Berberine Encapsulated in Exosomes Derived from Platelet-Rich Plasma Promotes Chondrogenic Differentiation of the Bone Marrow Mesenchymal Stem Cells via the Wnt/β-Catenin Pathway

Abstract

Cartilage regenerative medicine, wherein the stem cells from adults exert a crucial role, has high potential in the treatment of defective articular cartilage. Recently, Bone marrow mesenchymal stem cells (BMSCs) are being increasingly recognized as an alternative source of adult stem cells, which are capable of differentiating into several cell types (e.g., adipocytes, chondrocytes, and osteoblasts). However, their proliferative properties and tendency to dedifferentiate restrict their use in clinical settings. Recently, a possible bioactive material PRP-exos (exosomes derived from platelet-rich plasma), has emerged, which can effectively facilitate the differentiation and proliferation of cells. Recent studies have reported that berberine (Ber), known to have anti-inflammatory properties, plays a role in osteogenesis. Since biological molecules are used in combinations, we attempted to assess the effect of Exos-Ber (PRP-exos in combination with Ber) on the chondrogenic differentiation of BMSCs in vitro. In this study, Exos-Ber was observed to promote the proliferation of BMSCs and cause their chondrogenic differentiation in vitro. Additionally, Exos-Ber could promote the migration of BMSCs and increase the protein expression of the chondrogenic genes (Collagen II, SOX9, Aggrecan). After treatment with Exos-Ber, significant induction of β-catenin expression was observed, which could be repressed successfully by adding β-catenin inhibitor XAV-939. Interestingly, the repression of the Wnt/β-catenin axis also resulted in reduced gene expression levels of Collagen II, SOX9, and Aggrecan. These observations indicated that Exos-Ber facilitated the differentiation of chondrogenic BMSCs by modulating the Wnt/β-catenin axis, which offers innovative insights into the reconstruction of cartilage.

INTRODUCTION

Disabilities caused by cartilage injury have become an increasingly severe social issue and an economic burden globally.¹⁾ Cartilage injury is mainly caused by articular inflammatory disease or trauma.²⁾ Due to the inherent avascularity and poor intrinsic regenerative capacity of cartilaginous tissue, the regeneration of articular cartilage has become a clinical challenge.³⁾ Owing to traits such as differentiation, immunomodulation, and self-renewability, bone marrow mesenchymal stem cells (BMSCs) have been widely applied in the management of various diseases that have been regarded as multipotent.⁴⁾ Recently, the transplantation of BMSCs has been confirmed to have therapeutic potential against cartilage damage due to its ability to differentiate into chondrocytes, repress inflammation and apoptosis, and promote axonal regeneration and angiogenesis.⁵⁾ The fundamental mechanisms, efficacy, and safety of clinical treatments using BMSCs have been supported by both in vivo and in vitro studies.^6,7)

Platelet-rich plasma (PRP), an autologous derivative of the whole blood, has a higher platelet count than that of peripheral blood.⁸⁾ Several studies have demonstrated that the proliferative and synthesizing capacities of BMSCs are enhanced by PRP.^9–11) The administration of PRP could not only boost the formation of cartilage repair tissue but also could attain the quality of the level of native tissue.¹²⁾ Besides, PRP suppresses the catabolism of chondrocytes by the inflammatory cytokines, while simultaneously strengthening the synthesis of extracellular matrix (ECM) and chondrogenesis.¹³⁾ Previous studies have reported that the primary mechanism of PRP on osteoarthritis probably involves the PRP-derived exosomes.¹⁴⁾ Some recent studies have demonstrated the fundamental mechanisms and functionalities of exosomes derived from diverse extracellular fluids and cells.¹⁵⁾ Through the isolation of exosomes from PRP, Torreggiani et al. first reported the effects of PRP-exos on histological regeneration.¹⁶⁾ Besides, some studies have reported that PRP-exos have an underlying beneficial effect in the treatment of cartilage injury through the promotion of osteogenic differentiation of BMSCs.¹⁷⁾

Berberine (Ber) is an isoquinoline alkaloid that is isolated from Berberis plants such as Coptis chinensis, which possesses broad-spectrum pharmacological traits, including inflammatory resistance, anti-bacterial, and antioxidant properties.^18,19) With advantages such as low price and minor adverse events, Ber has always been a popular herbal therapy for bacterial diarrhea and gastroenteritis. Currently, it has attracted attention from the field of orthopedics.²⁰⁾ More interestingly, apart from the anti-bacterial effect of Ber, it can also promote osteogenesis.²¹⁾ According to previous studies, Ber can activate the typical Wnt/β-catenin axis, thereby facilitating the differentiation of chondrogenic BMSCs.²²⁾ However, the efficacy of Ber monotherapy is limited, which necessitates the use of adjuvants for better efficacy. Evidence has suggested that despite having a similar effect on the differentiation of BMSCs, the PRP-exos and Ber act via varying mechanisms.^23–25) Thus, compared to monotherapy using either PRP-exos or Ber, the use of PRP-exos in combination with Ber is possibly a better option for the clinical management of cartilage damage.

