Inhibitory Effects of Hydrolysable Tannins on Lipid Accumulation in 3T3-L1 Cells

Abstract

Obesity is currently the most common cause of metabolic diseases including type 2 diabetes and hyperlipidemia. Obesity results from excess lipid accumulation in adipose tissue. Several studies have investigated the inhibitory effects of natural plant-derived products on adipocyte differentiation and lipid accumulation. In this study, we examined the effect of hydrolysable tannins composed of gallic acid and glucose on adipocyte differentiation in 3T3-L1 cells. 1,2,3,4,6-Penta-O-galloyl-β-D-glucose (PGG) (1), a representative gallotannin, inhibited lipid accumulation in 3T3-L1 cells, whereas ellagitannins (tellimagrandin I, eugeniin and casuarictin) did not. The expression of adipocyte differentiation-related genes, including peroxisome proliferator activator γ2 (Pparγ2), CCAAT/enhancer binding protein α (C/EBPα) and adipocyte fatty acid binding protein (aP2), was significantly suppressed in PGG (1)-treated 3T3-L1 cells beginning at day 2 after induction of differentiation. While PGG (1) did not directly reduce Pparγ2 expression, it reduced the expression of its target genes in mature adipocytes. In addition, PGG (1) treatment inhibited mitotic clonal expansion, one of earliest events of adipocyte differentiation. These findings indicate that PGG (1) has an inhibitory effect on adipocyte differentiation through the suppression of mitotic clonal expansion.

INTRODUCTION

The prevalence of obesity has increased throughout the world in recent years. Obesity is considered to be a result of excessive lipid accumulation in adipose tissue. The expansion of adipose tissue results from the enlargement of mature adipocytes and the increase in new adipocytes differentiated from preadipocytes, which can lead to adipocyte dysfunction, insulin resistance and ultimately metabolic diseases such as type II diabetes, hyperlipidemia and atherosclerosis.^1–5)

Adipocyte differentiation contributes to lipid accumulation in adipocytes and is a key process in determining the number of adipocytes.⁶⁾ Therefore, targeting the inhibition of adipocyte differentiation has been considered to be an effective strategy in the development of anti-obesity agents. Natural products of plant origin provide various bioactive compounds that have been used as the base structures of drugs.⁷⁾ Moreover, natural products are generally safe and have fewer side effects than conventional drugs.⁸⁾ To date, 3T3-L1 cells have been widely used in anti-obesity studies of natural plants and food ingredients.^9,10) In previous studies, we reported on the inhibitory effects of natural plants such as Brazilian propolis and murta (Myreugenia euosma) on lipid accumulation during differentiation of 3T3-L1 cells, and clarified their active components.^11,12)

Tannins are water-soluble polyphenolic compounds that are present in many plant foods such as grains, vegetables, fruits and beverages (e.g., tea, coffee and wine).¹³⁾ Tannins are classified into two main groups, condensed tannins and hydrolysable tannins, based on their structural properties.¹⁴⁾ Condensed tannins are high molecular weight polymers of flavonoids, whereas hydrolysable tannins consist of phenylcarboxylic acid esterified to a glucose core.¹⁵⁾ Moreover, there are two subclasses of hydrolysable tannins, gallotannins (gallic acid) and ellagitannins (ellagic acid), based on the phenylcarboxylic acid.¹⁴⁾ 1,2,3,4,6-Penta-O-galloyl-β-D-glucose (PGG) (1), a prototypical gallotannin, is a galloyl ester on all the hydroxyl groups of glucose and is also involved in the biosynthetic pathway of hydrolysable tannins such as ellagitannins.¹⁵⁾ In contrast, ellagitannins containing tellimagrandin I (2), eugeniin (3) and casuarictin (4) have one or two hexahydroxydiphenoyl (HHDP) groups.¹⁶⁾

Hydrolyzable tannins are among the major bioactive components of fruits. Previous reports suggest that PGG (1) has several biological activities, including anti-oxidant, anti-aging, anti-cancer and anti-viral effects.^17–20) In addition, PGG (1) has been reported to improve high fat diet-induced insulin resistance in mice and decrease fat accumulation in Caenorhabditis elegans.^21,22) Tellimagrandin I, eugeniin and casuarictin are abundantly contained in walnuts and rosa rugosa.^23–25) Among them, tellimagrandin I has been studied in detail and was found to exert anti-oxidant, hepatoprotective and hyperlipidemia-improving effects.^23,24,26) Various biological activities of hydrolysable tannins have been revealed, but there are few reports on their effects in adipocytes. In this study, we investigated the effects of hydrolysable tannins on lipid accumulation during adipocyte differentiation.

MATERIALS AND METHODS

Tannins

The structures of tannins are shown in Fig. 1. PGG (1) was obtained from Sigma-Aldrich Co., LLC (St. Louis, MO, U.S.A.). Tellimagrandin I (2), eugeniin (3) and casuarictin (4) were obtained from Nagara Science Co., Ltd. (Gifu, Japan).

