The Role of Potassium Channels in Chronic Stress-Induced Brain Injury

Abstract

Chronic stress-induced brain injury (CSBI) is the organic damage of brain tissue caused by long-term psychological and environmental stress. However, there is no effective drug for the treatment of CSBI. The present study aimed to investigate possible mechanisms of CSBI and to explore related therapeutic targets. A rat model of CSBI was established by combining chronic restraint and cold water immersion. Our CSBI model was validated via Nissl staining, Western blotting, and behavioral tests. RNA sequencing (RNA-seq) was used to identify differentially expressed genes (DEGs) within brain tissue during CSBI. Both Kyoto Encyclopedia of Genes and Genomes (KEGG) and Gene Ontology (GO) analyses were performed to determine signaling pathways associated with CSBI-induced DEGs. Agonists/antagonists were used to validate the pharmacodynamics of potential therapeutic targets. A combination of chronic restraint and cold water immersion successfully induced a rat model of CSBI, as indicated by various markers of brain injury and cell apoptosis that were verified via Nissl staining, Western blotting, and behavioral tests. RNA-seq analysis identified 1131 DEGs in CSBI rats. Of these DEGs, 553 genes were up-regulated and 778 genes were down-regulated. GO and KEGG pathway analyses revealed that significant DEGs were predominantly related to membrane-bound ion channels, among which the potassium channel function was found to be significantly affected. Pharmacological experiments revealed that retigabine, a voltage-gated potassium channel opener, demonstrated a protective effect in CSBI rats. Taken together, our findings suggest that potassium channel function is disrupted in CSBI, and that potassium channel regulators may function as anti-CSBI drugs.

INTRODUCTION

The stress response is a collective term that includes neural, endocrine, and other physiological responses to environmental, psychological, and/or homeostatic stressors.^1,2) When stimulated by stressors such as hunger, disease, and fear, multiple coordinated systems are activated—such as the hypothalamic pituitary adrenal (HPA) axis³⁾ and the sympathetic nervous system (SNS)⁴⁾—which can promote cognition, immune function, metabolism, and homeostasis of the internal environment. However, long-term stress can reverse the beneficial and protective effects of acute stress, leading to serious diseases.⁵⁾

Many neuropsychiatric disorders are associated with chronic stress. Chronic stress is known to be one of the important causes of depression. Stressful events such as economic difficulties, unemployment, and diseases contribute to depression in adults; similarly, children are affected by severe stressors such as violence and abuse during childhood, which are known to also greatly increase the incidence of depression.⁶⁾ In addition, chronic stress often increases the risk of diseases such as hypertension and diabetes. In a study of 500 diabetic patients, Madu et al. found that stress levels experienced by diabetic patients were significantly higher than those of healthy controls.⁷⁾ Another study has shown that chronic stress can result in hypertension in rats.⁸⁾ Chronic stress also affects the immune system and cardiovascular function.^9,10)

The brain plays a commanding role in stress responses throughout the body; it is the most sensitive organ to stress responses. Prolonged or intense stress can hinder the function of neurons in various regions of the brain. For instance, in rats, it has been shown that hippocampal neurogenesis is not affected by acute restraint stress, but it is inhibited after three weeks of chronic restraint stress, during which a concomitant increase in the number of immature neurons is also observed.¹¹⁾ Similarly, another study showed that 21 d of chronic restraint stress resulted in the atrophy of apical dendrites of CA3 pyramidal neurons, as well as an increased expression of apoptosis-related proteins in the prefrontal cortex.^12,13) In addition, repeated restraint stress can lead to neuronal remodeling and changes in synaptic transmission within the amygdala.¹⁴⁾ Collectively, these findings indicate that chronic stress reduces neuron survival, and induces brain injury.

Chronic stress-induced brain injury (CSBI) is a type of brain injury caused by chronic stress; it includes anxiety- and depressive-like behaviors, and a reduction of survival neurons. If CSBI is not effectively treated, more serious psychiatric disorders will eventually develop. Therefore, it is essential to discover and develop drugs for the treatment of CSBI, which may also prevent the occurrence of chronic stress-triggered diseases.

This study aims to investigate the possible mechanisms of CSBI, and to discover potential therapeutic drugs. A rat model of CSBI was established via a combination of chronic restraint stress and cold water immersion, which were used, respectively, to simulate psychological and environmental stressors. Furthermore, Nissl staining, Western blotting, and behavioral testing, including the open field test, forced swimming test, and sucrose preference test, were used to validate the establishment of brain injury in our CSBI model. Subsequently, RNA sequencing (RNA-seq) was used to detect differentially expressed genes (DEGs) within brain tissue after chronic stress. Finally, bioinformatic analysis was employed to assess interactions between DEGs and possible mechanisms that induce CSBI in order to identify single or multiple drug targets for treating stress responses.

MATERIALS AND METHODS

Animals and Experimental Groups

Specific pathogen-free (SPF) female Sprague-Dawley (SD) rats (n = 66) at 10–11 weeks of age (180–220 g) were obtained from the Medical Laboratory Animal Center (Guangzhou, China). Rats were housed with a constant light/dark cycle of 12–12 h (lights on at 7 a.m. and lights off at 7 p.m.), under controlled temperature (20–24 °C) and humidity (45–65%). Rats received nesting material and free access to standard food and tap water in their home cage. Every effort was made to avoid or reduce pain or discomfort to the study animals, and to minimize the number of animals used in this study. Experiments began after a week of adaptive rearing. All animal experiments were approved by the University Committee on the Use and Care of Animals at Guangdong Pharmaceutical University (Guangzhou, China).

Thirty of these rats were randomly divided into either the normal control group (n = 15) or the model group (n = 15, chronic stress treatment) during the establishment of the CSBI model. In addition, 36 rats were randomly divided into three groups during the drug-intervention experiments, which included normal control (n = 12), model (n = 12, chronic stress treatment), and retigabine (n = 12, retigabine and chronic stress treatment) groups.

Chronic Stress Procedure

A chronic stress procedure was performed as previously described.^15,16) In brief, all rats, except for the normal controls, were restrained in homemade holders (plastic, cylindrical holders with holes, 18 × 5 cm). Then, every sixth restrained rat was placed into a tank (30 × 18 × 20 cm), which was filled with water (temperature: 20 ± 1 °C, depth: 15 cm). The chronic stress procedure lasted for 8 h, from 9 a.m. to 5 p.m., each day for 21 d. All rats were deprived of food and water during chronic stress, but were then provided food/water ad libitum after each session.

Drugs and Treatments

Retigabine (98% purity) was purchased from Maclean Biochemical Technology Co., Ltd. (Shanghai, China). Retigabine was prepared in a normal saline solution containing 1% Tween80. The rats in the retigabine treatment group were intraperitoneally (i.p.) administered retigabine (4 mg/kg) at 1 h before the chronic stress procedure was initiated each day.