In this study, we loaded Ber into PRP-derived exosomes as a novel drug system (Exos-Ber), which could increase the stability and bioavailability of Ber in vitro. The effects of Exos-Ber on the proliferative potential and chondrogenic differentiation of BMSCs were investigated, and the related signaling pathways and mechanisms of modulation were discussed. We observed that Exos-Ber could increase cellular proliferation, promote the migration of BMSCs, and increase the protein expressions of chondrogenic genes such as Collagen II, SOX9, and Aggrecan. Besides, treatment with Exos-Ber markedly induced the expression of β-catenin and glycogen synthase kinase 3β (GSK-3β), which could be repressed successfully by adding β-catenin inhibitor XAV-939. Interestingly, repression of the Wnt/β-catenin axis also reduced the gene expression levels of Collagen II, SOX9, and Aggrecan. These observations suggested that Exos-Ber facilitated the differentiation of chondrogenic BMSCs by modulating the Wnt/β-catenin axis, which offers innovative insights into the reconstruction of cartilage.

MATERIALS AND METHODS

Chemicals and Reagents

Berberine (purity >99%) was procured from MedChem Express (NJ, U.S.A.). Dulbecco’s modified eagle medium (DMEM) and fetal bovine serum (FBS) were obtained from Gibco (Suzhou, China). The culture plates and flasks used herein were procured from Corning Life Sciences (NY, U.S.A.). The Cell Counting Kit-8 (CCK-8) was a product of Dojindo (Kumamoto, Japan). Von Kossa (calcium stain) and alkaline phosphatase (ALP) assay kits were procured from Beyotime (Shanghai, China). TRIzol reagent was obtained from Invitrogen (CA, U.S.A.), while the radio immunoprecipitation assay (RIPA) lysis buffer was procured from Beyotime (Shanghai, China). Antibodies against collagen II, SOX9, Aggrecan, β-catenin, GSK-3β, and β-actin were obtained from Cell Signaling Technology (MA, U.S.A.). CD9, CD63, CD81, TSG101, anti-Rabbit immunoglobulin G (IgG) (H + L), and anti-Mouse IgG (H + L) goat secondary antibodies were obtained from Abcam (MA, U.S.A.). All the remaining chemicals used were of reagent grade.

Isolation and Characterization of BMSCs

BMSCs were isolated from female Sprague-Dawley (SD) rats according to a previously described procedure.²⁶⁾ All animal procedures were approved by the Institutional Animal Care and Use Committee of Nanjing Medical University (Approval ID: AP-012) and performed in accordance with institutional guidelines and regulations for animal experiments at Nanjing Medical University. They were then cultivated in low-glucose DMEM (Thermo Fisher, U.S.A.) containing 10% FBS (Gibco, U.S.A.). All the cells were incubated at 37 °C and 5% CO₂. BMSCs at passages 2 to 5 were used in every experiment. To identify the traits of the BMSCs, the expression of the surface markers (CD29, CD90, and CD45) was measured using flow cytometry.²⁷⁾ To determine the multipotent differentiation tendencies (e.g., adipogenesis, osteogenesis, and chondrogenesis) of the BMSCs, a previously described procedure was followed.²⁸⁾

Preparation of PRP and PRP-Exos

The isolation of PRP was performed as described previously.²⁹⁾ Briefly, whole blood was collected from the aforementioned SD rats into acid citrate dextrose solution A (ACD-A) anticoagulant at a ratio of 1 mL ACD-A:9 mL blood. The samples were centrifuged in two steps to separate the platelets from the plasma RBCs and WBCs. Initially, the mixture (10 mL) was centrifuged in a 15 mL centrifuge tube for 10 min at 250 × g. Then, the blood was isolated into three components, and the top two layers were shifted to a fresh centrifuge tube for centrifugation at 1000 × g for 10 min. After discarding the plasma supernatant and about three-fourths of the PPP (platelet-poor plasma) layer, the remaining platelet precipitate was resuspended to yield 1 mL of PRP.^30,31) The exoEasy Maxi Kit (QIAGEN, Hilden, Germany) was used to isolate the total exosomes from the PRP 4 °C according to the manufacturer’s instructions. The exosomes were carefully resuspended in sterile phosphate buffered saline (PBS) and stored at −80 °C for subsequent experiments. The concentration of the isolated exosomes was determined using the bicinchoninic acid (BCA) protein assay kit.