Fig. 1. Structures of the Four Hydrolysable Tannins Used in This Study

PGG (1), tellimagrandin I (2), eugeniin (3) and casuarictin (4). Dotted square indicates HHDP group.

Materials

Mouse 3T3-L1 cells were obtained from the American Type Culture Collection (Manassas, VA, U.S.A.). Dulbecco’s modified Eagle’s medium (DMEM) and Ham’s F12 medium were purchased from Nissui Pharmaceutical Co., Ltd. (Tokyo, Japan). Insulin, dexamethasone (DEX), isobutyl-3-methylxanthine (IBMX), dimethyl sulfoxide (DMSO) and berberine chloride were obtained from FUJIFILM Wako Pure Chemical Corporation (Osaka, Japan). Calf serum (CS) and penicillin–streptomycin–L-glutamine (PSG) were obtained from Thermo Fisher Scientific (Waltham, MA, U.S.A.). Fetal bovine serum (FBS) was obtained from Cosmo Bio Co., Ltd. (Tokyo, Japan).

Cell Culture

3T3-L1 cells were cultured in DMEM supplemented with 10% CS and 1% PSG in an incubator at 37 °C with 5% CO₂. Differentiation was induced following microscopic confirmation that the cells had reached 100% confluence. For the induction of adipocyte differentiation, differentiation medium (DMEM and Ham’s F12 supplemented with 10% FBS, 1% PSG, 1.6 µM insulin, 0.0005% transferrin, 180 µM adenine, 20 pM triiodothyronine) containing 500 µM IBMX, and 0.25 µM DEX was employed. The medium was replaced with fresh differentiation medium every 2 d. The samples were dissolved in distilled water and added to the differentiation medium beginning at day 0. In contrast, berberine chloride was dissolved in DMSO.

Measurement of Cell Viability

Cell viability was measured using the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay. 3T3-L1 cells were seeded onto a 96-well plate, and cultured in DMEM medium supplemented with 10% CS in an incubator at 37 °C with 5% CO₂ for 2 d. The cells were then treated with the samples or water (control). After 48 h of incubation, the 3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-tetrazolium bromide solution (Nacalai Tesque, Inc., Kyoto, Japan) was added to each well, the plate was incubated for an additional 4 h, and a solubilization solution was added to dissolve the insoluble formazan product. Then, the absorbance of the solution at 570 nm was measured with a microplate reader (Bio-Rad Laboratories, Hercules, CA, U.S.A.), and values relative to the absorbance at 655 nm as the control were used.

Oil Red O Staining

Oil Red O staining was performed using a Lipid Assay Kit (Cosmo Bio Co., Ltd.). Differentiation of 3T3-L1 cells seeded in a 24-well plate was induced according to the above method for 5 d, then the cells were washed once with phosphate-buffered saline and fixed with 4% formaldehyde solution for 24 h. The fixed cells were then rinsed once with water, and stained with Oil Red O solution for 15 min. The stained cells were washed three times with water to remove excess Oil Red O dye, and dried prior to imaging and quantification. The images were observed using an Olympus IX71 microscope (Tokyo, Japan). For the quantification of lipid droplets, a solubilization solution was added to the wells to elute the Oil Red O dye, and the absorbance at 540 nm was measured using a FLUOstar Omega (BMG LABTECH, Ortenberg, Germany).

Quantitative RT-PCR (qRT-PCR)

Total RNA was extracted from 3T3-L1 adipocytes using RNAiso Plus (TaKaRa Bio Inc., Shiga, Japan) according to the manufacturer’s instructions. cDNA was synthesized by ReverTra Ace RT (Toyobo Co., Ltd., Osaka, Japan) using 1.0 µg RNA in the presence of an oligo dT primer. Go Tap DNA polymerase (Promega, Madison, WI, U.S.A.) and 0.2 µM primers were mixed with the prepared cDNA. The PCR amplification conditions were as follows: initial denaturation at 95 °C for 30 s, annealing at 58 °C for 30 s, elongation at 72 °C for 30 s under 40 cycles, using the Mx3000 qRT-PCR system (Agilent Technologies, Santa Clara, CA, U.S.A.). The mRNA expression levels were normalized against 36b4 expression and are presented as relative expression levels. The primer sequences (Sigma-Aldrich Co., LLC) used for qRT-PCR are listed in Table 1.

