Coadministration of Curcumin and Hydromorphone Hydrochloride Alleviates Postoperative Pain in Rats

Abstract

This study aimed to explore the effect of curcumin and hydromorphone hydrochloride (HH) cotreatment on postoperative pain in rats. An incision + formaldehyde-induced pain rat model was established. Rats were treated with vehicle, curcumin, HH, or curcumin + HH. Paw mechanical withdrawal threshold and thermal withdrawal latency were measured at 1 d before surgery as well as 1 , 2 h, 1 , 3 , and 7 d after surgery to assess pain sensitivity. The L4-6 region of the spinal cord was collected from each rat at 2 h, 1 , 3 , and 7 d after surgery. Western blot analysis and immunohistochemical staining were carried out to detect the protein expression of pain-related genes. Quantitative real-time PCR and enzyme-linked immunosorbent assay were conducted to measure the expression and production of proinflammatory mediators. Compared with other groups, Curcumin + HH significantly reduced pain sensitivity in the model rats. Mechanistically, curcumin + HH suppressed protein expression of stromal cell-derived factor-1 (SDF-1), CXC chemokine receptor 4 (CXCR4), p-Akt, and c-fos while enhancing protein expression of nerve growth factor (NGF) in the dorsal root ganglia (DRG) of model rats. Curcumin + HH inhibited the expression and production of interleukin 1β (IL-1β), cyclooxygenase-2 (COX-2), tumor necrosis factor α (TNF-α), and p65 nuclear factor kappa B (NF-κB) in the DRG. Coadministration of curcumin and HH alleviates incision + formaldehyde-induced pain in rats, possibly by suppressing the SDF-1/CXCR4 pathway and the production of proinflammatory mediators. Our results provide curcumin and HH cotreatment as a promising therapeutic strategy in the management of postoperative pain.

INTRODUCTION

Postoperative pain refers to acute pain that occurs immediately after surgery and is mainly caused by surgical incision, visceral injury, and drainage. Postoperative pain typically peaks at 24–48 h after surgery and lasts less than 7 d. However, chronic pain syndrome may develop if postoperative pain is not well controlled.¹⁾ Postoperative pain management includes drug therapy, regional nerve block, local anesthesia, and multimodal anesthesia,²⁾ among which drug therapy is the most used method.^3,4) However, side effects such as addiction, respiratory depression, nausea, and vomiting have limited the use of existing analgesic drugs.⁵⁾ Considering the physical and mental distress in patients as well as the financial and medical burden on families and the society caused by pain, it is urgently to develop effective, low-toxic analgesic agents for pain management.

Peripheral nerve injuries arise from various types of trauma, such as laceration, compression, and drug injection injury. Peripheral nerve injury can block the sensory and motor signals between the brain and the spinal cord, leading to sensory loss and muscle weakness.^6,7) Accumulating evidence has shown that traditional Chinese medicine can provide protection against neurological diseases and promote neuronal, axonal, and myelin regeneration.^8,9) It has been reported that Curcuma longa protects the dorsal root ganglia (DRG) and sciatic nerve of rats from crush injury.¹⁰⁾ Curcumin is the main ingredient of curcuma longa, possessing multiple pharmacological activities, such as antiinflammatory, antioxidant, antiviral, and antitumor activities, with low toxicity and minimal adverse effects.^11,12) Curcumin has shown efficacy in alleviating neuropathic pain in animal models and patients. For example, curcumin treatment reduces pain sensitivity and alleviates hind paw swelling after hind paw incision in mice.¹³⁾ Curcumin-containing mucoadhesive film ameliorates periodontal postoperative pain and swelling in patients.¹⁴⁾ Moreover, curcumin relieves chronic compressive traumatic neuropathic pain by inhibiting nuclear factor kappa B (NF-κB) p65-induced CX3C receptor 1 expression in the spinal cord and DRG of rats.¹⁵⁾ These findings suggest that curcumin can protect the peripheral nerve from injury, serving as a promising therapeutic drug to relieve postoperative pain.¹⁶⁾ However, the underlying mechanism remains unclear.

The opioid drug hydromorphone hydrochloride (HH) is a semisynthetic derivative of morphine and is 8–10 times more potent than morphine. Due to the high analgesic potency and rapid onset of action, HH is commonly used to relieve moderate to severe pain.^17–19) However, continuous pain may require higher doses of HH, leading to toxicity produced by overdose and accumulation.⁶⁾ Recently, other drugs have been used in combination with HH to reduce the dose of HH while increasing its analgesic strength. For example, HH combined with ropivacaine has been used for labor analgesia.²⁰⁾ HH combined with flurbiprofen axetil has been used for patient-controlled intravenous analgesia in endoscopic sinus surgery.²¹⁾ However, the effect of curcumin combined with HH on postoperative pain remains unknown.