Preparation of Exos-Ber

According to the methods described in previous studies,³²⁾ Exos-Ber was prepared by mixing berberine (1 mg/mL) with PRP-exos (100 µg/mL, protein). The mixture was subjected to sonication for 30 s and subsequent suspension for 30 s in an ice bath. After repeating the above process 20 times, the final suspension was placed in a water bath at 37 °C for 2 h to maintain the intactness of the Exos membrane. Eventually, exosome spin columns (Thermo Fisher) were used to eliminate free Ber.

Identification of PRP-Exos and Exos-Ber

The sizes of the exosomes were determined using a Zeta View system (Particle Metrix, Germany), while the exosome was observed morphologically using a transmission electron microscopy (TEM) system (Philips-Technal, Netherlands). Surface markers (CD9, CD63, CD81, and Alix) of the exosome were detected by Western blotting.

Drug Release in Vitro

Exos-Ber was subjected to evaluation of its release property using PBS (pH 7.4) as the release medium. To a dialysis bag (8 kDa), 5 mL of Exos-Ber was added, after which, the bag was sealed and immersed in a release medium (25 mL) at 100 rpm and 37 °C. At a preset time, 500 µL of the release medium was collected, followed by replenishment with an identical amount of fresh medium. Each sample was analyzed using HPLC (maximum UV absorption) at 254 nm in triplicate.

Cell Proliferation Assay

The CCK-8 assay was used to evaluate the proliferative potential of BMSCs. About 5 × 10³ BMSCs were plated into each well of 96-well plates and incubated overnight. Then, chemicals such as PRP-exos, Ber, and Exos-Ber at different concentrations were added to each well and incubated for 48 h. For the negative controls, only culture media were used. Then, 10 µL of CCK-8 was added to each well and incubated for further 4 h at 37 °C in the dark. The optical density (OD) was determined at 450 nm. Cell viability was calculated using the formula:

  

Migration of BMSCs

To evaluate the migration potential of BMSCs, Transwell culture chambers with 8.0 µm Pore Polycarbonate Membrane (Corning) were used. Initially, 2 × 10⁴ cells were placed in the upper chamber, which was then loaded with 700 µL of low concentration serum culture medium containing 3% FBS. Then, an identical volume of “Drugs,” such as PBS (for the negative control), PRP-exos (25 µg/mL), Ber (25 µg/mL), or Exos-Ber (25 µg/mL) were added to the lower chamber. After incubating the BMSCs at 37 °C for 48 h, they were fixed in 4% formaldehyde for 30 min and washed twice using PBS. After discarding the PBS, the BMSCs were stained with 0.5% crystal violet for 60 min. Finally, after washing the BMSCs thrice using pure water, the upper chamber surface was swabbed, and the BMSCs were observed under 100× magnification (Olympus, Japan). Images were taken using a phase-contrast microscope.

Alcian Blue Stain

Following treatment with chondrogenic differentiation medium and corresponding drugs for 7 d, the medium was discarded, and the cells were fixed in 4% paraformaldehyde for 20 min. After washing the cells twice using PBS, they were co-incubated with Alcian blue dye solution for about 30 min. The cells were then washed with distilled water for 5 min. Subsequently, the staining results of each treatment group were observed and captured. Finally, the staining patterns were compared between groups.

Toluidine Blue Stain

Following treatment with osteogenic media and relevant drugs for 7 d, the BMSCs were washed using PBS and then fixed in 4% paraformaldehyde for 30 min at ambient temperature. Then, the cells were washed thrice in PBS. The staining solution (Toluidine blue) was mixed according to the manufacturer’s protocol and then added onto wells of a culture plate, followed by incubation at ambient temperature for 30 min. Finally, the cells were washed thrice using sterile water and photographed using a camera.

qRT-PCR Analysis

The BMSCs were plated onto a 6-well plate at a density of 1 × 10⁵/well and treated with the indicated drugs for 7 d. Then, the total RNA of the BMSCs was extracted using TRIzol according to the manufacturer’s instructions, followed by reverse transcription and qPCR assay. The reverse transcription was performed at 37°C for 15 min and 85°C for 15 s. The conditions of qPCR were initial denaturation at 95°C for 5 min, followed by 40 cycles of 95°C for 10 s and 60°C for 30 s. A DNA Engine (BIO-RAD) and a Real-time PCR system (ABI 7300) were used to perform the reactions. GAPDH was used to standardize the relative levels of mRNA expressions. The primer pairs used for PCR are presented in Table 1.

