DMT1 and dCYTb contain hypoxia response elements to which HIF-2α, but not HIF-1α, binds directly.²⁸⁾ Intestine-specific deletion of HIF-2α decreased the DMT1 and dCYTb expressions.^7,8) In contrast, intestine-specific von Hippel-Lindau-knockout mice showed protection against HIF-2α degradation and increased DMT1 and dCYTb gene expressions.²⁸⁾ These previous studies clearly demonstrate that HIF-2α directly regulates the gene expressions of DMT1 and dCYTb. Intestine-specific DMT1-knockout mice have been reported to show severe iron deficiency.²⁹⁾ dCYTb is a ferric reductase expressed only in the duodenal mucosa. Deletion of dCYTb decreased the reticulocyte hemoglobin level.³⁰⁾ These results indicate that DMT1 and dCYTb are key players in the absorption of iron. Therefore, since TP0463518 is a PHD inhibitor, TP0463518 may increase DMT1 and dCYTb expressions via stabilizing HIF-2α, and consequently, increase iron uptake by the intestine.

Proinflammatory cytokines, especially IL-6, are known to upregulate hepcidin expression via the Janus kinase/signal transducer and activator of transcription 3 pathway.³¹⁾ Increased hepcidin not only suppresses ferroportin mRNA expression, but also facilitates internalization of ferroportin.^3,32) Schwartz et al. reported that intestine-specific ferroportin conditional-knockout mice showed increased iron retention in the enterocytes.³³⁾ This mouse model showed decreased expression of HIF-2α and its target genes (e.g., DMT1 and dCYTb) in the intestine via activation of PHD, which requires iron as a substrate. Based on the above, inflammation is considered to cause anemia by downregulating the genes related to iron absorption via the hepatic hepcidin-intestinal ferroportin/HIF-2α axis. In the current study, while hepatic IL-6 expression was increased in the PG-PS-treated rats, the expression of hepcidin was not. Our result is consistent with a previous report of the absence of any significant increase of the hepcidin mRNA levels at eight weeks after PG-PS administration.¹³⁾ In addition, it has been reported that the serum hepcidin concentration increases up to 2 weeks after PG-PS administration, to start decreasing thereafter.³⁴⁾ Interestingly, Schwartz et al. also found that iron deficiency suppressed liver hepcidin expression.³³⁾ Therefore, it is possible that iron deficiency attenuated the induction of hepcidin expression by IL-6 in our eight-week experiment, as in the study reported by Schwartz et al.

Roxadustat, daprodustat, vadadustat, and enarodustat are approved drugs for the treatment of anemia in Japan, and molidustat is now under regulatory review.³⁵⁾ Among the clinical trials, although no studies have yet recruited patients with anemia of inflammation, decrease of hepcidin and ferritin concentrations is widely observed in patients with renal anemia.^16–19) Roxadustat reportedly increased the hemoglobin concentration regardless of the serum C-reactive protein levels in the patients, implying that PHD inhibitors are effective in patients with anemia of inflammation.^36,37) TP0463518 ameliorated anemia of inflammation, associated with an increase in the expressions of the genes involved in iron uptake in the intestine. The effect of TP0463518 in patients with anemia of inflammation is expected to be investigated in the future.

Genetic suppression of all of PHD 1/2/3 in the liver has been reported to be associated with severe hepatotoxicity.^38,39) Although TP0463518 did not induce hepatotoxicity in our previous studies performed using healthy and 5/6 nephrectomized rats,^20,22) it is possible that rats with liver inflammation may be more susceptible to the potential adverse effects of PHD 1/2/3 pan-inhibitors on the liver. Therefore, we investigated whether the administration of TP0463518 affected the severity of inflammation in the liver. Consistent with previous findings, PG-PS treatment increased the expression levels of all the inflammation marker genes.^13,40) However, pharmacological suppression of PHD 1/2/3 by TP0463518 was not associated with any effects on the expression levels of the inflammation marker genes. As shown by Taniguchi et al., hepatotoxicity was not observed in association with suppression of a single or a combination of 2 PHD isoforms.³⁹⁾ TP0463518 at the 10 mg/kg was considered to partially inhibit PHD in the liver, as TP0463518 increased the HIF-2α level and EPO mRNA expression in the liver in a dose-dependent manner from 5 to 40 mg/kg in our previous study.²²⁾ In addition, PHD 1/2/3 activity in the liver was considered to be intact at the trough level, as evidenced by the fact that the increased HIF-2α expression recovered within 24 h of the administration of TP0463518.²²⁾ Taking these results into account, we would like to suggest that although TP0463518 is a PHD 1/2/3 pan-inhibitor, TP0463518 does not completely inhibit PHD 1/2/3, so that the risk of hepatotoxicity of this compound is very limited.