Tissue Collection

After 21 d of chronic stress, rats were anesthetized with ether and sacrificed via decapitation. The brain tissue from each rat was harvested and washed with normal saline. Next, the hippocampus from each group of rats (n = 6 each) was separated from the brain tissue and fixed with 4% paraformaldehyde for 24 h, after which it was used for Nissl staining. The hippocampus from each group of rats (n = 6 each) was snap frozen in liquid nitrogen for subsequent RNA-seq, quantitative real-time PCR (qRT-PCR), and Western blotting.

Library Construction and RNA-Seq

Hippocampus total RNA from the normal control and model groups (n = 3 per group) was extracted using TRIzol reagent (TaKaRa, Japan), following the manufacturer’s protocol. In addition, the purity and concentration of total RNA were screened by measuring the absorbances at 230, 260, and 280 nm. RNA integrity was assessed using an Agilent 4200 TapeStation (Agilent Technologies, U.S.A.). Next, mRNA was obtained by oligo (dT) magnetic beads. Fragmentation buffer was added to the beads with mRNA, which induced random breaks in the mRNA strands. Subsequently, Ribonuclease H (RNase) H and DNA polymerase I were used to synthesize second-strand cDNA. After purification, the cDNA was eluted with an elution buffer (EB) for end repair and poly (A) addition. Finally, AMPure XP beads (Beckman Coulter, U.S.A.) were used to screen 200 bp of cDNA for PCR amplification and purification of PCR products, after which a sequencing library was obtained. The cDNA library was sequenced on an Illumina sequencing platform (NovaSeq 6000).

DEGs and Functional Enrichment Analysis

DEGs between the normal control and model groups were determined by DESeq2. The false discovery rate (FDR) was controlled using the Benjamini and Hochberg algorithm.¹⁷⁾ Genes with | log₂(Fold Change) | >1 and an FDR < 0.05 were considered DEGs. Gene Ontology (GO) annotation and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis were performed via clusterProfiler. Finally, all GO terms and KEGG pathways were considered based on an FDR < 0.05.

Nissl Staining

Brain hippocampus tissues were fixed in 4% paraformaldehyde, dehydrated by gradient alcohol, and made transparent by xylene. Next, these hippocampal tissues were embedded in paraffin wax and cut into 4 µm sections. The sections were deparaffinized with xylene and gradient alcohol, after which they were treated with Nissl staining solution for 5 min. Finally, the sections were mounted onto coverslips with neutral gum.

Open Field Test (OFT)

Open field testing was performed 1 d after the chronic stress procedure. Rats were placed into the center of an open-field apparatus (100 × 100 × 40 cm) with a black inner wall. The rats were allowed to move freely for 5 min.¹³⁾ The total distance travelled, central square duration, and rearing (number of times standing on hind legs with nose in the air for exploration) was digitally extracted and analyzed via SuperMaze (Shanghai, China). After each rat finished the test, the open-field apparatus was thoroughly cleaned with 75% ethanol.

Sucrose Preference Test (SPT)

Rats were housed individually in standard polycarbonate cages. This test lasted for three days. On the first day, all the rats were given two bottles of water for 24h. On the second day, rats were given a bottle of water and a bottle of 2% sucrose solution for another 24h. On the third day, all rats were deprived of water and food for 24 h. Afterwards, all rats were given a bottle of water and a bottle of 2% sucrose solution. The rats drank freely, and any remaining liquid was weighed after 1 h. Similarly, preferences were calculated as percentages [(sucrose consumption/(sucrose + water consumption)) × 100].¹⁸⁾

Western Blotting

Hippocampus sections were homogenized in RIPA lysis buffer (Beyotime, China), centrifuged at 12000 rpm for 30 min at 4 °C, and protein concentrations were then measured via a BCA Assay Kit (Thermo Scientific, U.S.A.). An equal amount of protein from each sample was subjected to 12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and then transferred to a polyvinylidene-fluoride membrane via electroblotting. Next, the membranes were blocked with 5% skim milk at room temperature for 2 h. After washing three times with tris-buffered saline and Tween 20 (TBST), the membranes were incubated with antibodies against Bax (2772S, CST, U.S.A.), Bcl-2 (26593-1-AP, Proteintech, China), cleaved-caspase 3 (96664S, CST), and tubulin overnight at 4 °C. After washing three times with TBST, membranes were incubated with HRP-conjugated anti-rabbit antibodies (SA00001-2, Proteintech) or anti-mouse immunoglobulin G (IgG) antibodies (SA00001-1, Proteintech) for 1 h at room temperature. Protein bands were detected by ECL reagent (Biosharp, China), and were captured by a chemiluminescence system. Finally, ImageJ was used to quantify protein bands.

qRT-PCR

The hippocampus total RNA from normal control and model groups (same batch as RNA-seq) was extracted using TRIzol reagent (TaKaRa), and the purity and concentration of total RNA was detected by a NanoDrop ND-1000 spectrophotometer (Thermo Scientific). Next, 1 µg of total RNA and a PrimerScript RT Kit (TaKaRa) were used to synthesize cDNA. Then, qRT-PCR was performed with SYBR Premix Taq TM II (TaKaRa) and a Roche LightCycler 480 (Roche, Switzerland). All primer sequences used are listed in Table 1. All genes were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) or β-actin as an internal control. Relative expression levels were calculated via the 2^−ΔΔCt method.¹⁹⁾

Table 1. Primers Used for Real-Time PCR

Gene	Forward (5ʹ→3ʹ)	Reverse (5ʹ→3ʹ)
Kcnj16	CTGCACCTCGGACACCAACAC	GGCTGGTCTCCTCTGGGTTCTC
Clic6	CTGCCCATTCTCACAGCGTCTC	CCGTTTCAGGTCCACCGTTGTC
Calb2	TCACACGGTTGGTGGGTAGGG	GCACTCTGTTGGACTCGGAAGC
Ngfr	CCAACGGTCAGAACGGAGCATC	AGAGGGTGGTCAGAAGCAAGGG
Zic1	CACAGTCTCTTCGCTGCTTCGG	GCCGCATCTGCCCGTTGAC
Olr59	TTCACTCACGCCACCTTCATGC	GGCTCCGCTCTGTCCTCACG
Cftr	CGGCACTCCAGCAAGCAGAAG	TCCAGCACCCAGCACTAGAGC
Camk2n1	CGGAGGTGCTGCCCTACGG	GCAGGCGGCACGAGAAGATC
Mef2c	TGCTGTGCGACTGTGAGATTGC	CTCGTGCGGCTCGTTGTACTC
Satb2	GTCCCAGCCAGCCAAGTTTCAG	CCATCCAACTGCTCCACCACAC
Gapdh	ACAGCAACAGGGTGGTGGAC	TTTGAGGGTGCAGCGAACTT

Statistical Analysis

All data are expressed as the mean ± standard error of the mean (S.E.M.). Unpaired Student’s t-tests with two-tailed distributions were used to analyze statistical differences between two groups. Differences among multiple groups were analyzed by one-way ANOVA. All statistical analysis was performed in SPSS 22.0 or GraphPad Prism 7.0. Differences were considered statistically significant at a p value of <0.05.