Nerve information triggered by harmful stimuli, such as surgical wounds, travels through the peripheral nerves, the spinal cord, and the brainstem before reaching the cerebral cortex where it achieves conscious access and initiates a response accordingly.²²⁾ When harmful stimuli cause damage to one or more stages of the information transmission pathway, idiopathic pain disorders, such as fibromyalgia, tension headache, and migraine, may occur.²³⁾ Researchers have found that the stromal cell-derived factor-1 (SDF-1)/CXC chemokine receptor 4 (CXCR4) signaling pathway and proinflammatory mediators, including interleukin 1β (IL-1β), cyclooxygenase-2 (COX-2), tumor necrosis factor α (TNF-α), and NF-κB, are closely associated with posttraumatic nerve injury.^24,25) Based on these findings, we hypothesized that curcumin might relieve postoperative pain by targeting SDF-1/CXCR4 signaling and proinflammatory mediators.

In this study, we established an inflammatory pain model in rats to explore the therapeutic effect and the underlying mechanism of curcumin on postoperative pain when used alone or in combination with HH. Our results suggest that curcumin and HH cotreatment alleviates postoperative pain, involving downregulations of SDF-1/CXCR4 signaling and proinflammatory mediator expression.

MATERIALS AND METHODS

Animals

This study was approved by the Ethical Committee of The Second Hospital of Lanzhou University (#D2021-017; Gansu, China). All procedures were conducted according to the Guide for the Care and Use of Laboratory Animals implemented by the U.S. National Institutes of Health.

Clean-grade Sprague-Dawley male rats (8-week-old) weighing 200–260 g were purchased from the Laboratory Animal Centre of Lanzhou University (Gansu, China) and maintained at 20–26 °C, 40–70% humidity in a 12 h-light/12 h-dark cycle with free access to food and water. Rats were randomly divided into five groups (n = 15/group) as follows: sham, model, HH, curcumin, and curcumin + HH. All rats except those from the sham group received an incision on the sole of the right posterior paw, followed by subcutaneous injection with 2.5% formaldehyde at the incision, to establish a formaldehyde-induced inflammatory pain model.²⁶⁾ Rats in the HH group were administered 5 mg/kg HH (TD2012-0010; Yichang Humanwell Pharmaceutical, China) via intravenous injection at 0.5 h before surgery. Rats in the curcumin group were administered curcumin (80% purity; C7727; Sigma-Aldrich, St. Louis, MO, U.S.A.) dissolved in dimethyl sulfoxide (DMSO) (20 mg/mL) at 100 mg/kg/d via intraperitoneal injection one day before surgery and once daily after surgery for one week. Rats in the curcumin + HH group were administered both HH and curcumin before surgery and curcumin alone after surgery, as above mentioned. Rats in the model group were administered 5% DMSO via intraperitoneal injection before and after surgery. Rats were sacrificed via 2–3% sevoflurane inhalation at 2 h, 1, 3, or 7 d after surgery. The L4-L6 spinal cord segments of the rats were immediately collected and snap-frozen in liquid nitrogen for Western blot and PCR analyses.

Measurement of Paw Mechanical Withdrawal Threshold (PMWT) and Thermal Withdrawal Latency (TWL)

The PMWT and TWL were measured at 1 d before surgery as well as 1 h, 2 h, 1 d, 3 d, and 7 d after surgery as previously described.²⁷⁾ Briefly, for PMWT measurement, each rat was placed in a cage with a wire mesh at the bottom. Von Frey fibers were used to vertically stimulate the area near the incision. The stimulation was stopped when the fiber was slightly bent for 4–6 s or the rat began to exhibit behavioural reactions. Each rat underwent two PMWT measurements with an interval of at least 15 s. For TWL measurement, each rat was placed on a glass plate. After the rat adapted to the environment for 30 min, the incision on the rat’s hind paw was stimulated with the irradiation light. When the rat started to withdraw the paw or the irradiation time reached 20 s, the irradiation was stopped, and the duration was recorded as the thermal pain threshold. Each rat was measured three times at a 5-min interval, and the mean value was calculated.