Table 1. List of the Primers Used for Quantitative (q)PCR

Gene	Primer (5′-3′)
Collagen II-forward	CTGGACTAGTGGGTCCCTTG
Collagen II-reverse	CCTCTCCTTGCTCACCCTTG
Sox9-forward	GGCTCGGACACAGAGAACAC
Sox9-reverse	GTGCGGCTTATTCTTGCTCG
Aggrecan-forward	GGTGTAGGCACCTCCTTTCC
Aggrecan-reverse	GAAAGGGTGAGGGGTGTCAG
β-Actin-forward	CTTCCAGCCTTCCTTCCTGG
β-Actin-reverse	CTGTGTTGGCGTACAGGTCT

Western Blot Analysis

RIPA buffer containing protease and phosphatase inhibitor cocktails was used to lyse the cells. After collection of the cell lysates, a BCA kit was used to assay their overall protein concentration. Each lane was loaded with total protein (approximately 20 µg), which was separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred onto polyvinylidene difluoride (PVDF) membranes. The membranes were initially blocked using skimmed milk (5%) in TBST buffer (0.1% Tween-20-involving Tris-buffered saline (TBS)) for 1 h at ambient temperature, after which, they were incubated with the relevant primary antibodies overnight at 4 °C. The membranes were then washed with TBST and incubated with horseradish peroxidase (HRP)-linked anti-rabbit or anti-mouse IgG at ambient temperature for 2 h. The bound immunocomplexes were detected using the CLINX system. The data represent the mean ± standard deviation (S.D.) values calculated based on three independent experiments.

Statistical Analysis

Each experiment was performed in triplicates. Student’s t-test was used to compare the means of two groups. To compare the means of three or more groups, one-way ANOVA was used. Quantitative data were expressed as mean ±S.D., and * p < 0.05 or ** p < 0.01 indicated statistically significant differences between the groups.

RESULTS

Preparation and Identification of PRP-Exos and Exos-Ber

The mixing of PRP-exos with Ber was performed by ultrasonication. Compared to the incubation approach (8.12 ± 0.86%), ultrasonication (28.16 ± 3.14%) yielded higher content of Ber in Exos-Ber (Fig. 1A). Then, the drug release was examined in vitro, and the results are presented in Fig. 1B. Exos-Ber tended to be released slowly in vitro, and the cumulative release was 61.28 ± 2.47% at 48 h. The PRP-Exos and Exos-Ber were observed using TEM. As shown in Fig. 1C, PRP-exos exhibited a completely thin membrane structure with around-shaped morphology. The results of nanoparticle tracking analysis (NTA) indicated that the majority of PRP-exos resembled in size (145.6 ± 50.4 nm; Fig. 1D), which concurred with the findings of previous reports on its structure and dimension. The particle size did not change after loading. Western blotting (Fig. 1E) demonstrated that both PRP-exos and Exos-Ber expressed feature markers such as CD9, CD63, CD81, and TSG101.

Fig. 1. Preparation and Identification of PRP-Exos and Exos-Ber

(A) Comparison of drug mixing by ultrasonication vs. incubation approaches. (B) Release of Ber by Exos-Ber in vitro. (C) TEM micrographs of PRP-exos and Exos-Ber. (D) Distribution of particle sizes and Zeta potentials of PRP-exos and Exos-Ber. (E) Results of Western blotting of protein markers for PRP-exos and Exos-Ber. All data were expressed as means ± S.D. (n = 3). * p < 0.05, ** p < 0.01.

Isolation and Identification of BMSCs

The isolation of BMSCs revealed a fusiform morphology at around 5 d following the first plating (Fig. 2A). The use of adipogenic, osteogenic, or chondrogenic culture media enabled the differentiation of BMSCs into adipocytes, osteoblasts, or chondrocytes (Fig. 2B). To further assess the traits of BMSCs based on surface markers, flow cytometry was used, which exhibited high positivity for CD29 and CD90 and negativity for CD45³³⁾ (Fig. 2C).

Fig. 2. Identification of BMSCs

(A) BMSCs showed a spindle-like morphology. (B) Positive staining of BMSCs with Oil Red O (a), Alizarin Red (b), and Alcian Blue (c) indicated the elicitation of adipogenic, osteogenic, and chondrogenic differentiation, respectively. (C) Flow cytometry analysis of the cell surface markers (CD29, CD90, and CD45) on BMSCs. Scale bar: 100 µm.

Effects of Exos-Ber on Proliferation, Differentiation and Migration of BMSCs Cells

For the examination of potential cytotoxicity, we treated the BMSCs using various concentrations of PRP-exos, Ber, and Exos-Ber for 48 h, followed by an assessment of cellular viability. Low concentrations of Ber were not cytotoxic to BMSCs (Fig. 3A). PRP-exos or Exos-Ber at 25 µg/mL led to significantly enhanced proliferation of BMSCs. Furthermore, the chondrogenic differentiation of BMSCs treated with PRP-exos, Ber, or Exos-Ber was examined by Toluidine blue stain and Alcian Blue stain. This demonstrated that PRP-exos, Ber, and Exos-Ber could significantly promote the chondrogenic differentiation of BMSCs (Fig. 3B). The highest upregulation was observed in BMSCs treated with Exos-Ber. Moreover, the migration patterns of BMSCs treated with PRP-exos, Ber, or Exos-Ber were examined. PRP-exos and Exos-Ber could significantly promote the migration of BMSCs (Figs. 3C, D). Between these two, Exos-Ber induced more migration of BMSCs compared to PRP-exos.