Table 1. Primers Used in This Study

Gene	Primers	(5′–3′ Sequence)
Pparγ2	Forward	GCTGTTATGGGTGAAACTCTG
	Reverse	ATAATAAGGTGGAGATGCAGG
C/ebpα	Forward	TGGACAAGAACAGCAACGAG
	Reverse	TCACTGGTCAACTCCAGCAC
aP2	Forward	ATGAAATCACCGCAGACGACAGGA
	Reverse	TGTGGTCGACTTTCCATCCCACTT
Adiponectin	Forward	AAGGACAAGGCCGTTCTCT
	Reverse	TATGGGTAGTTGCAGTCAGTTGG
Glut4	Forward	GCTTTGTGGCCTTCTTTGAG
	Reverse	CGGCAAATAGAAGGAAGACG
C/EBPδ	Forward	CCCCAAAGCTATGTGCCTTTC
	Reverse	CCTGGAGGGTTTGTGTTTTC
C/EBPβ	Forward	GGTTTCGGGACTTGATGCA
	Reverse	CAACAACCCCGCAGGAAC
36b4	Forward	AAGCGCGTCCTGGCATTGTCT
	Reverse	CCGCAGGGGCAGCAGTGGT

Cell Proliferation Assay

3T3-L1 cells seeded in a 24-well plate were induced to differentiate into adipocytes as described above. Cells were washed once with phosphate-buffered saline and harvested by trypsinization. Trypsinized cells were incubated with DMEM medium and 0.4% trypan blue. The number of viable cells were counted using a hemocytometer.

Statistical Analysis

The results are presented as the mean ± standard deviation (S.D.) of three experiments. Student’s t-tests were performed for comparisons between 2 groups, and Tukey’s multiple comparison test was performed after testing with one-way ANOVA for comparison of 3 or more groups. p-Values <0.05 were considered to indicate statistical significance.

RESULTS

Effects of Hydrolysable Tannins on Lipid Accumulation in 3T3-L1 Cells

To evaluate the cytotoxicity of hydrolysable tannins, 3T3-L1 preadipocytes were treated with one gallotannin and three ellagitannins at a concentration of 4 µM for two days. The tannins did not affect 3T3-L1 cell viability according to the MTT assay (Fig. 2); thus, subsequent experiments were conducted with hydrolysable tannins at a concentration of 4 µM. To examine the effects of these tannins on adipocyte differentiation in 3T3-L1 cells, Oil Red O staining was performed after induction of differentiation for 5 d. Berberine chloride, which has been reported to inhibit lipid accumulation in 3T3-L1 cells, was used as a positive control.¹²⁾ As shown in Fig. 3, PGG (1) exhibited a similar inhibitory activity on lipid accumulation to that observed for berberine chloride (Fig. 3). In contrast, there was no difference in lipid accumulation between the control and other tannin-treated cells. These data indicated that only PGG (1) inhibited lipid accumulation during adipocyte differentiation among the hydrolysable tannins assessed.

Fig. 2. Effects of Hydrolysable Tannins (1–4) and Berberine Chloride on 3T3-L1 Cell Viability

3T3-L1 preadipocytes were incubated with each of the four hydrolysable tannins (4 µM) and berberine chloride (Ber. 4 µM) for 2 d and cell viability was determined by MTT assay. The value of the control-treated cells was set to 100 (%). Results are presented as means ± S.D. of three independent experiments (* p < 0.05 vs. control, Tukey’s test).

Fig. 3. Effects of Hydrolysable Tannins (1–4) and Berberine Chloride on Lipid Accumulation in 3T3-L1 Cells

Cells were treated with each of the four hydrolysable tannins (4 µM) and berberine chloride (Ber. 4 µM) on days 0, 2, and 4 during adipocyte differentiation. (A) The cells were stained with Oil Red O after 5 d of differentiation and were observed microscopically at 100× magnification. (B) Intracellular lipids stained with Oil Red O dye were eluted and levels were quantified by absorbance at 540 nm. The value of the control-treated cells was set to 100 (%). Results are presented as means ± S.D. of three independent experiments (* p < 0.05 vs. control, Tukey’s test).

Effect of PGG (1) on Gene Expression during Adipocyte Differentiation

Next, we examined changes in adipocyte differentiation-related gene expression in 3T3-L1 cells treated with PGG (1). Consistent with the pattern of Oil Red O staining, the expression of adipocyte marker genes, including peroxisome proliferator-activated receptor γ2 (Pparγ2), adipocyte specific protein 2 (aP2) and CCAAT/enhancer-binding protein α (C/ebpα), was significantly suppressed in 3T3-L1 cells treated with PGG (1) (Fig. 4). Moreover, PGG (1) treatment suppressed the induction of adipocyte function-related genes such as glucose transporter isoform 4 (Glut4) and adiponectin. In contrast to C/EBPα, C/EBPβ and C/EBPδ play a vital role in the early events of adipocyte differentiation. There were significant decreases in C/ebpβ gene expression and increases in C/ebpδ gene expression in 3T3-L1 cells treated with PGG (1) after day 2 of differentiation (Fig. 4). In addition, we examined the effect of other hydrolysable tannins (2)–(4) on adipocyte differentiation-related genes (Pparγ2, C/ebpα, and aP2) expression in 3T3-L1 cells for 6 d. PGG (1) suppressed adipocyte differentiation-related genes to the same extent as berberine chloride whereas other hydrolysable tannins (2)–(4) had little effect on these gene expression (Fig. 5).