In summary, TP0463518 increased the expression levels of genes involved in iron uptake in the intestine, and ameliorated anemia of inflammation. TP0463518 did not aggravate inflammation in the liver. These results suggest that TP0463518 has an acceptable safety profile and may be promising as a new therapeutic option for anemia of inflammation.

Acknowledgments

The authors thank Ms. Fusayo Io and Ms. Aya Izaki for their technical supports.

Conflict of Interest

The authors are employees of Taisho Pharmaceutical Co., Ltd., and the company provided financial support for this work.

REFERENCES

• 1) Lopez A, Cacoub P, Macdougall IC, Peyrin-Biroulet L. Iron deficiency anaemia. Lancet, 387, 907–916 (2016).
• 2) Lee P, Peng H, Gelbart T, Wang L, Beutler E. Regulation of hepcidin transcription by interleukin-1 and interleukin-6. Proc. Natl. Acad. Sci. U.S.A., 102, 1906–1910 (2005).
• 3) Nemeth E, Tuttle MS, Powelson J, Vaughn MB, Donovan A, Ward DM, Ganz T, Kaplan J. Hepcidin regulates cellular iron efflux by binding to ferroportin and inducing its internalization. Science, 306, 2090–2093 (2004).
• 4) Ramey G, Deschemin JC, Durel B, Canonne-Hergaux F, Nicolas G, Vaulont S. Hepcidin targets ferroportin for degradation in hepatocytes. Haematologica, 95, 501–504 (2010).
• 5) Jaakkola P, Mole DR, Tian YM, Wilson MI, Gielbert J, Gaskell SJ, von Kriegsheim A, Hebestreit HF, Mukherji M, Schofield CJ, Maxwell PH, Pugh CW, Ratcliffe PJ. Targeting of HIF-alpha to the von Hippel-Lindau ubiquitylation complex by O²⁻regulated prolyl hydroxylation. Science, 292, 468–472 (2001).
• 6) Maxwell PH, Wiesener MS, Chang GW, Clifford SC, Vaux EC, Cockman ME, Wykoff CC, Pugh CW, Maher ER, Ratcliffe PJ. The tumour suppressor protein VHL targets hypoxia-inducible factors for oxygen-dependent proteolysis. Nature, 399, 271–275 (1999).
• 7) Mastrogiannaki M, Matak P, Keith B, Simon MC, Vaulont S, Peyssonnaux C. HIF-2alpha, but not HIF-1alpha, promotes iron absorption in mice. J. Clin. Invest., 119, 1159–1166 (2009).
• 8) Anderson ER, Xue X, Shah YM. Intestinal hypoxia-inducible factor-2alpha (HIF-2alpha) is critical for efficient erythropoiesis. J. Biol. Chem., 286, 19533–19540 (2011).
• 9) Anderson ER, Taylor M, Xue X, Martin A, Moons DS, Omary MB, Shah YM. The hypoxia-inducible factor-C/EBPα axis controls ethanol-mediated hepcidin repression. Mol. Cell. Biol., 32, 4068–4077 (2012).
• 10) Pinto JP, Ribeiro S, Pontes H, Thowfeequ S, Tosh D, Carvalho F, Porto G. Erythropoietin mediates hepcidin expression in hepatocytes through EPOR signaling and regulation of C/EBPalpha. Blood, 111, 5727–5733 (2008).
• 11) Liu Q, Davidoff O, Niss K, Haase VH. Hypoxia-inducible factor regulates hepcidin via erythropoietin-induced erythropoiesis. J. Clin. Invest., 122, 4635–4644 (2012).
• 12) Mastrogiannaki M, Matak P, Mathieu JR, Delga S, Mayeux P, Vaulont S, Peyssonnaux C. Hepatic hypoxia-inducible factor-2 down-regulates hepcidin expression in mice through an erythropoietin-mediated increase in erythropoiesis. Haematologica, 97, 827–834 (2012).
• 13) Flamme I, Oehme F, Ellinghaus P, Jeske M, Keldenich J, Thuss U. Mimicking hypoxia to treat anemia: HIF-stabilizer BAY 85-3934 (Molidustat) stimulates erythropoietin production without hypertensive effects. PLOS ONE, 9, e111838 (2014).
• 14) Brigandi RA, Johnson B, Oei C, et al. A novel hypoxia-inducible factor-prolyl hydroxylase inhibitor (GSK1278863) for anemia in CKD: a 28-day, phase 2a randomized trial. Am. J. Kidney Dis., 67, 861–871 (2016).