RESULTS

Chronic Restraint Stress with Cold Water Immersion Induces Depression-Like Behavior in Rats

The open field test (OFT) and SPT were performed to measure whether the chronic restraint stress with cold water immersion (the model group) induced anxiety- and depression-like behaviors.

The OFT results are shown in Figs. 1A–C. The total distance travelled of rats in the model group was significantly lower than those in the control group (Fig. 1A, p < 0.001). In addition, compared with the control group, central square duration and rearing were both decreased in the model group (Fig. 1B, p < 0.001, Fig. 1C, p < 0.001).

Fig. 1. Chronic Restraint Stress with Cold Water Immersion Induces Depression-Like Behavior in Rats

A Total distance travelled of rats in OFT, B Central square duration of rats in OFT, C Rearing of rats in OFT, D Sucrose preference of rats in SPT. All values are expressed as means ±standard error of the mean ( S.E.M.s.). * p < 0.05, ** p < 0.01, and *** p < 0.001 model vs. control.

In SPT, sucrose preference in the model group was significantly decreased compared with that in the control group (Fig. 1D, p < 0.001).

The results of the behavior testing indicate that chronic restraint stress with cold water immersion induced anxiety- and depression-likes behavior.

Chronic Restraint Stress with Cold Water Immersion Induces Brain Injury in Rats

Nissl staining showed that in the control group hippocampal neurons were neatly arranged with clear nuclei. Nissl bodies were indigo blue and were evenly distributed. In contrast, in the CSBI model group, the number of Nissl bodies was comparatively reduced. In addition, the morphologies of some neurons were shrunken, and their nuclei were unclear (Fig. 2A). The number of survival neurons in the model group was significantly decreased compared with the control group (Figs. 2B, C, p < 0.001). Western-blot analysis of total protein within the hippocampus revealed that, compared with those in the control group, the expression levels of cleaved-caspase 3 (p < 0.05) and Bax (p < 0.05) were increased in the model group, while Bcl2 (p < 0.05) was decreased (Figs. 2D, E). Collectively, these results suggest that chronic restraint stress with cold water immersion induced brain injury in rats. Therefore, our paradigm successfully established a rat model of CSBI.

Fig. 2. Chronic Stress-Induced Brain Injury

A Representative images of Nissl-stained hippocampal CA1 and CA3 regions (magnification ×20, scale bar = 25 µm), B The number of survival neurons of CA1 area in hippocampus, C The number of survival neurons of CA3 area in hippocampus, D Representative western blots for cleaved-caspase 3, Bcl-2, and Bax expression, E Protein expression levels of cleaved-caspase 3, Bax, and Bcl-2. All values are expressed as means ± S.E.M.s. * p < 0.05, ** p < 0.01, and *** p < 0.001 model vs. control. (Color figure can be accessed in the online version.)

DEGs between Brain Tissues in Control and CSBI Model Rats

In order to investigate the mechanisms of CSBI, we next characterized the brain transcriptomic profiles between control and CSBI model rats via RNA-seq. Genes were considered to be differentially expressed based on a | log₂ (Fold Change) | > 1 and an FDR <0.05. A total of 1131 DEGs were identified via RNA-seq, of which 553 were up-regulated and 778 were down-regulated in the model group, compared to those in the control group (Fig. 3A). Then, 10 randomly selected genes (Cftr, Camk2n1, Mef2c, Satb2, Olr59, Kcng4, Ngfr, Zic1, Calb2, Kcnj16, and Clic6) were verified by qRT-PCR. The results showed that Cftr, Camk2n1, Mef2c, Satb2, and Olr59 were significantly up-regulated (Fig. 3B), whereas Ngfr, Zic1, Calb2, Kcnj16, and Clic6 were significantly down-regulated (Fig. 3C) in the model group compared to those in the control group, which was consistent with the results of RNA-seq.

Fig. 3. Differentially Expressed Genes in Brain Tissue Following Chronic Stress

A Differentially expressed genes (DEGs) are shown in a volcano plot, B, C qRT-PCR verification of DEGs characterized by RNA-seq analysis. All values are expressed as means ± S.E.M.s. * p < 0.05 and ** p < 0.01 model vs. control. (Color figure can be accessed in the online version.)

GO Annotation and KEGG Pathway Analysis

GO (gene ontology) annotations—consisting of biological processes (BP), cellular components (CC), and molecular functions (MF)—represent an internationally standardized classification system of gene function for describing the characteristics of genes and their products in any organism.²⁰⁾ Additionally, the international gene database KEGG integrates genomics, transcriptomics, and metabolomics. Using KEGG pathway analysis, associations among DEGs can be determined.

To investigate potential mechanisms of CSBI, we performed GO annotation and KEGG pathway analysis of DEGs between the control and CSBI model rats. The top-five GO terms of each category with an FDR <0.05 are shown in Fig. 4A. Biological processes involved in CSBI-induced DEGs included regulation of transmembrane ion transport, regulation of transmembrane transport, regulation of membrane potential, cellular potassium-ion transport, and transmembrane potassium-ion transport. Furthermore, the cellular components involved in CSBI-induced DEGs included ion channel complexes, transmembrane transporter complexes, transporter complexes, proteinaceous extracellular matrices, and cation channel complexes. Lastly, the molecular functions involved in CSBI-induced DEGs included ion channel activity, voltage-gated ion channel activity, potassium channel activity, potassium-ion transmembrane transporter activity, and voltage-gated potassium channel activity.

Fig. 4. GO and KEGG Analysis of Differentially Expressed Genes Following Chronic Stress

A GO terms related to biological processes (BP), cellular components (CC), and molecular functions (MF), B KEGG enriched pathways following CSBI. (Color figure can be accessed in the online version.)

The KEGG enriched pathways are shown in Fig. 4B. According to the standard of FDR <0.05, the top five pathways were those involving neuroactive ligand-receptor interactions, Cushing syndrome, complement and coagulation cascades, calcium signaling pathways, and the cAMP signaling pathway.

Taken together, GO annotation and KEGG pathway analysis revealed that membrane-bound ion-channel function was altered following CSBI. Therefore, changes in membrane-bound ion channels may have contributed to CSBI in rats.