Fig. 4. mRNA Expression Levels of Adipocyte Differentiation-Related Genes in 3T3-L1 Cells Treated with PGG (1)

Cells were treated with PGG (1) (4 µM) or water (control) on days 0, 2, and 4 during adipocyte differentiation. Total RNA was extracted at the indicated time points following differentiation, and the expression of adipocyte differentiation-related genes was determined by RT-qPCR. Results are presented as means ± S.D. of three independent experiments (* p < 0.05 vs. control, Student’s t-test).

Fig. 5. mRNA Expression Levels of Adipocyte Differentiation-Related Genes in 3T3-L1 Cells Treated with Hydrolysable Tannins (1–4) and Berberine Chloride

Cells were treated with four hydrolysable tannins (4 µM) and berberine chloride (Ber. 4 µM) on days 0, 2, and 4 during adipocyte differentiation. Total RNA was extracted and the expression of adipocyte differentiation-related genes was determined by RT-qPCR. Results are presented as means ± S.D. of three independent experiments (* p < 0.05 vs. control, Tukey’s test).

Effect of PGG (1) on Pparγ2 and Its Target Gene Expression in Mature 3T3-L1 Adipocytes

Among adipocyte differentiation-related genes highly expressed in adipocytes, PPARγ2 is a master regulator for adipocyte differentiation, and PPARγ2 target genes are those coding for aP2, C/EBPα, adiponectin and glut4. As shown in Figs. 3 and 4, PGG (1) treatment inhibited the differentiation of preadipocytes into adipocytes. However, it is unclear whether the effect of PGG (1) on adipocyte differentiation-related genes involves direct regulation or is an indirect result of the decrease in adipocyte differentiation. Next, we examined the direct effect of PGG (1) on adipocyte-related gene expression in mature 3T3-L1 adipocytes after differentiation. While PGG (1) treatment did not alter Pparγ2 gene expression, the expression of its target genes, such as C/ebpα, aP2, adiponectin and Glut4, was slightly decreased (Fig. 6). These results indicated that PGG (1) did not directly affect Pparγ2 gene expression, but altered the expression of its target genes.

Fig. 6. Effects of PGG (1) on the Expression of Adipocyte Differentiation-Related Genes in Mature 3T3-L1 Adipocytes

Mature 3T3-L1 adipocytes were treated with PGG (1) (4 µM) or water (control) for 24 h. Total RNA was extracted and the expression of adipocyte differentiation-related genes was determined by RT-qPCR. The value of control-treated cells was normalized to 1. Results are presented as means ± S.D. of three independent experiments (* p < 0.05 vs. control, Student’s t-test).

Effect of PGG (1) on Mitotic Clonal Expansion during Adipogenesis

3T3-L1 preadipocytes differentiate into adipocytes through several events, including growth arrest, mitotic clonal expansion and terminal differentiation. Mitotic clonal expansion is an essential event in early adipogenesis. To determine the effect of PGG (1) on mitotic clonal expansion, changes in cell morphology and cell number were evaluated. PGG (1) treatment inhibited mitotic clonal expansion on day 2 and subsequent changes in cell morphology (Fig. 7A). Cell growth with clonal expansion in cells treated with PGG (1) was completely suppressed (Fig. 7B). These results suggest that the inhibitory effect of PGG (1) on adipocyte differentiation was likely associated with the suppression of mitotic clonal expansion.

Fig. 7. Effects of PGG (1) on Mitotic Clonal Expansion during Differentiation of 3T3-L1 Adipocytes

Cells were treated with PGG (1) (4 µM) or water (control) on days 0, 2, and 4 during adipocyte differentiation. (A) Changes in cell morphology were observed microscopically at 100× magnification. (B) Cell numbers were determined at the indicated time points during differentiation. Results are presented as means ± S.D. of three independent experiments (* p < 0.05 vs. control, Student’s t-test).

DISCUSSION

Recent studies have focused on natural products with potential for anti-obesity effects. 3T3-L1 cells are a popular in vitro screening model used in anti-obesity studies of natural plants and food ingredients. In this study, we examined the effect of four hydrolysable tannins on adipocyte differentiation in 3T3-L1 cells. PGG (1) treatment inhibited lipid accumulation and adipocyte differentiation, whereas the other hydrolysable tannins had no effect (Figs. 3, 5). The suppression of adipocyte differentiation by PGG (1) was as effective as that of berberine chloride. Furthermore, PGG (1) treatment significantly suppressed adipocyte differentiation-related gene expression and cell proliferation related to mitotic clonal expansion 2 d after the induction of differentiation (Figs. 4, 7). Mitotic clonal expansion is a prerequisite for terminal differentiation of adipocytes.²⁷⁾ Consequently, the anti-obesity effect of PGG (1) may be due to a mechanism by which PGG (1) inhibits adipocyte differentiation, i.e., via the suppression of mitotic clonal expansion.

