INTRODUCTION
Breast cancer is one of the inflammatory-related diseases in which the nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB) transcriptional factor is the central negotiator of a wide range of target inflammatory genes.1,2) NF-κB is a multi-functional transcriptional factor protein system that participates in various physiological and pathological developments.3) The NF-κB/Rel complex system consists of pro-oncogenes belonging to the Rel family: p50, p52, c-Rel, p65(RelA), and B-Rel; these protein units are linked to inhibitor of kappaB (IκB) inhibitory protein. Phosphorylation and activation of IκB by inhibitory kappaB kinase (IKK) lead to p50/p65 liberation in the cytoplasm and translocation to a reporter site in the nucleus to target gene expression, such as interleukin (IL)-6, IL-8, CXCL1, matrix metalloproteinases (MMPs), vascular endothelial growth factor (VEGF), and others responsible for the formation of an inflammatory storm and escaping from anti-tumor immunity, which promotes in breast cancer initiation, progression, survival, and metastasis.4–9) Therefore, NF-κB is an attractive drug target strategy for breast cancer.
Caralluma tuberculata is a wild traditional, edible herb that grows worldwide in dry countries (Egypt, Saudi Arabia, Pakistan, India, Iran, Nigeria, and the United Arab Emirates).10,11) This herb belongs to the subfamily Asclepiadoideae and the family Apocynaceae. Caralluma tuberculata is widely used in folk medicine to treat a variety of diseases due to its antioxidant activity, such as regulating blood pressure, reducing blood glucose, rheumatism, leprosy, peptic ulcer, inflammation, jaundice, and cirrhosis, and it is also used for dysentery, stomach pain, constipation, hepatitis B and C, pimples, and as a blood purifier following snake and scorpion bites. Additionally, it has antibacterial and antifungal activities.12–16) Pregnanes glycosides (Russelioside A, B, and C) are the major compounds isolated from the Caralluma tuberculata n-butanol fraction of a methanol extract and show structural similarity to estrogenic agonists as they are C21 steroids conjugated as glycosides, which may play a role in treatment for breast cancer.17) It has been reported that the methanol extract of Caralluma tuberculata has a direct cytotoxic effect against different estrogen-dependent breast and colon cancer cell lines17) and Russelioside B has an anti-inflammatory effect through the inhibition of NF-κB and IL-6 protein expressions.14) However, no reported studies have been conducted on the utility of those pregnane glycosides as anti-cancer agents. In this study, we identified that Russelioside A suppresses NF-κB activity and has anti-metastatic effects in murine and human triple-negative breast cancer cell lines.
MATERIALS AND METHODS
ReagentsRusselioside A, Russelioside B, and Russelioside C were isolated from Caralluma tuberculata herb, dissolved in dimethyl sulfoxide (DMSO, FUJIFILM Wako Pure Chemical Corporation, Osaka, Japan), and stored at −20 °C. Cell Counting Kit-8 Assay Kit (WST-8) was purchased from Dojindo (#CK04, Kumamoto, Japan). D-Luciferin was obtained from Promega (#p1041, WI, U.S.A.), Albumin Bovine Serum (#CAF6673) and Mayer’s Hematoxylin Solution (#PTQ7267) were obtained from FUJIFILM Wako Pure Chemical Corporation. One percent eosin Y solution (#031023) was purchased from MUTO PURE CHEMICALS (Tokyo, Japan). The primary antibodies against p65 and P-p65 were purchased from Cell Signaling Technology (Beverly, MA, U.S.A.), and the antibody against β-actin was purchased from Santa Cruz Biotechnology (Santa Cruz, CA, U.S.A.).
Plant MaterialThe aerial parts of C. tuberculata N.E.Br. (syn. Borealluma tuberculata (N.E.Br.) Plowes, Apteranthes tuberculata (N.E.Br.) Meve & Liede) were collected from Al-Sheffa area, Al-Taif governorate, Saudi Arabia, in May 2020 and were dried in the shade. A specimen was deposited at the herbarium of the College of Pharmacy, King Abdulaziz University, Jeddah, Saudi Arabia (Voucher Specimen No. CT1027-A).