Quantitative Real-Time (qRT)-PCR

Total RNA was isolated using Trizol (TaKaRa, Japan). RNA concentration was determined using an ultra-micro spectrophotometer. Reverse transcription was performed using a reverse transcription kit (TaKaRa), followed by PCR amplification using SYBR Premix Ex TaqTMII (TaKaRa) and the primers summarized in Table 1. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as an internal reference. Each reaction was performed in triplicate. The relative gene expression was calculated using the 2^−△△Ct method.

Table 1.  Primer Sequences

Genes	Forward (5′–3′)	Reverse (5′–3′)	Length (bp)
IL-1β	AGAAG-TACCTGAGCTCGCCA	CTG-GAAGGAGCACTTCATCTGT	106
COX-2	CCAGCAGTTCCAGTATCAG	AGCAAGTCCGTGTTCAAG	157
TNF-α	GCTGCACTTTGGAGTGATCG	GAGGGTTTGCTACAACATGGG	140
p65NF-κB	TGCGATTCCGCTATAAATGCG	ACAAGTTCATGTGGATGAGGC	178
GAPDH	AGGGCTACTTTTAACTCTGGT	CCCCACTTGATTTTGGAGGGA	206

Enzyme-Linked Immunosorbent Assay (ELISA)

ELISA was conducted to measure the levels of IL-1β, COX-2, TNF-α, and p65NF-κB in rat spinal cord tissue using corresponding ELISA kits following the manufacturer’s instructions. The IL-1β, COX-2, and TNF-α ELISA kits were purchased from Solaibao (Beijing, China). The p65NF-κB ELISA kit was from Enzyme-linked (Shanghai, China).

Western Blot Analysis

The rat DRG tissue samples were ground in liquid nitrogen and lysed in radio immunoprecipitation assay (RIPA) buffer containing 1 mmol/L phenylmethylsulfonyl fluoride (Beyotime, Jiangsu, China). After centrifuging at 4 °C and 12000 r/min for 15 min, the supernatant was collected. Protein concentration was measured using the bicinchoninic acid (BCA) assay (Beyotime). A total of 20 µg proteins were separated on a 12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) gel and then transferred to a polyvinylidene fluoride membrane (Merck Millipore, U.S.A.). After blocking with 5% skim milk at room temperature for 1 h, the membrane was incubated with primary antibody against SDF-1 (ab155090; Abcam, Cambridge, U.K.), CXCR4 (ab181020; Abcam), p-AKT (Ab38449; Abcam), TNFα (ab221609; Abcam), c-fos (ab218578; Abcam), NGF (ab221609; Abcam) or β-actin (ab8227; Abcam) overnight at 4 °C (dilution 1 : 1500). After washing with Tris-buffered saline containing 0.1% Tween 20, the membrane was incubated with secondary antibody (1 : 8000; Abcam) at room temperature for 1 h. The protein bands were visualized using an enhanced chemiluminescence reagent (Beyotime) and analyzed using ImageJ software (NIH, Bethesda, MD, U.S.A.).

Immunohistochemical (IHC) Staining

Rats were sacrificed at 2 h, 1 , 3 , or 7 d after surgery. The DRG was obtained and fixed in 4% paraformaldehyde at 4 °C for 6 h, followed by overnight incubation with 30% sucrose at 4 °C. The paraffin-embedded tissue sections were dewaxed, rehydrated, and subjected to IHC staining using an SP IHC kit (003-1-1; Jiancheng, Nanjing, China) following the manufacturer’s instructions. The results were observed using an inverted microscope (RX50; Sunny, Ningbo, China) at magnification ×400. Five fields were randomly selected in each slide. The total number of cells and the number of brown-stained positive cells were counted in each field using Image J 1.48 software (NIH, Bethesda, MD, U.S.A.). The relative expression of the protein of interest was calculated as the ratio of the number of positive cells to the total number of cells in each field.

Statistical Analysis

Data were expressed as the mean ± standard deviation (S.D.). Statistical analysis was performed using SPSS21.0 software (IBM, Armonk, NY, U.S.A.). The comparisons were conducted using one-way ANOVA with Tukey test. A p-value <0.05 was considered statistically significant. All F values and p-values were summarized in supplementary material.

RESULTS

Coadministration of Curcumin and HH Reduces Postoperative Pain in Rats

To explore the effect of curcumin and HH cotreatment on postoperative pain, we measured PMWT and TWL in the model rats. As shown in Fig. 1, compared with sham rats, rats in other groups rapidly developed pain, as evidenced by significant reductions in PMWT at 1 h after operation (both p < 0.05), along with gradual and slight changes through 7 d after operation. Compared with vehicle treatment in the model group, HH or curcumin treatment significantly increased PMWT and TML of rats (all p < 0.05). In addition, HH-treated rats had markedly greater PMWT and TWL than curcumin-treated rats at different time points after operation (all p < 0.05). These results suggest that HH outperforms curcumin in reducing postoperative pain. However, treatment with curcumin + HH resulted in significant elevations in PMWT and TWL (all p < 0.05) compared with curcumin or HH alone at different time points after operation, suggesting that curcumin and HH has an additive effect on reducing postoperative pain.