Adipocyte differentiation is a complex process that involves changes in gene expression. Recent studies have shown that this process is mainly controlled by several transcription factors including adipocyte differentiation-related genes (PPARγ2, C/EBPs etc.).²⁸⁾ During adipocyte differentiation, C/EBPβ and C/EBPδ are transiently increased by hormonal stimuli and subsequently induce PPARγ2 and C/EBPα genes during terminal differentiation. Moreover, PPARγ2 and C/EBPα control adipocyte function through the regulation of target genes such as Glut4, adiponectin, and aP2. PGG (1) treatment suppressed PPARγ2 and C/EBPα gene expression at day 2 after differentiation and the expression of target genes after day 4 of differentiation (Fig. 4). Although PGG (1) treatment reduced the expression of PPARγ2 during adipocyte differentiation, this might be associated with the low adipocyte differentiation of 3T3-L1 cells treated with PGG (1), as PGG (1) treatment had no effect on PPARγ2 expression in mature adipocytes (Fig. 6). Interestingly, the expression of PPARγ2 target genes was at least partially reduced in mature adipocytes treated with PGG (1) (Fig. 6). This may imply that PGG (1) regulates PPARγ2 protein expression or acts as an antagonist of PPARγ2. A recent study showed the betulinic acid contained in fruits and vegetables exerts PPARγ antagonist activity and inhibits 3T3-L1 adipocyte differentiation.²⁹⁾ Moreover, adiponectin and glut4 are involved in adipocyte differentiation and adipose tissue formation.^30,31) Therefore, these results suggest that PGG (1) might inhibit adipocyte differentiation through the suppression of PPARγ target gene expression.

C/EBPβ is required for both mitotic clonal expansion in early-stage differentiation and terminal differentiation by inducing PPARγ and C/EBPα.³²⁾ In this study, PGG (1) decreased the expression of C/EBPβ gene and suppressed mitotic clonal expansion at day 2 and later (Figs. 4, 7). Also, DNA binding activity of C/EBPβ is associated with posttranscriptional modifications such as phosphorylation and is responsible for the transcriptional regulation of PPARγ and C/EBPα.³³⁾ C/EBPβ mRNA and its phosphorylation exhibit a biphasic expression pattern during mitotic clonal expansion of adipocyte differentiation.³³⁾ Phosphorylation of C/EBPβ is regulated by several signaling pathways (p42/44 mitogen-activated protein kinase (MAPK), AMP activated protein kinase (AMPK), p38 MAPK, cdk2, GsK3β) related to mitotic clonal expansion.^34,35) Previous study reported that PGG (1) attenuated cdk2 expression and p42/44 MAPK activity.³⁶⁾ Peng et al. recently showed that PGG (1) extracted from Radix Paeoniae Alba inhibits MAPKs (p42/44 MAPK, p38 MAPK, c-Jun N-terminal kinase (JNK)) activation at the beginning of adipocyte differentiation.³⁷⁾ The study reported by Peng et al. showed the elevation of MAPKs by adipogenic inducers were suppressed by PGG (1) for 30 min, resulted in the suppression of adipocyte differentiation. In contrast, the results in this study demonstrated PGG (1) suppressed C/EBPβ mRNA expression and mitotic clonal expansion at day 2, but not at day 1. Activation of p42/44 MAPK exhibits biphasic pattern during mitotic clonal expansion of 3T3-L1 adipocyte differentiation, suggesting that p42/44 MAPK signal pathway may be involved in several mitotic steps.³⁵⁾ Taken together, PGG (1) may exert inhibitory effects on mitotic clonal expansion through regulating C/EBPβ expression and posttranscriptional modifications associated with MAPKs. However, there is no direct evidence indicating that PGG (1) affects C/EBPβ modification and its related signaling pathway or kinase activity. Further studies are required to examine the molecular mechanism underlying PGG (1)-induced suppression of mitotic clonal expansion.

Tannins are the most abundant secondary metabolites in natural plants, and are classified into condensed and hydrolysable tannins.³⁸⁾ PGG (1) is one of the most potent antioxidants in natural plants and has been reported to exhibit anti-inflammatory and anti-diabetes effects.³⁹⁾ Ellagitannins have also shown anti-obesity and anti-inflammatory effects.^40,41) In this study, the results demonstrated that PGG (1) significantly inhibited lipid accumulation in 3T3-L1 cells, whereas other ellagitannins with an HHDP group had no effect on adipocyte differentiation. PGG (1) has a galloyl ester on all the hydroxyl groups of glucose, while tellimagrandin I (2), eugeniin (3), and casuarictin (4) have one or more HHDP groups (Fig. 1). Therefore, the presence of an HHDP group appears to weaken the inhibitory effect on lipid accumulation.