Fig. 3. Proliferation, Differentiation and Migration of BMSCs Cells

(A) Cell viability following treatment with Ber, PRP-exos, or Exos-Ber for 48 h. (B) The chondrogenic differentiation of BMSCs treated with PRP-Exos, Ber, or Exos-Ber was detected using Toluidine blue stain and Alcian Blue stain. Exos-Ber has the best effect on promoting the chondrogenic differentiation of BMSCs. (C) The migrations of BMSCs treated with PRP-Exos, Ber, or Exos-Ber. (D) Quantification of cell migration. All data were represented as the mean ± S.D. (n = 3). * p < 0.05, ** p < 0.01. Scale bar: 100 µm.

Exos-Ber Increased the Protein Levels of Chondrogenesis-Related Genes via Activating Wnt/β-Catenin Pathway

To investigate the potential signaling axes and the associated effector proteins, BMSCs were treated with Ber, PRP-exos, Exos-Ber or PBS for 48 h. The protein levels of chondrogenesis-related genes (collagen II, SOX9, Aggrecan) and the signaling pathway protein (β-catenin, GSK-3β) were measured by Western blotting. The proteins collagen II, SOX9, and Aggrecan were upregulated in BMSCs exposed to Ber, PRP-exos, or Exos-Ber (Fig. 4A). The greatest upregulation was observed in cells treated with Exos-Ber. As shown in Fig. 4B, the protein level of β-catenin was also upregulated, while that of GSK-3β was downregulated. These findings suggested the activation of the Wnt/β-catenin axis, which participates in chondrogenic differentiation.

Fig. 4. Exos-Ber Increased the Protein Levels of Chondrogenesis-Related Genes by Activating the Wnt/β-Catenin Pathway

(A) Results of Western blotting of the levels of chondrogenic marker proteins. (B) Western blot analysis for protein levels of β-catenin and GSK-3β in BMSCs treated with Ber, PRP-Exos, Exos-Ber, or PBS. All data were represented as the mean ± S.D. (n = 3). * p < 0.05, ** p < 0.01.

Inhibitors, XAV-939 Reversed the Promotion Effects of Exos-Ber on Chondrogenic Differentiation

To study the in-depth role of the Wnt/β-catenin axis in the chondrogenic differentiation induced by Exos-Ber, the β-catenin inhibitor XAV-939 was used in combination with Exos-Ber, while the β-catenin activator SB216763 was used as the positive control. Exos-Ber or SB216763 led to the elevated expression of β-catenin and repressed expression of GSK-3β (Fig. 5A). However, the effects were reversed when Exos-Ber was used in combination with XAV-939. Similarly, the mRNA (Fig. 5C) and protein (Fig. 5B) levels of chondrogenesis-related genes (collagen II, SOX9, Aggrecan) were upregulated in BMSCs exposed to Exos-Ber or SB216763. The effects were reversed when Exos-Ber was used in combination with XAV-939. This result indicated that Exos-Ber could promote BMSCs chondrogenic differentiation via Wnt/β-catenin signaling pathway.

Fig. 5. Inhibitors Reversed the Promotion Effects of Exos-Ber on BMSCs

(A) Results of Western blotting of β-catenin and GSK-3β proteins. (B) Results of Western blotting of the chondrogenic marker (Collagen II, Aggrecan, SOX9) proteins. (C) Results of qPCR for determining the mRNA expression levels. All data were represented as the mean ± S.D. (n = 3). * p < 0.05, ** p < 0.01.

DISCUSSION

Once damaged, articular cartilage has limited ability to regenerate itself, and poor management of lesions can lead to disability.^34–36) In both clinical and animal studies, therapies involving BMSCs to repair cartilage tissue have proven to be effective.^37,38) However, there are logistic (availability of adequate storage) and operational challenges (keeping cells viable and vital for transplantation).³⁹⁾ BMSCs can be used to repair cartilage since they possess a chondrogenic differentiation ability and can replace impaired or apoptotic chondrocytes.^40,41)

The present work aims mainly to explore how Exos-Ber affects the proliferation and differentiation of BMSCs. Statistically significant increases were observed in the proliferation and differentiation of BMSCs after treatment with 25 µg/mL Exos-Ber, which agreed with previous in vitro research demonstrating that PRP-exos or Ber could enhance cellular proliferation or differentiation.⁴²⁾ Our next objective was to check whether these drugs influenced the protein or gene expression of BMSCs. The protein levels of chondrogenesis-related genes (collagen II, SOX9, Aggrecan) increased significantly in BMSCs treated with Ber, PRP-exos, or Exos-Ber, with cells treated with Exos-Ber exhibiting the highest upregulation. This result indicated that Exos-Ber could promote chondrogenic differentiation.