Fig. 1. Curcumin Synergized with Hydromorphone Hydrochloride (HH) to Reduce Postoperative Pain in Rats

Sprague-Dawley male rats were randomly divided into sham, model, HH, curcumin, and curcumin + HH groups (n = 15/group). All rats except those from the sham group were administered formaldehyde via subcutaneous injection to induce pain, followed by treatment with vehicle, HH, curcumin, or curcumin + HH. Paw mechanical withdrawal threshold (A) and thermal withdrawal latency (B) were measured at 1 d before surgery as well as 1, 2 h, 1, 3, and 7 d after surgery. Data are expressed as the mean ± standard deviation (S.D.). * p < 0.05 vs. sham group, n = 15. **p < 0.01 vs. sham group; #p < 0.05, ##p < 0.01 vs. model group, n = 15. (Color figure can be accessed in the online version.)

Coadministration of Curcumin and HH Suppresses SDF-1/CXCR4 Signaling and Modulates the Expression of Pain-Related Genes

To investigate the underlying mechanism of curcumin and HH cotreatment in postoperative pain, we determined the expression of pain-related SDF-1, CXCR4, p-AKT, c-fos, and nerve growth factor (NGF) in rat DRG. Western blot analysis showed that rats in sham and vehicle-treated model group had significantly increased SDF-1, CXCR4, p-AKT, c-fos, and NGF protein levels in DRG compared with sham rats (all p < 0.05; Figs. 2A and B), suggesting that these proteins are involved in the development of postoperative pain. Compared with vehicle treatment in model rats, curcumin treatment significantly attenuated the expression of these proteins (all p < 0.05) except NGF. Importantly, curcumin + HH further enhanced the effects of curcumin alone on the expression of these proteins (all p < 0.05). Consistent results were observed in IHC staining (all p < 0.05; Figs. 3A–D). Taken together, these results suggest that coadministration of curcumin and HH suppresses SDF-1/CXCR4 signaling and modulate pain-related gene expression in the DRG during pain development.

Fig. 2. Western Blot Analysis of the Expression of SDF-1/CXCR4 Signaling and Pain-Related Genes in the Dorsal Root Ganglia (DRG) of Rats

(A) Rats were sacrificed at 2 h, 1, 3, or 7 d after surgery. Western blot analysis was performed to measure protein levels of SDF-1, CXCR4, p-AKT, c-fos, and NGF in the DRG tissue samples. (B) Quantification of (A). Data are expressed as the mean ± S.D. ** p < 0.01 vs. sham group; # p < 0.05, ## p < 0.01 vs. model group, n = 15. (Color figure can be accessed in the online version.)

Fig. 3. Immunohistochemical Staining of SDF-1/CXCR4 and Pain-Related Proteins in the DRG of Rats

Rats were sacrificed at 2 h, 1, 3, or 7 d after surgery. Immunohistochemical staining was performed to detect protein expression of SDF-1 (A), CXCR4 (B), c-fos (C), and NGF (D) in the DRG tissue samples. Representative images are shown. Magnification × 400. Data are expressed as the mean ± S.D. **p < 0.01 vs. sham group; ^# p < 0.05, ^## p < 0.01 vs. model group, n = 15. (Color figure can be accessed in the online version.)

Coadministration of Curcumin and HH Suppresses Proinflammatory Mediator Expression and Production in the DRG

Postoperative pain involves an inflammatory reaction.²⁸⁾ Thus, we sought to investigate whether curcumin and HH affect the expression of proinflammatory mediators. qRT-PCR showed that compared with those from sham rats, the DRG samples from vehicle-treated model rats had significantly increased mRNA levels of IL-1β, COX-2, TNF-α, and p65NF-κB through 2 h to 7 d after operation in a time-dependent manner (all p < 0.05; Figs. 4A–D). ELISA revealed that vehicle-treated model rats had significantly elevated serum levels of IL-1β, COX-2, TNF-α, and p65NF-κB compared with sham rats (all p < 0.05; Figs. 4E–H). Although HH or curcumin alone to some extend reduced operation-induced expression and production of these proinflammatory mediators, treatment with curcumin + HH further diminished the expression and production of these mediators (all p < 0.05). These data suggest that coadministration of curcumin and HH suppresses proinflammatory mediator expression and production.