PGG (1) isoforms, other gallotannins and hydrolysable tannins have been identified from natural plants and food.^19,37,42) Recently, Fujimaki et al. reported that PGG (1) and other tannins were containing in Mangifera indica L. kernels.⁴²⁾ Consisted with our results, PGG (1) extracted from mango kernels also inhibited lipid accumulation with suppressed the induction of PPARγ and C/EBPα gene expression.⁴²⁾ Interestingly, 3-O-digalloyl-1,2,4,6-tetra-O-galloyl-β-D-glucose (HGG), which has an additional galloyl moiety to the structure of PGG (1), showed the similar degree of inhibitory effect on adipocyte differentiation compared with PGG (1).⁴²⁾ On the other hands, it has been reported that anti-oxidative activity of tannin acid increases proportionally to the number of galloyl moiety.⁴³⁾ Several reports suggest that the PGG (1) and galloyl-based polyphenols are thought to modify the structure of cell membrane and incorporate into lipid bilayers via galloyl moieties, leading to exert the biological activity such as anti-oxidant and anti-proliferative effects.^44–46) Therefore, further exploration of the quantitative structure–activity relationships of tannins on adipocyte differentiation is highly justified. Additional studies are needed to clarity the direct association between inhibition of lipid accumulation and the position or number of galloyl moieties.

CONCLUSION

In the present study, we revealed that the gallotannin PGG (1) strongly inhibited lipid accumulation and adipocyte differentiation in 3T3-L1 cells. Moreover, PGG (1) suppressed mitotic clonal expansion during adipocyte differentiation. Therefore, further investigation of the mechanism of PGG (1)-induced inhibition of mitotic clonal expansion and its effect on obesity in vivo is warranted. Consequently, the results from this study provide new insights into the biological activities of PGG (1) and may be applicable in the development of prophylactic agents for obesity-related metabolic diseases.

Acknowledgments

Development and Establishment of the Center of Excellence on Anti-Doping Education Research, and Studies toward Post-Olympic/Paralympic Games at Nihon University.

Conflict of Interest

The authors declare no conflict of interest.