β-Catenin, a vital regulator of Wnt signaling, probably acts via certain mechanisms that enable sequential modification during chondrogenic differentiation. In this study, the expression of β-catenin in BMSCs was studied following treatment with Ber, PRP-exos, or Exos-Ber. It was observed that the expression of β-catenin was promoted, while that of GSK-3β was inhibited, thus promoting Wnt signaling. Prior reports have also demonstrated the activation of proteoglycan generation in the 3D-cultured chondrocytes by PRP-exos, as well as upregulation of β-catenin.⁴³⁾ The Wnt signals mediated by β-catenin, when activated, enhance cartilage formation, and when lacking, might repress the differentiation of chondrocytes.⁴⁴⁾ To understand the role of the Wnt/β-catenin axis in the Exos-Ber-mediated differentiation of chondrocytes in further detail, the inhibitor β-catenin XAV-939 was used in combination with Exos-Ber, while the β-catenin activator SB216763 was used as a positive control. Exos-Ber or SB216763 led to elevated expression of β-catenin and reduced expression of GSK-3β (Fig. 5A). These effects were reversed when Exos-Ber was used in combination with XAV-939. Similarly, the mRNA (Fig. 5C) and protein (Fig. 5B) levels of chondrogenic genes (collagen II, Aggrecan, and SOX9) were upregulated in BMSCs exposed to Exos-Ber or SB216763. As demonstrated by this study, Exos-Ber elevated the levels of chondrogenic markers with the activity of β-catenin.

In conclusion, our study demonstrated that Exos-Ber significantly improved the in vitro proliferative potential and chondrogenic differentiation ability of human BMSCs. Besides, Exos-Ber could upregulate cartilage-associated genes such as collagen II, Aggrecan, and SOX-9 by activating the transduction of the Wnt/β-catenin signaling axis. This study will provide novel insights into cartilage reconstruction and the treatment of cartilage defects.

Acknowledgments

This work was supported by the Key Projects of Youth Innovation and Scientific Research Fund of the Affiliated Jiangning Hospital with Nanjing Medical University (JNYYZXKY202017).

Conflict of Interest

The authors declare no conflict of interest.