• 15) Martin ER, Smith MT, Maroni BJ, Zuraw QC, deGoma EM. Clinical trial of vadadustat in patients with anemia secondary to stage 3 or 4 Chronic Kidney Disease. Am. J. Nephrol., 45, 380–388 (2017).
• 16) Chen N, Hao C, Peng X, et al. Roxadustat for anemia in patients with kidney disease not receiving dialysis. N. Engl. J. Med., 381, 1001–1010 (2019).
• 17) Chen N, Hao C, Liu BC, et al. Roxadustat Treatment for Anemia in Patients Undergoing Long-Term Dialysis. N. Engl. J. Med., 381, 1011–1022 (2019).
• 18) Akizawa T, Macdougall IC, Berns JS, Yamamoto H, Taguchi M, Iekushi K, Bernhardt T. Iron regulation by molidustat, a daily oral hypoxia-inducible factor prolyl hydroxylase inhibitor, in patients with chronic kidney disease. Nephron, 143, 243–254 (2019).
• 19) Akizawa T, Nangaku M, Yamaguchi T, Arai M, Koretomo R, Matsui A, Hirakata H. A placebo-controlled, randomized trial of enarodustat in patients with chronic kidney disease followed by long-term trial. Am. J. Nephrol., 49, 165–174 (2019).
• 20) Kato S, Takayama N, Takano H, Koretsune H, Koizumi C, Kunioka EI, Uchida S, Takahashi T, Yamamoto K. TP0463518, a novel inhibitor for hypoxia-inducible factor prolyl hydroxylases, increases erythropoietin in rodents and monkeys with a good pharmacokinetics-pharmacodynamics correlation. Eur. J. Pharmacol., 838, 138–144 (2018).
• 21) Shinfuku A, Shimazaki T, Fujiwara M, Sato F, Watase H, Numazaki T, Kawakita Y, Mutoh M, Yamasaki H, Takayama N, Kato S, Sugimoto T, Maruyama J. Novel compound induces erythropoietin secretion through liver effects in chronic kidney disease patients and healthy volunteers. Am. J. Nephrol., 48, 157–164 (2018).
• 22) Kato S, Ochiai N, Takano H, Io F, Takayama N, Koretsune H, Kunioka EI, Uchida S, Yamamoto K. TP0463518, a Novel Prolyl Hydroxylase Inhibitor, Specifically Induces Erythropoietin Production in the Liver. J. Pharmacol. Exp. Ther., 371, 675–683 (2019).
• 23) Hamada M, Takayama T, Shibata T, Hiratate A, Takahashi M, Yashiro M, Takayama N, Okumura-Kitajima L, Koretsune H, Kajiyama H, Naruse T, Kato S, Takano H, Kakinuma H. Discovery of novel 2-[(4-hydroxy-6-oxo-2,3-dihydro-1H-pyridine-5-carbonyl)amino]acetic acid derivatives as HIF prolyl hydroxylase inhibitors for treatment of renal anemia. Bioorg. Med. Chem. Lett., 28, 1725–1730 (2018).
• 24) Kato S, Takahashi T, Miyata N, Roman RJ. DMOG, a prolyl hydroxylase inhibitor, increases hemoglobin levels without exacerbating hypertension and renal injury in salt-sensitive hypertensive rats. J. Pharmacol. Exp. Ther., 372, 166–174 (2020).
• 25) Sartor RB, Anderle SK, Rifai N, Goo DA, Cromartie WJ, Schwab JH. Protracted anemia associated with chronic, relapsing systemic inflammation induced by arthropathic peptidoglycan-polysaccharide polymers in rats. Infect. Immun., 57, 1177–1185 (1989).
• 26) Coccia MA, Cooke K, Stoney G, Pistillo J, Del Castillo J, Duryea D, Tarpley JE, Molineux G. Novel erythropoiesis stimulating protein (darbepoetin alfa) alleviates anemia associated with chronic inflammatory disease in a rodent model. Exp. Hematol., 29, 1201–1209 (2001).