Potassium Channels Are Affected by Chronic Stress

GO annotation and KEGG pathway analysis suggested that CSBI was related to changes in membrane-bound ion channels. Further analysis revealed that 46 DEGs were related to potassium channels, calcium channels, sodium channels, and chloride channels expressed in neuronal membranes (Table 2). Among these, 29 genes were up-regulated and 17 genes were down-regulated in the model group compared to those in the control group.

Table 2. Differentially Expressed Genes Corresponding to Ion Channels

Gene	Gene ID	log2FC	FDR	Style	Gene description
Kcnf1	298908	2.926649	3.59E-31	Up	Potassium Voltage-Gated Channel Modifier Subfamily F Member 1
Kcnh5	171146	2.561279	7.11E-16	Up	Potassium Voltage-Gated Channel Subfamily H Member 5
Kcns1	117023	2.087972	6.20E-10	Up	Potassium Voltage-Gated Channel Modifier Subfamily S Member 1
Kcnk4	116489	1.816018	1.17E-12	Up	Potassium Two Pore Domain Channel Subfamily K Member 4
Kcnip3	65199	1.708096	1.79E-12	Up	Potassium Voltage-Gated Channel Interacting Protein 3
Kcnj4	116649	1.664317	2.36E-11	Up	Potassium Voltage-Gated Channel Subfamily J Member 4
Kcnk15	156873	1.451746	0.000231	Up	Potassium Two Pore Domain Channel Subfamily K Member 15
Kcnh4	114032	1.387499	7.87E-06	Up	Potassium Voltage-Gated Channel Subfamily H Member 4
Kcnv1	60326	1.3278	1.28E-07	Up	Potassium Voltage-Gated Channel Modifier Subfamily V Member 1
Kcnk12	64119	1.317223	0.000594	Up	Potassium Two Pore Domain Channel Subfamily K Member 12
Kcnk9	84429	1.303801	5.80E-06	Up	Potassium Two Pore Domain Channel Subfamily K Member 9
Kcnh7	170739	1.27681	4.04E-06	Up	Potassium Voltage-Gated Channel Subfamily H Member 7
Kcnh3	27150	1.235379	6.39E-07	Up	Potassium Voltage-Gated Channel Subfamily H Member 3
Kcnab3	58981	1.198436	2.78E-05	Up	Potassium Voltage-Gated Channel Subfamily A Regulatory Beta Subunit 3
Kcnt1	60444	1.140749	4.71E-06	Up	Potassium Sodium-Activated Channel Subfamily T Member 1
Kcnk2	170899	1.123004	3.71E-05	Up	Potassium Two Pore Domain Channel Subfamily K Member 2
Kcna3	29731	1.070987	0.001353	Up	Potassium Voltage-Gated Channel Subfamily A Member 3
Kcnk1	59324	1.063034	4.48E-05	Up	Potassium Two Pore Domain Channel Subfamily K Member 1
Kcnk3	29553	1.016777	0.003001	Up	Potassium Two Pore Domain Channel Subfamily K Member 3
Kcng4	307900	−1.16476	0.000138	Down	Potassium Voltage-Gated Channel Modifier Subfamily G Member 4
Kcng2	307234	−1.38431	7.55E-07	Down	Potassium Voltage-Gated Channel Modifier Subfamily G Member 2
Kcne5	681190	−1.71856	0.015829	Down	Potassium Voltage-Gated Channel Subfamily E Regulatory Subunit 5
Kcnj16	29719	−2.06396	8.18E-11	Down	Potassium Voltage-Gated Channel Subfamily J Member 16
Cacng3	140724	1.218907	1.02E-06	Up	Calcium Voltage-Gated Channel Auxiliary Subunit Gamma 3
Cacnb4	58942	1.12627	6.95E-06	Up	Calcium Voltage-Gated Channel Auxiliary Subunit Beta 4
Cacna1s	682930	2.299475	0.003707	Up	Calcium Voltage-Gated Channel Subunit Alpha1 S
Cacng8	140729	−1.06891	3.01E-05	Down	Calcium Voltage-Gated Channel Auxiliary Subunit Gamma 3
Cacng5	140726	−1.6671	2.09E-09	Down	Calcium Voltage-Gated Channel Auxiliary Subunit Gamma 5
Trpv6	114246	1.154701	2.38E-05	Up	Transient Receptor Potential Cation Channel Subfamily V Member 6
Trpc5	140933	−1.07393	9.13E-05	Down	Transient Receptor Potential Cation Channel Subfamily C Member 5
Trpv3	497948	−1.54345	4.87E-05	Down	Transient Receptor Potential Cation Channel Subfamily V Member 3
Clic5	94272	1.517053	1.20E-05	Up	Chloride Intracellular Channel 5
Clic6	304081	−7.29608	6.69E-31	Down	Chloride Intracellular Channel 6
Clic4	83718	−1.67147	1.49E-10	Down	Chloride Intracellular Channel 4
Clcn2	29232	−1.27821	0.010229	Down	Chloride Voltage-Gated Channel 2
CFTR	24255	4.902666	4.58E-25	Up	Cf Transmembrane Conductance Regulator
Gabrd	29689	1.239462	2.77E-06	Up	Gamma-Aminobutyric Acid Type A Receptor Delta Subunit
Gabra3	24947	1.326115	1.81E-07	Up	Gamma-Aminobutyric Acid Type A Receptor Alpha3 Subunit
Gabre	65191	−4.22253	3.62E-10	Down	Gamma-Aminobutyric Acid Type A Receptor Epsilon Subunit
Gabra5	29707	−1.24863	2.89E-07	Down	Gamma-Aminobutyric Acid Type A Receptor Alpha5 Subunit
Trpm4	171143	1.359117	2.71E-05	Up	Transient Receptor Potential Cation Channel Subfamily M Member 4
Scn3b	245956	−1.06637	1.34E-05	Down	Sodium Voltage-Gated Channel Beta Subunit 3
Scn7a	64155	−1.45892	0.029075	Down	Sodium Voltage-Gated Channel Alpha Subunit 7
Scn4a	25722	−1.82435	0.000371	Down	Sodium Voltage-Gated Channel Alpha Subunit 4
Scn5a	25665	−2.94601	4.53E-17	Down	Sodium Voltage-Gated Channel Alpha Subunit 5

Potassium channel genes accounted for the largest proportion of CSBI-induced DEGs, accounting for 50% of all DEGs corresponding to ion channels (Fig. 5B). In total, there were 23 differentially expressed genes related to potassium channels, of which 19 were up-regulated and four were down-regulated in the model group compared to those in the control group (Fig. 5A). According to their structures and functions, the differentially expressed potassium channel genes were divided into four categories: voltage-gated potassium channels, inward-rectifying potassium channels, two-pore-domain potassium channels, and sodium-activated potassium channels. First, there were 13 DEGs related to voltage-gated potassium channels, accounting for 58.52% of all DEGs corresponding to potassium channels (Fig. 5C), of which Kcna3, Kcnab3, Kcnf1, Kcnh3, Kcnh4, Kcnh5, Kcnh7, Kcnip3, Kcns1, and Kcnv1 were up-regulated, whereas Kcng2, Kcng4, and Kcne5 were down-regulated in the model group compared to those in the control group. Second, there were two DEGs related to inward-rectifying potassium channels, such that Kcnj4 was up-regulated and Kcnj16 was down-regulated in the model group compared to those in the control group. Third, seven DEGs were related to two-pore-domain potassium channels—including Kcnk1, Kcnk2, Kcnk3, Kcnk4, Kcnk9, Kcnk12, and Kcnk15—all of which were up-regulated in the model group compared to those in the control group. Finally, Kcnt1 was the only DEG that was a sodium-activated potassium channel, which was up-regulated in the model group compared to that in the control group.