REFERENCES

• 1) Wang SJ, Jiang D, Zhang ZZ, Huang AB, Qi YS, Wang HJ, Zhang JY, Yu JK. Chondrogenic potential of peripheral blood derived mesenchymal stem cells seeded on demineralized cancellous bone scaffolds. Sci. Rep., 6, 36400 (2016).
• 2) Peterson L, Minas T, Brittberg M, Nilsson A, Sjögren-Jansson E, Lindahl A. Two- to 9-year outcome after autologous chondrocyte transplantation of the knee. Clin. Orthop. Relat. Res., 374, 212–234 (2000).
• 3) Farr J, Cole B, Dhawan A, Kercher J, Sherman S. Clinical cartilage restoration: evolution and overview. Clin. Orthop. Relat. Res., 469, 2696–2705 (2011).
• 4) Wang B, Wu S, Ma Z, Wang T, Yang C. BMSCs pre-treatment ameliorates inflammation-related tissue destruction in LPS-induced rat DIC model. Cell Death Dis., 9, 1024 (2018).
• 5) Yu T, Zhao C, Hou S, Zhou W, Wang B, Chen Y. Exosomes secreted from miRNA-29b-modified mesenchymal stem cells repaired spinal cord injury in rats. Braz. J. Med. Biol. Res., 52, e8735 (2019).
• 6) Orr MB, Simkin J, Bailey WM, Kadambi NS, McVicar AL, Veldhorst AK, Gensel JC. Compression decreases anatomical and functional recovery and alters inflammation after contusive spinal cord injury. J. Neurotrauma, 34, 2342–2352 (2017).
• 7) Wang X, Botchway BOA, Zhang Y, Yuan J, Liu X. Combinational treatment of bioscaffolds and extracellular vesicles in spinal cord injury. Front. Mol. Neurosci., 12, 81 (2019).
• 8) Ren B, Lv X, Tu C, Li Z. Research trends of platelet-rich plasma application in orthopaedics from 2002 to 2020: a bibliometric analysis. Int. Orthop., 45, 2773–2790 (2021).
• 9) Ba R, Kong L, Wu G, Liu S, Dong Y, Li B, Zhao Y. Increased expression of Sox9 during balance of BMSCs/chondrocyte bricks in platelet-rich plasma promotes construction of a stable 3-D chondrogenesis microenvironment for BMSCs. Stem Cells Int., 2020, 5492059 (2020).
• 10) Xia C, Chen Y, Sun K, Tian S, Yang X, Hong G. Effects of platelet-rich plasma on BMSCs differentiation into SC in vitro. Zhongguo Xiu Fu Chong Jian Wai Ke Za Zhi, 23, 997–1001 (2009).
• 11) Lei H, Xiao R, Tang XJ, Gui L. Evaluation of the efficacy of platelet-rich plasma in delivering BMSCs into 3D porous scaffolds. J. Biomed. Mater. Res. B Appl. Biomater., 91B, 679–691 (2009).
• 12) Krüger JP, Hondke S, Endres M, Pruss A, Siclari A, Kaps C. Human platelet-rich plasma stimulates migration and chondrogenic differentiation of human subchondral progenitor cells. J. Orthop. Res., 30, 845–852 (2012).
• 13) van Buul GM, Koevoet WL, Kops N, Bos PK, Verhaar JA, Weinans H, Bernsen MR, van Osch GJ. Platelet-rich plasma releasate inhibits inflammatory processes in osteoarthritic chondrocytes. Am. J. Sports Med., 39, 2362–2370 (2011).
• 14) Shi Y, Kang X, Wang Y, Bian X, He G, Zhou M, Tang K. Exosomes derived from bone marrow stromal cells (BMSCs) enhance tendon-bone healing by regulating macrophage polarization. Med. Sci. Monit., 26, e923328 (2020).
• 15) Alzhrani GN, Alanazi ST, Alsharif SY, Albalawi AM, Alsharif AA, Abdel-Maksoud MS, Elsherbiny N. Exosomes: Isolation, characterization, and biomedical applications. Cell Biol. Int., 45, 1807–1831 (2021).
• 16) Torreggiani E, Perut F, Roncuzzi L, Zini N, Baglio SR, Baldini N. Exosomes: novel effectors of human platelet lysate activity. Eur. Cell. Mater., 28, 137–151, discussion, 151 (2014).
• 17) Qi H, Liu DP, Xiao DW, Tian DC, Su YW, Jin SF. Exosomes derived from mesenchymal stem cells inhibit mitochondrial dysfunction-induced apoptosis of chondrocytes via p38, ERK, and Akt pathways. In Vitro Cell. Dev. Biol. Anim., 55, 203–210 (2019).
• 18) Chopra RN, Dikshit BB, Chowhan JS. Berberine and Berberine-Containing Plants in Pharmacology and Therapeutics. Ind. Med. Gaz., 67, 194–197 (1932).
• 19) Habtemariam S. Berberine and inflammatory bowel disease: A concise review. Pharmacol. Res., 113 (Pt A), 592–599 (2016).
• 20) Xie Q, Johnson BR, Wenckus CS, Fayad MI, Wu CD. Efficacy of berberine, an antimicrobial plant alkaloid, as an endodontic irrigant against a mixed-culture biofilm in an in vitro tooth model. J. Endod., 38, 1114–1117 (2012).
• 21) Ma L, Yu Y, Liu H, Sun W, Lin Z, Liu C, Miao L. Berberine-releasing electrospun scaffold induces osteogenic differentiation of DPSCs and accelerates bone repair. Sci. Rep., 11, 1027 (2021).
• 22) Xin BC, Wu QS, Jin S, Luo AH, Sun DG, Wang F. Berberine promotes osteogenic differentiation of human dental pulp stem cells through activating EGFR-MAPK-Runx2 pathways. Pathol. Oncol. Res., 26, 1677–1685 (2020).
• 23) Wang D, Zhang P, Mei X, Chen Z. Repair calvarial defect of osteoporotic rats by berberine functionalized porous calcium phosphate scaffold. Regen. Biomater., 8, rbab022 (2021).