Fig. 4. Curcumin Synergized with HH to Suppress Proinflammatory Mediator Expression and Production in the DRG

Rats were sacrificed at 2 h, 1, 3, or 7 d after surgery. Quantitative real-time PCR was conducted to determine mRNA levels of IL-1β (A), COX-2 (B), TNF-α (C), and p65NF-κB (D) in the DRG. Enzyme-linked immunosorbent assay was carried out to measure protein levels of IL-1β (E), COX-2 (F), TNF-α (G), and p65NF-κB (H) at 7 d after surgery in the DRG. Data are expressed as the mean ± S.D. ** p < 0.01 vs. sham group; ^# p < 0.05, ^## p < 0.01 vs. model group; n = 15. (Color figure can be accessed in the online version.)

DISCUSSION

In this study, we established an incision + formaldehyde-induced pain rat model. By measuring MWT and TWL, we found that the model rats rapidly developed pain at 1 h after operation compared with the control rats, suggesting that the pain model was successfully established. We demonstrated that cotreatment with curcumin and HH significantly reduced the pain sensitivity in rats compared with treatment with curcumin or HH alone, suggesting that curcumin and HH exhibit additive effects on relieving postoperative pain. Considering the critical roles of the SDF-1/CXCR4 pathway and proinflammatory cytokines in posttraumatic nerve injury,^24,25,29) we determined the expressions of SDF-1/CXCR4 and proinflammatory mediators in the DRG of rats. Our results suggest that the suppression of the SDF-1/CXCR4 pathway and inhibition of proinflammatory mediator production are involved in the therapeutic effect of curcumin + HH on postoperative pain.

SDF-1 belongs to the CXC family, playing multiple biological functions through activating CXCR4.³⁰⁾ SDF-1 and CXCR4 are expressed in various types of cells in the central and peripheral nervous system. The alteration in SDF-1/CXCR4 expression is involved in the pathogenesis of neurological disorders, serving as a therapeutic target for pharmacological intervention.³¹⁾ Recent studies have implicated SDF-1/CXCR4 signaling in pain development. For example, in the DRG of rats with unilateral sciatic nerve injury-induced pain, Dubový et al. have observed SDF-1/CXCR4 upregulation that lasts at least for two weeks.³²⁾ Similarly, Knerlich-Lukoschus et al. have demonstrated that in a rat spinal cord injury-induced posttraumatic pain model, SDF1/CXCR4 expression levels are continuously increased at the spinal cord level from 2 to 42 d after the injury.³³⁾ Moreover, Reaux-Le et al. have reported that CXCR4-neutralizing antibody can prevent intrathecal SDF-1 injection-induced mechanical allodynia.³¹⁾ These findings suggest that SDF1/CXCR4 signaling contributes to the chronic and persistent pain and that targeting SDF1/CXCR4 signaling can prevent pain development. Consistent with these findings, in our study, Western blot analysis and IHC staining showed that untreated model rats had significantly increased SDF-1 and CXCR4 protein levels in the DRG compared with sham rats, which lasted for at least 7 d postoperation, suggesting that SDF-1/CXCR4 signaling is involved in the development of postoperative pain. Importantly, SDF-1/CXCR4 expression was dramatically attenuated in response to curcumin + HH treatment, suggesting that curcumin + HH alleviated postoperative pain possibly by suppressing SDF-1/CXCR4 signaling. A recent study⁷⁾ has demonstrated that treatment with curcumin + HH protects the injured neurons through TrkA and phosphatidylinositol 3-kinase (PI3K)/Akt signaling. Our results showed that treatment with curcumin + HH more effectively blocked AKT phosphorylation than curcumin or HH alone in the DRG of model rats, suggesting that curcumin + HH alleviates postoperative pain possibly by modulating AKT signaling.