Fig. 5. Differentially Expressed Genes Corresponding to Potassium Channels Following Chronic Stress

A Heatmap of differentially expressed genes corresponding to potassium channels following chronic stress, B Proportions of sodium, potassium, calcium, and chloride channels, C Proportions of voltage-gated potassium channels, inward-rectifying potassium channels, two-pore-domain potassium channels, and sodium-activated potassium channels, D FDR values of voltage-gated potassium channels. (Color figure can be accessed in the online version.)

Voltage-gated potassium channels are the primary channels that regulate potassium flux across the plasma membrane. Inadequate opening of voltage-gated potassium channels may affect repolarization. The proteins encoded by Kcnf1, Kcnv1, Kcns1, and Kcne5 are regulatory subunits of voltage-gated potassium channels, and up-regulation or down-regulation of these subunits is known to decrease the activity of potassium channels.^21–24) We found that Kcnf1, Kcnv1, and Kcns1 were significantly up-regulated, and Kcne5 was down-regulated (Fig. 5D) in the model group compared to those in the control group, which suggests that chronic stress may hinder the opening of voltage-gated potassium channels.

Retigabine, a Voltage-Gated Potassium Channel Opener, Provides Neuroprotection from Chronic Stress

Our RNA-seq results suggested that reduced activity of voltage-gated potassium channels may contribute to CSBI. Therefore, we next tested the efficacy of retigabine, a voltage-gated potassium channel opener, in ameliorating anxiety- and depression-like behavior following chronic restraint stress with cold water immersion.

The results of OFT found that chronic restraint stress with cold water immersion reduced the spontaneous activity of rats in the model group. However, rats in the retigabine group exhibited an amelioration after treatment. Compared with those in the control group, the total distance travelled of model group decreased significantly (Fig. 6A, p < 0.001), while central square duration and rearing decreased (Figs. 6B, C, p < 0.001). Rats in retigabine group shown significant amelioration compared with the model group. The total distance travelled (Fig. 6A, p < 0.01), central square duration (Fig. 6B, p < 0.001) and rearing (Fig. 6C, p < 0.001) in CSBI model mice increased after retigabine treatment.

Fig. 6. The Potassium Channel Opener, Retigabine, Ameliorates Depression-Like Behavior Induced by Chronic Stress

A Total distance travelled of rats in OFT, B Central square duration of rats in OFT, C rearing of rats in OFT, D sucrose preference of rats in SPT. All values are expressed as means ± S.E.M.s. * p < 0.05, ** p < 0.01, and *** p < 0.001 model vs. control. # p < 0.05, ## p < 0.01, and ### p < 0.001 model vs. Retigabine.

The results of SPT show that the sucrose preference of rats in the model group was lower than that in the control group (Fig. 6D, p < 0.01). By contrast, rats in the retigabine group after treatment shown increased sucrose preference (Fig. 6D, p < 0.01.)

Subsequently, we tested the efficacy of retigabine in ameliorating brain damage in rats following chronic stress. Nissl staining showed that, compared with those in the model group, rats treated with retigabine had neatly arranged neurons and an increased number of Nissl bodies in the hippocampus (Fig. 7A). The number of survival neurons of the CA1 and CA3 areas in the model group were decreased significantly, compared with control (Figs. 7B, C, p < 0.001). In contrast to model group, the number of survival neurons of the CA1 and CA3 area in the retigabine group were increased (Figs. 7B, C, p < 0.001). Western blotting revealed that the expression levels of Bax (p < 0.05) and cleaved-caspase3 (p < 0.01) in the brain tissue of rats treated with retigabine were decreased, while Bcl-2 (p < 0.01) was increased (Figs. 7D, E) compared with those in the model group.

Fig. 7. The Potassium Channel Opener, Retigabine, Provides Neuroprotection from Chronic Stress

A Representative images of Nissl-stained hippocampal CA1 and CA3 regions (magnification ×20, scale bar = 25 µm), B The number of survival neurons of CA1 area of hippocampus, C The number of survival neurons of CA3 area of hippocampus, D Representative western blots for cleaved-caspase 3, Bcl-2, and Bax expression, E Protein expression levels of cleaved-caspase3, Bax, and Bcl-2. All values are expressed as means ± S.E.M.s. * p < 0.05, ** p < 0.01, and *** p < 0.001 model vs. control; # p < 0.05, ## p < 0.01, and ### p < 0.001 model vs. Retigabine. (Color figure can be accessed in the online version.)

Collectively, these results demonstrate that the voltage-gated potassium channel opener, retigabine, significantly ameliorates brain injury induced by chronic stress in rats. Hence, our findings suggest that voltage-gated potassium channel blockage may contribute to CSBI, and thus represents a therapeutic target.

DISCUSSION

Chronic stress can damage tissues and organs; this kind of injury is positively correlated to the duration and intensity of stress, and is negatively correlated to one’s anti-stress ability. The nervous system, especially the brain, acts as a regulatory center for various types of stress. Continuous and repeated chronic stress not only induces brain injury, but also adversely affects the repair of damaged tissues, leading to impaired brain function. In the present study, we performed RNA-seq analysis in a rat model of CSBI and found that the function of neuronal membrane-bound ion channels was affected by chronic stress. Among them, mRNA levels of voltage-gated potassium channel genes were significantly altered following chronic stress, suggesting that the opening and closing of voltage-gated potassium channels is closely related to stress-induced brain injury.