REFERENCES

• 1) Larsen TM, Toubro S, Astrup A. PPARgamma agonists in the treatment of type II diabetes: is increased fatness commensurate with long-term efficacy? Int. J. Obes. Relat. Metab. Disord., 27, 147–161 (2003).
• 2) Formiguera X, Canton A. Obesity: epidemiology and clinical aspects. Best Pract. Res. Clin. Gastroenterol., 18, 1125–1146 (2004).
• 3) Kadowaki T, Yamauchi T, Kubota N, Hara K, Ueki K, Tobe K. Adiponectin and adiponectin receptors in insulin resistance, diabetes, and the metabolic syndrome. J. Clin. Invest., 116, 1784–1792 (2006).
• 4) Rocha VZ, Libby P. Obesity, inflammation, and atherosclerosis. Nat. Rev. Cardiol., 6, 399–409 (2009).
• 5) Ishikawa K, Yokote K. Dysfunction of adipose tissue and insulin resistance. Nippon Naika Gakkai Zasshi, 102, 2691–2698 (2013).
• 6) Parelee SD, Lentz SI, Mori H, MacDougald OA. Quantifying size and number of adipocytes in adipose tissue. Methods Enzymol., 537, 93–122 (2014).
• 7) Tabata K, Motani K, Takayanagi N, Nishimura R, Asami S, Kimura Y, Ukiya M, Hasegawa D, Akihisa T, Suzuki T. Xanthoangelol, a major chalcone constituent of Angelica keiskei, induces apoptosis in neuroblastoma and leukemia cells. Biol. Pharm. Bull., 28, 1404–1407 (2005).
• 8) Hirai S, Kanda N, Takahashi A, Ohe Y, Egashira Y. Water extract of Eriobotrya japonica enhances adipocyte differentiation. HortResearch, 69, 11–15 (2015).
• 9) Nobushi Y, Hamada Y, Yasukawa K. Inhibitory effects of the edible mushroom flammulina velutipes on lipid accumulation in 3T3-L1 cells. J. Pharm. Nutr. Sci., 3, 222–227 (2013).
• 10) Nishina A, Ukiya M, Fukatsu M, Koketsu M, Ninomiya M, Sato D, Yamamoto J, Kobayashi-Hattori K, Okubo T, Tokuoka H, Kimura H. Effects of various 5,7-dihydroxyflavone analogs on adipogenesis in 3T3-L1 cells. Biol. Pharm. Bull., 38, 1794–1800 (2015).
• 11) Nobushi Y, Oikawa N, Okazaki Y, Tsutsumi S, Park YK, Kurokawa M, Shimba S, Yasukawa K. Inhibitory effects of brazilian propolis on lipid accumulation in 3T3-L1 cells. J. Pharm. Nutr. Sci., 4, 6–11 (2014).
• 12) Oikawa N, Nobushi Y, Wada T, Sonoda K, Okazaki Y, Tsutsumi S, Park YK, Kurokawa M, Shimba S, Yasukawa K. Inhibitory effects of compounds isolated from the dried branches and leaves of murta (Myrceugenia euosma) on lipid accumulation in 3T3-L1 Cells. J. Nat. Med., 70, 502–509 (2016).
• 13) Yoshimura M. Structure elucidation of antioxidative polyphenols and their biological properties. Yakugaku Zasshi, 134, 957–964 (2014).
• 14) Taniguchi S, Hatano T, Yazaki K. Production of tannin by tissue culture of woody plants and tannin biosynthesis. Mokuzai Gakkaishi, 52, 67–76 (2006).
• 15) Torres-Leon C, Ventura-Sobrevilla JM, Serna-Cock L, Ascacio-Valdes JA, Contreras-Esquivel JC, Aguilar CN. Pentagalloylglucose (PGG): a valuable phenolic compound with functional properties. J. Funct. Foods, 37, 176–189 (2017). doi: 10.1016/j.jff.2017.07.045
• 16) Wilkins CK, Bohm BA. Ellagitannins from Tellima grandiflora. Phytochemistry, 15, 211–214 (1976).
• 17) Riedl KM, Hagerman AE. Tannin-protein complexes as radical scavengers and radical sinks. J. Agric. Food Chem., 49, 4917–4923 (2001).
• 18) Ahn MJ, Kim CY, Lee JS, Kim TG, Kim SH, Lee CK, Lee BB, Shin CG, Huh H, Kim J. Inhibition of HIV-1 integrase by galloyl glucoses from Terminalia chebula and flavonol glycoside gallates from euphorbia pekinensis. Planta Med., 68, 457–459 (2002).
• 19) Chen Y, Onken B, Chen H, Xiao S, Liu X, Driscoll M, Cao Y, Huang Q. Mechanism of longevity extension of Caenorhabditis elegans induces by pentagalloyl glucose isolated from eucalyptus leaves. J. Agric. Food Chem., 62, 3422–3431 (2014).
• 20) Deiab S, Mazzio E, Eyunni S, McTier O, Mateeva N, Elshami F, Soliman KFA. 1,2,3,4,6-Penta-O-galloylglucose within Galla chinensis inhibits human LDH-A and attenuates cell proliferation in MDA-MB-231 breast cancer cells. Evid. Based Complement. Alternat. Med., 2015, 276946 (2015).
• 21) Zhang X, Li W, Tang Y, Lin C, Cao Y, Chen Y. Mechanism of pentagalloyl glucose in alleviating fat accumulation in Caenorhabditis elegans. J. Agric. Food Chem., 67, 14110–14120 (2019).
• 22) Kant R, Lu CK, Nguyen HM, Hsiao HH, Chen CJ, Hsiao HP, Lin KJ, Fang CC, Yen CH. 1,2,3,4,6-Penta-O-galloyl-β-D-glucose ameliorates high-fat diet-induced nonalcoholic fatty liver disease and maintains the expression of genes involved in lipid homeostasis in mice. Biomed. Pharmacother., 129, 110348 (2020).
• 23) Shimoda H, Tanaka J, Kikuchi M, Fukuda T, Ito H, Hatano T, Yoshida T. Walnut polyphenols prevent liver damage induced by carbon tetrachloride and D-galactosamine: hepatoprotective hydrolyzable tannins in the kernel pellicles of walnut. J. Agric. Food Chem., 56, 4444–4449 (2008).
• 24) Shimoda H, Tanaka J, Kikuchi M, Fukuda T, Ito H, Hatano T, Yoshida T. Effect of polyphenol-rich extract from walnut on diet-induced hypertriglyceridemia in mice via enhancement of fatty acid oxidation in the liver. J. Agric. Food Chem., 57, 1786–1792 (2009).