Proinflammatory cytokines contribute to pain development. On the other hand, continuous pain stimulates inflammatory response, promoting the expression and secretion of proinflammatory cytokines.²⁸⁾ IL-1β and TNF-α are important proinflammatory cytokines that have been found to be increased in the DRG and the spinal cord in response to incision- or chronic compression-induced peripheral nerve injury.^34,35) In a rat model of postoperative pain, the concentrations of IL-1β and TNF-α at the site of injury are increased within 24 to 48 h of surgery and remain elevated for 4 to 8 d after surgery.³⁶⁾ NF-κB is a key regulator of inflammation and pain.¹⁶⁾ Upon activation by proinflammatory cytokines, growth factors, or other stimuli, the p65/p50 heterodimer translocates to the nucleus and initiates transcription of inflammatory genes, such as IL-1β, TNFα, and COX-2, that subsequently influence inflammation and pain.³⁷⁾ These multiple molecules and mechanisms become novel therapeutic targets for analgesic drug development.³⁸⁾ To investigate the effect of curcumin + HH on proinflammatory mediator production, we measured the expression of IL-1β, COX-2, TNF-α, and p65NF-κB in the DRG of model rats. The results showed that treatment with curcumin + HH significantly reduced the mRNA and protein levels of these proinflammatory mediators compared with other groups, suggesting that cotreatment with curcumin and HH could alleviate postoperative pain by suppressing inflammatory response during pain development.

Neurotrophins NGF promotes the survival of sensory and sympathetic neurons.³⁹⁾ We found that NGF protein level in the curcumin + HH group was remarkably higher than that in other groups, suggesting that curcumin + HH may facilitate regeneration and repair of neurons and thus relieving postoperative pain. The proto-oncogene c-fos is a marker of nociceptive neuronal activity.⁴⁰⁾ Our results showed that c-fos expression in the curcumin + HH group was significantly lower than that in other groups, suggesting that nociceptive neuronal activity is decreased in response to curcumin and HH cotreatment. However, the underlying mechanism needs further investigation.

In conclusion, we demonstrate that coadministration of curcumin and HH could alleviate incision + formaldehyde-induced pain in rats. Curcumin combined with HH could suppress the expression of SDF-1, CXCR4, p-Akt, c-fos, and proinflammatory mediators while enhancing the expression of NGF, suggesting that curcumin combined with HH alleviates postoperative pain possibly by inhibiting inflammation and promoting neuron repair. Our results provide curcumin combined with HH as a promising therapeutic strategy in the management of postoperative pain.

Author Contributions

Yihan Wang designed the study. Yihan Wang, Yang Liu, Yingbin Wang performed the experiments and drafted the manuscript. Yihan Wang, Jieting Liu, Min Wang, analyzed and interpreted the data. All authors read and approved the final manuscript.

Conflict of Interest

The authors declare no conflict of interest.

Supplementary Materials

The online version of this article contains supplementary materials.