Rat Model of CSBI

Chronic restraint is a well-established model of chronic stress that emulates the neuroendocrine responses of humans under stress and induces depression- and anxiety-like behaviors.²⁵⁾ In the present study, cold water immersion combined with chronic restraint was used to establish a rat model of CSBI. The behavior tests, including the OFT and SPT, are usually used to investigate anxiety- and depression-like behaviors in rats. After 21 d of chronic restraint stress and water immersion, rats in the model group showed a reduction in spontaneous activities and exploration behaviors in OFT. In SPT, the sucrose preference of rats in the model group decreased. The behavior test suggested that after 21 d of chronic stress, rats in the CSBI model exhibited anxiety- and depression-like behaviors. Additionally, Nissl staining showed that the model group had a reduced number of Nissl bodies and survival neurons in the hippocampus. These results were similar to those of brain injury caused by hydraulic shock.²⁶⁾ In addition, cleaved-caspase 3, Bcl2, and Bax are markers that reflect neuronal apoptosis.²⁷⁾ Our present results, obtained by Western blotting, were consistent with those of previous studies.²⁸⁾ As compared to levels in the control group, the expression levels of cleaved-caspase 3 and Bax in the hippocampus of the model group mice were increased, while the expression of bcl2 was decreased.

Anxiety- and depression-like behaviors are associated with neuronal injury within a special brain region. Animal models of depression research have revealed that depression-like behavior is accompanied by neuronal apoptosis in the hippocampus, with reduced levels of Bcl-2 and increased levels of caspase-3.²⁹⁾ However, inhibition of apoptosis in the hippocampus can significantly ameliorate depression-like behavior in animal models.³⁰⁾ On the other hand, increasing neuronal apoptosis in the hippocampus is associated with anxiety-like behavior, while inhibition of apoptosis in the hippocampus can alleviate abnormal behavior in rats.^31,32) Thus, CSBI was shown to be responsible for anxiety- and depression-like behavior in rats.

After 21 d of chronic restraint stress and water immersion, we successfully established a rat model of CSBI that resulted in anxiety- and depression-like behaviors and neuronal apoptosis.

Role of Potassium Channels in Chronic Stress-Induced Brain Injury

Our GO annotation and KEGG pathway analysis showed that changes in ion channel function were the most significant under chronic stress, suggesting that ion channel dysfunction contributed to CSBI in our rat model. Ion channels regulate the excitability of neurons by regulating ion transport across the plasma membrane.³³⁾ Na⁺, K⁺, Ca²⁺, and Cl⁻ are the main ions that regulate neuronal excitation and inhibition. Activation of sodium channels induces Na⁺ influx, which contributes to triggering action potentials.³⁴⁾ Similarly, activation of calcium channels triggers action potentials via Ca²⁺ influx, and also plays an important role in the secretion and reuptake of neurotransmitters.³⁵⁾ In addition, K⁺ and Cl⁻ are the main ions that contribute to repolarization, hyperpolarization, and maintaining resting membrane potential.^36,37)

In the present study, among the CSBI-induced DEGs corresponding to ion channels following RNA-seq analysis, potassium channels represented the largest proportion of this group. According to their structures and functions, potassium channels can be divided into four types: inward-rectified K⁺ channels (Kir), two-pore domain K⁺ channels (K₂P), calcium-activated K⁺ channels (KCa), and voltage-gated K⁺ channels (Kv).³⁸⁾

Our present results show that voltage-gated potassium channel (Kv) genes represented the largest proportion of DEGs corresponding to potassium channels. High densities of voltage-gated potassium channels are located on neuronal plasma membranes, which contribute to repolarization, regulation of action potentials, and maintenance of resting membrane potential.³⁹⁾ Voltage-gated potassium channels are closely related to neuronal excitability, and their dysfunction can induce various neuropsychiatric diseases. For example, benign familial neonatal convulsions are caused by a mutation in KCNQ3 or KCNQ2.⁴⁰⁾ Furthermore, a mutation in KCNA1 yields type-I episodic ataxia.⁴¹⁾ In addition, blockade of voltage-gated potassium channels can induce apoptosis.^42–44)

Among the DEGs corresponding to potassium channels in our present study, Kcnf1 (Kv5.1), Kcns1 (Kv9.1), Kcnv1 (Kv8.1), and Kcne5 belong to electrically silent voltage-gated potassium channel subunits (KvS). In general, potassium channels are homotetramers formed by a combination of four identical functional subunits. However, electrically silent voltage-gated potassium channel subunits are unable to form homotetramers. Instead, they form heterotetramers with other functional subunits to regulate currents and inactivation times of potassium channels.⁴⁵⁾ These genes have been demonstrated to regulate voltage-gated potassium channels. Hugnot and colleagues found that Kv8.1 inhibits K⁺ currents by forming heterotetramers with Kv2.²¹⁾ Similarly, Kramer et al. reported that the co-expression of Kv2.1 and Kv5.1 in Xenopus oocytes results in the inhibition of K⁺ currents.²²⁾ Furthermore, the co-expression of Kv9.1 and Kv2 channels suppresses K⁺ currents.²³⁾ Overexpression of KCNE5 in HEK cells can enhance Kv7.4 currents and increase the Kv7.4 time of deactivation.²⁴⁾

Collectively, these findings suggest that under the influence of chronic stress, retardation of voltage-gated potassium channels may contribute to CSBI. Therefore, voltage-gated potassium channel openers targeting the central nervous system may result in anti-stress effects.

Anti-stress Effect of Retigabine, a Potassium Channel Opener

After analysis of DEGs, we speculated that the blockage of KCNB (Kv2) or KCNQ (Kv7) is related to the CSBI. Since there is no specific opener for KCNB, we chose a KCNQ opener for the central nervous system for our pharmacological experiments. The Kv7 family consists of Kv7.1, Kv7.2, Kv7.3, Kv7.4, and Kv7.5. Kv7.2–Kv7.5 are mainly expressed in the central nervous system.⁴⁶⁾ Retigabine shows anti-epileptic effects in multiple epileptic models by activating KCNQ2–5 (Kv7.2–7.5) channels and enhancing K⁺ currents.⁴⁷⁾ For this reason, retigabine has been approved by the U.S. Food and Drug Administration (FDA) for the treatment of epilepsy. In addition, it has been reported that retigabine protects brain tissue from damage by activating voltage-gated potassium channels and enhancing K⁺ currents. Furthermore, retigabine can ameliorate traumatic brain injury via enhancing potassium channel activity.⁴⁸⁾ Retigabine also exhibits a protective effect on focal cerebral ischemic injury and sarin-induced brain injury.^49,50) In our present study, RNA-seq analysis suggested that KCNQ (Kv7) in the brain was blocked following CSBI. Therefore, we assessed whether the potassium channel opener, retigabine, could ameliorate brain injury in rats following chronic stress.