• 27) Barrett TD, Palomino HL, Brondstetter TI, Kanelakis KC, Wu X, Haug PV, Yan W, Young A, Hua H, Hart JC, Tran DT, Venkatesan H, Rosen MD, Peltier HM, Sepassi K, Rizzolio MC, Bembenek SD, Mirzadegan T, Rabinowitz MH, Shankley NP. Pharmacological characterization of 1-(5-chloro-6-(trifluoromethoxy)-1H-benzoimidazol-2-yl)-1H-pyrazole-4-carboxylic acid (JNJ-42041935), a potent and selective hypoxia-inducible factor prolyl hydroxylase inhibitor. Mol. Pharmacol., 79, 910–920 (2011).
• 28) Shah YM, Matsubara T, Ito S, Yim SH, Gonzalez FJ. Intestinal hypoxia-inducible transcription factors are essential for iron absorption following iron deficiency. Cell Metab., 9, 152–164 (2009).
• 29) Gunshin H, Fujiwara Y, Custodio AO, Direnzo C, Robine S, Andrews NC. Slc11a2 is required for intestinal iron absorption and erythropoiesis but dispensable in placenta and liver. J. Clin. Invest., 115, 1258–1266 (2005).
• 30) Choi J, Masaratana P, Latunde-Dada GO, Arno M, Simpson RJ, McKie AT. Duodenal reductase activity and spleen iron stores are reduced and erythropoiesis is abnormal in Dcytb knockout mice exposed to hypoxic conditions. J. Nutr., 142, 1929–1934 (2012).
• 31) Wang CY, Babitt JL. Hepcidin regulation in the anemia of inflammation. Curr. Opin. Hematol., 23, 189–197 (2016).
• 32) Yeh KY, Yeh M, Glass J. Hepcidin regulation of ferroportin 1 expression in the liver and intestine of the rat. Am. J. Physiol. Gastrointest. Liver Physiol., 286, G385–G394 (2004).
• 33) Schwartz AJ, Das NK, Ramakrishnan SK, Jain C, Jurkovic MT, Wu J, Nemeth E, Lakhal-Littleton S, Colacino JA, Shah YM. Hepatic hepcidin/intestinal HIF-2α axis maintains iron absorption during iron deficiency and overload. J. Clin. Invest., 129, 336–348 (2019).
• 34) Asshoff M, Petzer V, Warr MR, Haschka D, Tymoszuk P, Demetz E, Seifert M, Posch W, Nairz M, Maciejewski P, Fowles P, Burns CJ, Smith G, Wagner KU, Weiss G, Whitney JA, Theurl I. Momelotinib inhibits ACVR1/ALK2, decreases hepcidin production, and ameliorates anemia of chronic disease in rodents. Blood, 129, 1823–1830 (2017).
• 35) Kuriyama S, Maruyama Y, Honda H. A new insight into the treatment of renal anemia with HIF stabilizer. Ren. Replace Ther., 6, 63 (2020).
• 36) Besarab A, Chernyavskaya E, Motylev I, Shutov E, Kumbar LM, Gurevich K, Chan DT, Leong R, Poole L, Zhong M, Saikali KG, Franco M, Hemmerich S, Yu KH, Neff TB. Roxadustat (FG-4592): correction of anemia in incident dialysis patients. J. Am. Soc. Nephrol., 27, 1225–1233 (2016).
• 37) Provenzano R, Besarab A, Wright S, Dua S, Zeig S, Nguyen P, Poole L, Saikali KG, Saha G, Hemmerich S, Szczech L, Yu KH, Neff TB. Roxadustat (FG-4592) versus epoetin alfa for anemia in patients receiving maintenance hemodialysis: a phase 2, randomized, 6- to 19-week, open-label, active-comparator, dose-ranging, safety and exploratory efficacy study. Am. J. Kidney Dis., 67, 912–924 (2016).
• 38) Minamishima YA, Moslehi J, Padera RF, Bronson RT, Liao R, Kaelin WG Jr. A feedback loop involving the Phd3 prolyl hydroxylase tunes the mammalian hypoxic response in vivo. Mol. Cell. Biol., 29, 5729–5741 (2009).
• 39) Taniguchi CM, Finger EC, Krieg AJ, Wu C, Diep AN, LaGory EL, Wei K, McGinnis LM, Yuan J, Kuo CJ, Giaccia AJ. Cross-talk between hypoxia and insulin signaling through Phd3 regulates hepatic glucose and lipid metabolism and ameliorates diabetes. Nat. Med., 19, 1325–1330 (2013).
• 40) Lichtman SN, Wang J, Schwab JH, Lemasters JJ. Comparison of peptidoglycan-polysaccharide and lipopolysaccharide stimulation of Kupffer cells to produce tumor necrosis factor and interleukin-1. Hepatology, 19, 1013–1022 (1994).