REFERENCES

• 1) Saito M, Tsukada S, Fujita N, Rahman M, Morita W, Kitamura N, Tasaki A. Post-operative pain control following arthroscopic rotator cuff repair: peri-articular injection versus interscalene brachial plexus block. Int. Orthop., 43, 1435–1441 (2019).
• 2) Uquillas CA, Capogna BM, Rossy WH, Mahure SA, Rokito AS. Postoperative pain control after arthroscopic rotator cuff repair. J. Shoulder Elbow Surg., 25, 1204–1213 (2016).
• 3) Pauzenberger L, Domej MA, Heuberer PR, Hexel M, Grieb A, Laky B, Blasl J, Anderl W. The effect of intravenous tranexamic acid on blood loss and early post-operative pain in total shoulder arthroplasty. Bone Joint J., 99-B, 1073–1079 (2017).
• 4) Fu X, Zeng H, Guo J, Liu H, Shi Z, Chen H, Li D, Xie X, Kuang C. A PLGA-PEG-PLGA thermosensitive gel enabling sustained delivery of ropivacaine hydrochloride for postoperative pain relief. Chem. Pharm. Bull., 65, 229–235 (2017).
• 5) Dahan A, van der Schrier R, Smith T, Aarts L, van Velzen M, Niesters M. Averting opioid-induced respiratory depression without affecting analgesia. Anesthesiology, 128, 1027–1037 (2018).
• 6) Hewson DW, Bedforth NM, Hardman JG. Peripheral nerve injury arising in anaesthesia practice. Anaesthesia, 73 (Suppl. 1), 51–60 (2018).
• 7) Sang Q, Sun D, Chen Z, Zhao W. NGF and PI3K/Akt signaling participate in the ventral motor neuronal protection of curcumin in sciatic nerve injury rat models. Biomed. Pharmacother., 103, 1146–1153 (2018).
• 8) Kwon H, Jung IH, Yi JH, Kim JH, Park JH, Lee S, Jung JW, Lee YC, Ryu JH, Kim DH. The seed of Zizyphus jujuba var. spinosa attenuates Alzheimer’s disease-associated hippocampal synaptic deficits through BDNF/TrkB signaling. Biol. Pharm. Bull., 40, 2096–2104 (2017).
• 9) Wu SP, Li D, Wang N, Hou JC, Zhao L. YiQi Tongluo Granule against cerebral ischemia/reperfusion injury in rats by freezing GluN2B and CaMK II through NMDAR/ERK1/2 signaling. Chem. Pharm. Bull., 67, 244–252 (2019).
• 10) Noorafshan A, Omidi A, Karbalay-Doust S. Curcumin protects the dorsal root ganglion and sciatic nerve after crush in rat. Pathol. Res. Pract., 207, 577–582 (2011).
• 11) Zhou DY, Ding N, Van Doren J, Wei XC, Du ZY, Conney AH, Zhang K, Zheng X. Effects of curcumin analogues for inhibiting human prostate cancer cells and the growth of human PC-3 prostate xenografts in immunodeficient mice. Biol. Pharm. Bull., 37, 1029–1034 (2014).
• 12) Akaishi T, Yamamoto S, Abe K. The synthetic curcumin derivative CNB-001 attenuates thrombin-stimulated microglial inflammation by inhibiting the ERK and p38 MAPK pathways. Biol. Pharm. Bull., 43, 138–144 (2020).
• 13) Sahbaie P, Sun Y, Liang DY, Shi XY, Clark JD. Curcumin treatment attenuates pain and enhances functional recovery after incision. Anesth. Analg., 118, 1336–1344 (2014).
• 14) Anil A, Gujjari SK, Venkatesh MP. Evaluation of a curcumin-containing mucoadhesive film for periodontal postsurgical pain control. J. Indian Soc. Periodontol., 23, 461–468 (2019).
• 15) Cao H, Zheng JW, Li JJ, Meng B, Li J, Ge RS. Effects of curcumin on pain threshold and on the expression of nuclear factor kappa B and CX3C receptor 1 after sciatic nerve chronic constrictive injury in rats. Chin. J. Integr. Med., 20, 850–856 (2014).
• 16) Zhang X, Guan Z, Wang X, Sun D, Wang D, Li Y, Pei B, Ye M, Xu J, Yue X. Curcumin alleviates oxaliplatin-induced peripheral neuropathic pain through inhibiting oxidative stress-mediated activation of NF-κB and mitigating inflammation. Biol. Pharm. Bull., 43, 348–355 (2020).
• 17) Braun DE, Gelbrich T, Kahlenberg V, Griesser UJ. Insights into hydrate formation and stability of morphinanes from a combination of experimental and computational approaches. Mol. Pharm., 11, 3145–3163 (2014).
• 18) Qin W, Liu B, Deng A, Liu Y, Zhang X, Zhang L. Super analgesia of intrathecal morphine may be related to ABCB1 (MDR1) gene polymorphism. J. Pain Res., 11, 1355–1357 (2018).
• 19) Takemura M, Niki K, Okamoto Y, Matsuda Y, Omae T, Takagi T, Ueda M. Tapentadol in cancer patients with neuropathic pain: a comparison of methadone, oxycodone, fentanyl, and hydromorphone. Biol. Pharm. Bull., 44, 1286–1293 (2021).
• 20) Lu YY, Huang H, Mao WL, Liu RH, Hu MJ, Shao LX, Hu MP, Li J: [A concentration-response observation of hydromorphone combined with ropivacaine in labor analgesia]. Zhonghua Yi Xue Za Zhi, 97, 3297–3300 (2017).
• 21) Jiang XY, Shu LW, Pan CX: [Efficacy of patient-controlled intravenous analgesia with hydromorphone hydrochloride plus flurbiprofen axetil after endoscopic sinus surgery]. Zhonghua Yi Xue Za Zhi, 97, 2516–2519 (2017)