Nissl staining, OFT, SPT, and Western blotting showed that rats treated with retigabine exhibited neuroprotection from chronic stress, such that brain tissue damage was significantly reduced compared with that of the model group. The protection mechanism of retigabine will be the focus of our future study. Chronic stress can induce neuronal hyperexcitability,^51,52) and neuronal hyperexcitability is one cause of neuronal apoptosis. Retigabine is a specific opener for KCNQ—it is able to increase the number of KCNQ channels. On the other hand, retigabine can also enhance the magnitude and duration of KCNQ channel action and shift the voltage dependence of KCNQ activation, leading to a more rapid and prolonged ability to depolarize stimuli or neuronal hyperexcitability.⁴⁷⁾ Thus, the protective mechanism of retigabine may be related to the rapid and prolonged opening of KCNQ, which acts against chronic stress induced neuronal hyperexcitability. Reduced potassium channel activity may contribute to chronic stress-induced brain injury, thus voltage-gated potassium channel openers may serve as a therapeutic approach for CSBI.

In summary, the etiology of CSBI remains unclear. Multiple environmental, psychological, and homeostatic factors contribute to CSBI. In our present study, RNA-seq analysis suggested that high expression levels of Kcnf1, Kcns1, Kcnv1, and Kcne5 may lead to the dysfunction of voltage-gated potassium channels and contribute to CSBI. We found that retigabine, a voltage-gated potassium channel opener, exhibited neuroprotection against the effects of chronic stress. Therefore, voltage-gated potassium channels represent potential drug targets for the treatment of chronic stress.

Acknowledgments

This work was supported by the Nature Science Foundation of Guangdong Province, China (NO2015A020211028; 2017A030313856).

Conflict of Interest

The authors declare no conflict of interest.