• 24) Li W, Liu Y, Wang B, Luo Y, Hu N, Chen D, Zhang X, Xiong Y. Protective effect of berberine against oxidative stress-induced apoptosis in rat bone marrow-derived mesenchymal stem cells. Exp. Ther. Med., 12, 4041–4048 (2016).
• 25) Zhang W, Su X, Gao Y, Sun B, Yu Y, Wang X, Zhang F. Berberine protects mesenchymal stem cells against hypoxia-induced apoptosis in vitro. Biol. Pharm. Bull., 32, 1335–1342 (2009).
• 26) Jing H, Liao L, Su X, Shuai Y, Zhang X, Deng Z, Jin Y. Declining histone acetyltransferase GCN5 represses BMSC-mediated angiogenesis during osteoporosis. FASEB J., 31, 4422–4433 (2017).
• 27) Huang S, Xu L, Sun Y, Wu T, Wang K, Li G. An improved protocol for isolation and culture of mesenchymal stem cells from mouse bone marrow. J. Orthop. Translat., 3, 26–33 (2015).
• 28) Zhu H, Guo ZK, Jiang XX, Li H, Wang XY, Yao HY, Zhang Y, Mao N. A protocol for isolation and culture of mesenchymal stem cells from mouse compact bone. Nat. Protoc., 5, 550–560 (2010).
• 29) Guo SC, Tao SC, Yin WJ, Qi X, Yuan T, Zhang CQ. Exosomes derived from platelet-rich plasma promote the re-epithelization of chronic cutaneous wounds via activation of YAP in a diabetic rat model. Theranostics, 7, 81–96 (2017).
• 30) Yuan T, Zhang C, Zeng B. Treatment of chronic femoral osteomyelitis with platelet-rich plasma (PRP): a case report. Transfus. Apher. Sci., 38, 167–173 (2008).
• 31) Yin WJ, Xu HT, Sheng JG, An ZQ, Guo SC, Xie XT, Zhang CQ. Advantages of pure platelet-rich plasma compared with leukocyte- and platelet-rich plasma in treating rabbit knee osteoarthritis. Med. Sci. Monit., 22, 1280–1290 (2016).
• 32) Gao ZS, Zhang CJ, Xia N, Tian H, Li DY, Lin JQ, Mei XF, Wu C. Berberine-loaded M2 macrophage-derived exosomes for spinal cord injury therapy. Acta Biomater., 126, 211–223 (2021).
• 33) Li J, Ding Z, Li Y, Wang W, Wang J, Yu H, Liu A, Miao J, Chen S, Wu T, Cao Y. BMSCs-derived exosomes ameliorate pain via abrogation of aberrant nerve invasion in subchondral bone in lumbar facet joint osteoarthritis. J. Orthop. Res., 38, 670–679 (2020).
• 34) Cho YJ, Huh JE, Kim DY, Kim NJ, Lee JD, Baek YH, Cho EM, Yang HR, Choi DY, Park DS. Effect of Betula platyphylla var. japonica on proteoglycan release, type II collagen degradation, and matrix metalloproteinase expression in rabbit articular cartilage explants. Biol. Pharm. Bull., 29, 1408–1413 (2006).
• 35) Korpershoek JV, Vonk LA, Kester EC, Creemers LB, de Windt TS, Kip MMA, Saris DBF, Custers RJH. Efficacy of one-stage cartilage repair using allogeneic mesenchymal stromal cells and autologous chondron transplantation (IMPACT) compared to nonsurgical treatment for focal articular cartilage lesions of the knee: study protocol for a crossover randomized controlled trial. Trials, 21, 842 (2020).
• 36) Schmitt LC, Quatman CE, Paterno MV, Best TM, Flanigan DC. Functional outcomes after surgical management of articular cartilage lesions in the knee: a systematic literature review to guide postoperative rehabilitation. J. Orthop. Sports Phys. Ther., 44, 565–A10 (2014).
• 37) Jin L, Zhao W, Ren B, Li L, Hu X, Zhang X, Cai Q, Ao Y, Yang X. Osteochondral tissue regenerated via a strategy by stacking pre-differentiated BMSC sheet on fibrous mesh in a gradient. Biomed. Mater., 14, 065017 (2019).
• 38) Bornes TD, Jomha NM, Mulet-Sierra A, Adesida AB. Porous scaffold seeding and chondrogenic differentiation of BMSC-seeded scaffolds. Bio Protoc., 5, e1693 (2015).
• 39) Zhang S, Chuah SJ, Lai RC, Hui JHP, Lim SK, Toh WS. MSC exosomes mediate cartilage repair by enhancing proliferation, attenuating apoptosis and modulating immune reactivity. Biomaterials, 156, 16–27 (2018).
• 40) Kim KH, Park TS, Cho BW, Kim TM. Nanoparticles from equine fetal bone marrow-derived cells enhance the survival of injured chondrocytes. Animals (Basel), 10, 1723 (2020).
• 41) Chung MJ, Park S, Son JY, Lee JY, Yun HH, Lee EJ, Lee EM, Cho GJ, Lee S, Park HS, Jeong KS. Differentiation of equine induced pluripotent stem cells into mesenchymal lineage for therapeutic use. Cell Cycle, 18, 2954–2971 (2019).
• 42) Liu X, Wang L, Ma C, Wang G, Zhang Y, Sun S. Exosomes derived from platelet-rich plasma present a novel potential in alleviating knee osteoarthritis by promoting proliferation and inhibiting apoptosis of chondrocyte via Wnt/beta-catenin signaling pathway. J. Orthop. Surg. Res., 14, 470 (2019).
• 43) Shen J, Gao Q, Zhang Y, He Y. Autologous plateletrich plasma promotes proliferation and chondrogenic differentiation of adiposederived stem cells. Mol. Med. Rep., 11, 1298–1303 (2015).
• 44) Oichi T, Otsuru S, Usami Y, Enomoto-Iwamoto M, Iwamoto M. Wnt signaling in chondroprogenitors during long bone development and growth. Bone, 137, 115368 (2020).