• 22) Prielipp RC, Morell RC, Butterworth J. Ulnar nerve injury and perioperative arm positioning. Anesthesiol. Clin. North America, 20, 589–603 (2002).
• 23) Yarnitsky D, Crispel Y, Eisenberg E, Granovsky Y, Ben-Nun A, Sprecher E, Best LA, Granot M. Prediction of chronic post-operative pain: pre-operative DNIC testing identifies patients at risk. Pain, 138, 22–28 (2008).
• 24) Yang F, Sun W, Yang Y, Wang Y, Li CL, Fu H, Wang XL, Yang F, He T, Chen J. SDF1-CXCR4 signaling contributes to persistent pain and hypersensitivity via regulating excitability of primary nociceptive neurons: involvement of ERK-dependent Nav1.8 up-regulation. J. Neuroinflammation, 12, 219 (2015).
• 25) Gonçalves Dos Santos G, Delay L, Yaksh TL, Corr M. Neuraxial cytokines in pain states. Front. Immunol., 10, 3061 (2020).
• 26) Fu KY, Light AR, Maixner W. Relationship between nociceptor activity, peripheral edema, spinal microglial activation and long-term hyperalgesia induced by formalin. Neuroscience, 101, 1127–1135 (2000).
• 27) Deuis JR, Dvorakova LS, Vetter I. Methods used to evaluate pain behaviors in rodents. Front Mol Neurosci, 10, 284 (2017).
• 28) Bugada D, Lavand’homme P, Ambrosoli AL, Cappelleri G, Saccani Jotti GM, Meschi T, Fanelli G, Allegri M. Effect of preoperative inflammatory status and comorbidities on pain resolution and persistent postsurgical pain after inguinal hernia repair. Mediators Inflamm., 2016, 5830347 (2016).
• 29) Piao JM, Wu W, Yang ZX, Li YZ, Luo Q, Yu JL. MicroRNA-381 favors repair of nerve injury through regulation of the SDF-1/CXCR4 signaling pathway via LRRC4 in acute cerebral ischemia after cerebral lymphatic blockage. Cell. Physiol. Biochem., 46, 890–906 (2018).
• 30) Reaux-Le Goazigo A, Rivat C, Kitabgi P, Pohl M, Melik Parsadaniantz S. Cellular and subcellular localization of CXCL12 and CXCR4 in rat nociceptive structures: physiological relevance. Eur. J. Neurosci., 36, 2619–2631 (2012).
• 31) Reaux-Le Goazigo A, Van Steenwinckel J, Rostene W, Melik Parsadaniantz S. Current status of chemokines in the adult CNS. Prog. Neurobiol., 104, 67–92 (2013).
• 32) Dubový P, Klusakova I, Svizenska I, Brazda V. Spatio-temporal changes of SDF1 and its CXCR4 receptor in the dorsal root ganglia following unilateral sciatic nerve injury as a model of neuropathic pain. Histochem. Cell Biol., 133, 323–337 (2010).
• 33) Knerlich-Lukoschus F, von der Ropp-Brenner B, Lucius R, Mehdorn HM, Held-Feindt J. Spatiotemporal CCR1, CCL3(MIP-1alpha), CXCR4, CXCL12(SDF-1alpha) expression patterns in a rat spinal cord injury model of posttraumatic neuropathic pain. J. Neurosurg. Spine, 14, 583–597 (2011).
• 34) Chang L, Ye F, Luo Q, Tao Y, Shu H. Increased hyperalgesia and proinflammatory cytokines in the spinal cord and dorsal root ganglion after surgery and/or fentanyl administration in rats. Anesth. Analg., 126, 289–297 (2018).
• 35) Song XJ, Huang ZJ, Song WB, Song XS, Fuhr AF, Rosner AL, Ndtan H, Rupert RL. Attenuation effect of spinal manipulation on neuropathic and postoperative pain through activating endogenous anti-inflammatory cytokine interleukin 10 in rat spinal cord. J. Manipulative Physiol. Ther., 39, 42–53 (2016).
• 36) Loram LC, Themistocleous AC, Fick LG, Kamerman PR. The time course of inflammatory cytokine secretion in a rat model of postoperative pain does not coincide with the onset of mechanical hyperalgesia. Can. J. Physiol. Pharmacol., 85, 613–620 (2007).
• 37) Hartung JE, Eskew O, Wong T, Tchivileva IE, Oladosu FA, O’Buckley SC, Nackley AG. Nuclear factor-kappa B regulates pain and COMT expression in a rodent model of inflammation. Brain Behav. Immun., 50, 196–202 (2015).
• 38) Khan S, Shehzad O, Chun J, Kim YS. Mechanism underlying anti-hyperalgesic and anti-allodynic properties of anomalin in both acute and chronic inflammatory pain models in mice through inhibition of NF-kappaB, MAPKs and CREB signaling cascades. Eur. J. Pharmacol., 718, 448–458 (2013).
• 39) Hui L, Yuan J, Ren Z, Jiang X. Nerve growth factor reduces apoptotic cell death in rat facial motor neurons after facial nerve injury. Neurosciences, 20, 65–68 (2015).
• 40) Makino H, Seki S, Yahara Y, Shiozawa S, Aikawa Y, Motomura H, Nogami M, Watanabe K, Sainoh T, Ito H, Tsumaki N, Kawaguchi Y, Yamazaki M, Kimura T. A selective inhibition of c-Fos/activator protein-1 as a potential therapeutic target for intervertebral disc degeneration and associated pain. Sci. Rep., 7, 16983 (2017).