REFERENCES

• 1) Selye H. A syndrome produced by diverse nocuous agents. J. Neuropsychiatry Clin. Neurosci., 10, 230a–231 (1998).
• 2) Kim JS, Han SY, Iremonger KJ. Stress experience and hormone feedback tune distinct components of hypothalamic CRH neuron activity. Nat. Commun., 10, 5696 (2019).
• 3) Sunwoo SH, Lee JS, Bae S, Shin YJ, Kim CS, Joo SY, Choi HS, Suh M, Kim SW, Choi YJ, Kim TI. Chronic and acute stress monitoring by electrophysiological signals from adrenal gland. Proc. Natl. Acad. Sci. U.S.A., 116, 1146–1151 (2019).
• 4) Heidt T, Sager HB, Courties G, Dutta P, Iwamoto Y, Zaltsman A, von Zur Muhlen C, Bode C, Fricchione GL, Denninger J, Lin CP, Vinegoni C, Libby P, Swirski FK, Weissleder R, Nahrendorf M. Chronic variable stress activates hematopoietic stem cells. Nat. Med., 20, 754–758 (2014).
• 5) Yaribeygi H, Panahi Y, Sahraei H, Johnston TP, Sahebkar A. The impact of stress on body function: A review. EXCLI J., 16, 1057–1072 (2017).
• 6) Kessler RC, McLaughlin KA, Green JG, et al. Childhood adversities and adult psychopathology in the WHO World Mental Health Surveys. Br. J. Psychiatry, 197, 378–385 (2010).
• 7) Madhu SV, Siddiqui A, Desai NG, Sharma SB, Bansal AK. Chronic stress, sense of coherence and risk of type 2 diabetes mellitus. Diabetes Metab. Syndr., 13, 18–23 (2019).
• 8) Chan TC, Wall RA, Sutter MC. Chronic ethanol consumption, stress, and hypertension. Hypertension, 7, 519–524 (1985).
• 9) Song H, Fang F, Tomasson G, Arnberg FK, Mataix-Cols D, Fernández de la Cruz L, Almqvist C, Fall K, Valdimarsdóttir UA. Association of stress-related disorders with subsequent autoimmune disease. JAMA, 319, 2388–2400 (2018).
• 10) Kivimäki M, Steptoe A. Effects of stress on the development and progression of cardiovascular disease. Nat. Rev. Cardiol., 15, 215–229 (2018).
• 11) Pham K, Nacher J, Hof PR, McEwen BS. Repeated restraint stress suppresses neurogenesis and induces biphasic PSA-NCAM expression in the adult rat dentate gyrus. Eur. J. Neurosci., 17, 879–886 (2003).
• 12) Watanabe Y, Gould E, Mcewen BS. Stress induces atrophy of apical dendrites of hippocampal CA3 pyramidal neurons. Brain Res., 588, 341–345 (1992).
• 13) Banagozar Mohammadi A, Torbati M, Farajdokht F, Sadigh-Eteghad S, Fazljou SMB, Vatandoust SM, Golzari SEJ, Mahmoudi J. Sericin alleviates restraint stress induced depressive- and anxiety-like behaviors via modulation of oxidative stress, neuroinflammation and apoptosis in the prefrontal cortex and hippocampus. Brain Res., 1715, 47–56 (2019).
• 14) Roozendaal B, McEwen BS, Chattarji S. Stress, memory and the amygdala. Nat. Rev. Neurosci., 10, 423–433 (2009).
• 15) Zhang YY, Zhu WX, Cao GH, Cui XY, Ai HB. c-Fos expression in the supraoptic nucleus is the most intense during different durations of restraint water-immersion stress in the rat. J. Physiol. Sci., 59, 367–375 (2009).
• 16) Zhao DQ, Lu CL, Ai HB. The role of catecholaminergic neurons in the hypothalamus and medullary visceral zone in response to restraint water-immersion stress in rats. J. Physiol. Sci., 61, 37–45 (2011).
• 17) Benjamini Y, Hochberg Y. Controlling the false discovery rate: a practical and powerful approach to multiple testing. J. R. Stat. Soc. Series B Stat. Methodol., 57, 289–300 (1995).
• 18) Cordero AS, Bastos AS, Fornaguera J, Brebes JC. Behavioural characterisation of chronic unpredictable stress based on ethologically relevant paradigms in rats. Sci. Rep., 9, 17403 (2019).
• 19) Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2^−ΔΔCt method. Methods, 25, 402–408 (2001).
• 20) Wang Y, Jiang H, Meng H, Lu J, Li J, Zhang X, Yang X, Zhao B, Sun Y, Bao T. Genome-wide transcriptome analysis of hippocampus in rats indicated that the TLR/NLR signaling pathway was involved in the pathogenesis of depressive disorder induced by chronic restraint stress. Brain Res. Bull., 134, 195–204 (2017).
• 21) Hugnot JP, Salinas M, Lesage F, Guillemare E, de Weille J, Heurteaux C, Mattéi MG, Lazdunski M. Kv8.1, a new neuronal potassium channel subunit with specific inhibitory properties towards Shab and Shaw channels. EMBO J., 15, 3322–3331 (1996).
• 22) Kramer JW, Post MA, Brown AM, Kirsch GE. Modulation of potassium channel gating by co-expression of Kv2.1 with regulatory Kv5.1 or Kv6.1 alpha-subunits. Am. J. Physiol., 274, C1501–C1510 (1998).
• 23) Salinas M, Duprat F, Heurteaux C, Hugnot JP, Lazdunski M. New modulatory alpha subunits for mammalian Shab K⁺ channels. J. Biol. Chem., 272, 24371–24379 (1997).
• 24) de Jong IEM, Jepps TA. Impaired Kv7 channel function in cerebral arteries of a tauopathy mouse model (rTg4510). Physiol. Rep., 6, e13920 (2018).
• 25) Feng Z, Liu L, Zhang C, Zheng T, Wang J, Lin M, Zhao Y, Wang X, Levine AJ, Hu W. Chronic restraint stress attenuates p53 function and promotes tumorigenesis. Proc. Natl. Acad. Sci. U.S.A., 109, 7013–7018 (2012).
• 26) Hicks R, Soares H, Smith D, McIntosh T. Temporal and spatial characterization of neuronal injury following lateral fluid-percussion brain injury in the rat. Acta Neuropathol., 91, 236–246 (1996).
• 27) Sastry PS, Rao KS. Apoptosis and the nervous system. J. Neurochem., 74, 1–20 (2000).
• 28) Wang M, Bi Y, Zeng S, Liu Y, Shao M, Liu K, Deng Y, Wen G, Sun X, Zeng P, Jing L, Lv Z. Modified Xiaoyao San ameliorates depressive-like behaviors by triggering autophagosome formation to alleviate neuronal apoptosis. Biomed. Pharmacother., 111, 1057–1065 (2019).
• 29) Kubera M, Obuchowicz E, Goehler L, Brzeszcz J, Maes M. In animal models, psychosocial stress-induced (neuro)inflammation, apoptosis and reduced neurogenesis are associated to the onset of depression. Prog. Neuropsychopharmacol. Biol. Psychiatry, 35, 744–759 (2011).
• 30) Zhao Y, Shang P, Wang M, Xie M, Liu J. Neuroprotective effects of fluoxetine against chronic stress-induced neural inflammation and apoptosis: involvement of the p38 activity. Front. Physiol., 11, 351 (2020).
• 31) Meyer DL, Davies DR, Barr JL, Manzerra P, Forster GL. Mild traumatic brain injury in the rat alters neuronal number in the limbic system and increases conditioned fear and anxiety-like behaviors. Exp. Neurol., 235, 574–587 (2012).
• 32) Wang J, Li P, Qin T, Sun D, Zhao X, Zhang B. Protective effect of epigallocatechin-3-gallate against neuroinflammation and anxiety-like behavior in a rat model of myocardial infarction. Brain Behav., 10, e01633 (2020).
• 33) Hille B. Ionic channels of excitable membranes. Sinauer, Sunderland, MA (2001).
• 34) Bean BP. The action potential in mammalian central neurons. Nat. Rev. Neurosci., 8, 451–465 (2007).
• 35) Simms BA, Zamponi GW. Neuronal voltage-gated calcium channels: structure, function, and dysfunction. Neuron, 82, 24–45 (2014).
• 36) Saha RN, Dudek SM. Action potentials: to the nucleus and beyond. Exp. Biol. Med. (Maywood), 233, 385–393 (2008).
• 37) Verkman AS, Galietta LJ. Chloride channels as drug targets. Nat. Rev. Drug Discov., 8, 153–171 (2009).
• 38) Kuang Q, Purhonen P, Hebert H. Structure of potassium channels. Cell. Mol. Life Sci., 72, 3677–3693 (2015).
• 39) Rudy B. Diversity and ubiquity of K channels. Neuroscience, 25, 729–749 (1988).
• 40) Jentsch TJ. Neuronal KCNQ potassium channels: physiology and role in disease. Nat. Rev. Neurosci., 1, 21–30 (2000).
• 41) Litt M, Kramer P, Browne D, Gancher S, Brunt ER, Root D, Phromchotikul T, Dubay CJ, Nutt J. A gene for episodic ataxia/myokymia maps to chromosome 12p13. Am. J. Hum. Genet., 55, 702–709 (1994).
• 42) Urrego D, Tomczak AP, Zahed F, Stühmer W, Pardo LA. Potassium channels in cell cycle and cell proliferation. Philos. Trans. R. Soc.Lond. B Biol. Sci., 369, 20130094 (2014).
• 43) Lowinus T, Heidel FH, Bose T, Nimmagadda SC, Schnöder T, Cammann C, Schmitz I, Seifert U, Fischer T, Schraven B, Bommhardt U. Memantine potentiates cytarabine-induced cell death of acute leukemia correlating with inhibition of Kv1.3 potassium channels, AKT and ERK1/2 signaling. Cell Commun. Signal., 17, 5 (2019).
• 44) Ru Q, Li WL, Xiong Q, Chen L, Tian X, Li CY. Voltage-gated potassium channel blocker 4-aminopyridine induces glioma cell apoptosis by reducing expression of microRNA-10b-5p. Mol. Biol. Cell, 29, 1125–1136 (2018).
• 45) Bocksteins E, Snyders DJ. Electrically silent Kv subunits: their molecular and functional characteristics. Physiology, 27, 73–84 (2012).
• 46) Wulff H, Castle NA, Pardo LA. Voltage-gated potassium channels as therapeutic targs. Nat. Rev. Drug Discov., 8, 982–1001 (2009).
• 47) Gunthorpe MJ, Large CH, Sankar R. The mechanism of action of retigabine (ezogabine), a first-in-class K⁺ channel opener for the treatment of epilepsy. Epilepsia, 53, 412–424 (2012).
• 48) Vigil FA, Bozdemir E, Bugay V, Chun SH, Hobbs M, Sanchez I, Hastings SD, Veraza RJ, Holstein DM, Sprague SMM, Carver C, Cavazos JE, Brenner R, Lechleiter JD, Shapiro MS. Prevention of brain damage after traumatic brain injury by pharmacological enhancement of KCNQ (Kv7, “M-type”) K⁺ currents in neurons. J. Cereb. Blood Flow Metab., 40, 1256–1273 (2020).
• 49) Li GB, Liu JY, Feng XM, Zhang BL, Zhang RS. Retigabine attenuates focal cerebral ischemic injury through inhibiting mitochondria-dependent apoptotic pathway. Eur. Rev. Med. Pharmacol. Sci., 22, 5018–5023 (2018).
• 50) Gore A, Neufeld-Cohen A, Egoz I, Baranes S, Gez R, Grauer E, Chapman S, Lazar S. Efficacy of retigabine in ameliorating the brain insult following sarin exposure in the rat. Toxicol. Appl. Pharmacol., 395, 114963 (2020).
• 51) Sharp BM. Basolateral amygdala and stress-induced hyperexcitability affect motivated behaviors and addiction. Transl. Psychiatry, 7, e1194 (2017).
• 52) Rosenkranz JA, Venheim ER, Padival M. Chronic stress causes amygdala hyperexcitability in rodents. Biol. Psychiatry, 67, 1128–1136 (2010).