• 25) Yamagishi T, Takano K, Kondo S. The serum lipid lowering effect of rugosa pose petal extract rich in polypenols in adults with high serum triglyceride. Japanese Journal of Complementary and Alternative Medicine, 12, 29–35 (2015).
• 26) Lee DY, Kim HW, Yang H, Sung SH. Hydrolyzable tannins from the fruits of Terminalia chebula Retz and their α-glucosidase inhibitory activities. Phytochemistry, 137, 109–116 (2017).
• 27) MacDougald OA, Lane MD. Adipocyte differentiation. When precursors are also regulators. Curr. Biol., 5, 618–621 (1995).
• 28) Soukas A, Socci ND, Saatkamp BD, Novelli S, Friedman JM. Distinct transcriptional profiles of adipogenesis in vivo and in vitro. J. Biol. Chem., 276, 34167–34174 (2001).
• 29) Brusotti G, Montanari R, Capelli D, Cattaneo G, Laghezza A, Tortorella P, Loiodice F, Peiretti F, Bonardo B, Paiardini A, Calleri E, Pochetti G. Betulinic acid is a PPARγ antagonist that improves glucose uptake, promotes osteogenesis and inhibits adipogenesis. Sci. Rep., 7, 5777 (2017).
• 30) Fu Y, Luo N, Klein RL, Garvey WT. Adiponectin promotes adipocyte differentiation, insulin sensitivity, and lipid accumulation. J. Lipid Res., 46, 1369–1379 (2005).
• 31) Katz EB, Stenbit AE, Hatton K, Depinhot R, Charron MJ. Cardiac and adipose tissue abnormalities but not diabetes in mice deficient in GLUT4. Nature, 377, 151–155 (1995).
• 32) Tang QQ, Otto TC, Lane MD. CCAAT/enhancer-binding protein β is required for mitotic clonal expansion during adipogenesis. Proc. Natl. Acad. Sci. U.S.A., 100, 850–855 (2003).
• 33) Guo L, Li X, Tang QQ. Transcriptional regulation of adipocyte differentiation: a central role for CCAAT/enhancer-binding protein (C/EBP) β. J. Biol. Chem., 290, 755–761 (2015).
• 34) Li X, Kim JW, Gronborg M, Urlaub H, Lane MD, Tang QQ. Role of cdk2 in the sequential phosphorylation/activation of C/EBPβ during adipocyte differentiation. Proc. Natl. Acad. Sci. U.S.A., 104, 11597–11602 (2007).
• 35) Park BH, Qiang L, Farmer SR. Phosphorylation of C/EBPβ at a consensus extracellular signal-regulated kinase/glycogen synthase kinase 3 site is required for the induction of adiponectin gene expression during the differentiation of mouse fibroblasts into adipocytes. Mol. Cell. Biol., 24, 8671–8680 (2004).
• 36) Mendonca P, Taka E, Bauer D, Reams RR, Soliman KFA. The attenuating effects of 1,2,3,4,6-penta-O-galloyl-β-D-glucose on pro-inflammatory responses of LPS/IFNγ-activated BV-2 microglial cells through NFκB and MAPK signaling pathways. J. Neuroimmunol., 324, 43–53 (2018).
• 37) Peng J, Li K, Zhu W, Nie R, Wang R, Li C. Penta-O-galloyl-β-d-glucose, a hydrolysable tannin from Radix Paeoniae Alba, inhibits adipogenesis and TNF-α-mediated inflammation in 3T3-L1 cells. Chem. Biol. Interact., 302, 156–163 (2019).
• 38) Barbehenn RV, Constabel CP. Tannins in plant-herbivore interactions. Phytochemistry, 72, 1551–1565 (2011).
• 39) Lucas EA, Li W, Peterson SK, Brown A, Kuvibidila S, Perkins-Veazie P, Clarke SL, Smith BJ. Mango modulates body fat and plasma glucose and lipids in mice fed a high-fat diet. Br. J. Nutr., 106, 1495–1505 (2011).
• 40) Xia B, Shi XC, Xie BC, Zhu MQ, Chen Y, Chu XY, Cai GH, Liu M, Yang SZ, Mitchell GA, Pang WJ, Wu JW. Urolithin A exerts antiobesity effects through enhancing adipose tissue thermogenesis in mice. PLOS Biol., 18, e3000688 (2020).
• 41) Zhao M, Yuan X, Pei YH, Ye HY, Peng AH, Tang MH, Guo DL, Deng Y, Chen LJ. Anti-inflammatory ellagitannins from Cleidion brevipetiolatum for the treatment of rheumatoid arthritis. J. Nat. Prod., 82, 2409–2418 (2019).
• 42) Fujimaki T, Sato C, Yamamoto R, Watanabe S, Fujita H, Kikuno H, Sue M, Matsushima Y. Isolation of phenolic acids and tannin acids from Mangifera indica L. kernels as inhibitors of lipid accumulation in 3T3-L1 cells. Biosci. Biotechnol. Biochem., 86, 665–671 (2022).
• 43) Machida S, Sugaya M, Saito H, Uchiyama T. Synthesis and evaluation of gallotannin derivatives as antioxidants and α-glucosidase inhibitors. Chem. Pharm. Bull., 69, 1209–1212 (2021).
• 44) Salucci M, Stivala LA, Maiani G, Bugianesi R, Vannini V. Flavonoids uptake and their effect on cell cycle of human colon adenocarcinoma cells (Caco2). Br. J. Cancer, 86, 1645–1651 (2002).
• 45) Uekusa Y, Kamihira M, Nakayama T. Dynamic behavior of tea catechins interacting with lipid membranes as determined by NMR spectroscopy. J. Agric. Food Chem., 55, 9986–9992 (2007).
• 46) Zhu W, Zou B, Nie R, Zhang Y, Li CM. A-type ECG and EGCG dimers disturb the structure of 3T3-L1 cell membrane and strongly inhibit its differentiation by targeting peroxisome proliferator-activated receptor γ with miR-27 involved mechanism. J. Nutr. Biochem., 26, 1124–1135 (2015).