Extraction and IsolationA sample (500 g) of the air-dried powder of C. tuberculata aerial parts was extracted with cold MeOH (3 × 2 L) using the Ultra-Turrax T50 homogenizer. The solvent was evaporated under reduced pressure to give 115 g of a brown residue (ME). Part of the residue (65 g) was suspended in distilled water (300 mL) and partitioned successively with chloroform (4 × 500 mL) and n-butanol (4 × 500 mL), and the solvent was evaporated to yield 22.1 (CE) and 20 g (BE), respectively. The remaining water fraction (WRF) was evaporated to give 22.8 g. Russeliosides A–C were isolated from the n-butanol fraction (BE) after chromatography on an Si gel column following the procedure reported by Al-Yahya et al.18) Purity of the isolated Russeliosides A–C was checked by measuring the mp, superimposed IR, and comparing spectral data (1H- and 13C-NMR) with those reported in the literature (Al-Yahya et al.). The isolated compounds were identified as calogenin 20-O-β-D-glucopyranosyl-3-O-β-D-(3-O-methyl-6-deoxy) galactoside (Russelioside A), calogenin 20-O-β-D-glucopyranosyl-3-O-[β-D-glucopyranosyl-(1f4)-β-D-(3-O-methyl-6-deoxy)] galactoside (Russeliosides B), and calogenin 3-O-[β-D-glucopyranosyl-(1f4)-β-D-(3-O-methyl-6-deoxy)] galactoside (Russeliosides C).
Cell CultureThe murine breast cancer cells 4T1 (ATCC) and human breast cancer cell line MDA-MB-231 (ATCC) were maintained in RPMI-1640 medium (Nissui, Tokyo, Japan) and supplied by 10% fetal bovine serum (FBS) (Thermo Fisher Scientific, Waltham, MA, U.S.A.), 20 U/mL of penicillin, 20 µg/mL of streptomycin, NaHCO3, and L-glutamine. The cells were incubated at 37 °C in a 5% CO2 humidified incubator. 4T1 murine breast cancer cells (4T1-Luc2 or 4T1-NFκB-Luc2) were previously established.19) Briefly, to establish the luciferase gene expressing murine mammary carcinoma 4T1 cells (4T1-Luc2 or 4T1-NFκB-Luc2), 4T1 cells (ATCC, Manassas, VA, U.S.A.) were seeded in a 6-well plate and pGL4.50 or pGL4.32 vector (Promega, Sunnyvale, CA, U.S.A.) was transfected using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, U.S.A.). The cells were selected with Hygromycin B (100 µg/mL) (Nacalai Tesque, Kyoto, Japan) and cloned by limiting dilution.
Luciferase Reporter AssayThe 4T1-NFκB-Luc2 cells (2 × 104 cells/well) were seeded in a 96-well plate and pre-treated with the test compounds at different concentrations (1, 10, 100, and 200 µM) or 0.1% DMSO for 24 h. After incubation with test compounds, 10 µL D-luciferin (150 µg/mL; Promega) was added and luciferase activity was recorded after 15 min using the bioluminescent imaging detection system (IVIS Lumina II; Caliper Life Sciences, Hopkinton, MA, U.S.A.). NF-κB activity was determined as the activity relative to the untreated control.
Cell Viability AssayCell viability was quantified using Cell Counting Kit-8 Assay Kit (#CK04, Dojindo) according to the manufacturer’s instructions. The exponentially-phased 4T1 cells were seeded at a final concentration of 2 × 104 cells/well in a 96-well plate. After 24-h incubation at 37 °C and 5% CO2, cells were co-cultured with the test compounds at a concentration of 200 µM for 24 h. For Russelioside A, 4T1 and MDA-MB-231 cells were seeded at 104 cells/well (48 h) and 3 × 103 cells/well (72 h) and treated with Russelioside A at different concentrations (1, 10, 100, and 200 µM). After incubation with test compounds, 10 µL of WST-8 reagent was added to the culture medium for each well and absorbance (OD) was measured after 15 min at 450 and 620 nm using a microplate reader. Cell viability was determined as a percentage of the untreated control cells.
Western Blot Analysis4T1-Luc2 or MDA-MB-231 cells (106 cells/well) were treated with the test compounds for 7 h. The whole-cell lysates were set from the pre-treated cells by washing with phosphate-buffered saline (PBS) and lysing in lysis buffer [25 mM N-(2-hydroxyethyl)piperazine-N′-2-ethanesulfonic acid (HEPES) (pH 7.7), 0.3 M NaCl, 1.5 mM MgCl2, 0.2 mM ethylenediaminetetraacetic acid (EDTA), 0.1% Triton X-100, 20 mM β-glycerophosphate, 0.1 mM sodium orthovanadate, 0.5 mM phenylmethylsulfonyl fluoride (PMSF), 1 mM dithiothreitol, 10 mg/mL aprotinin, and 10 mg/mL leupeptin]. Equal protein amounts of cell lysates (110 µg) were resolved by 10% sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis (PAGE) and transferred to the Immobilon-P nylon membrane (Merck Millipore, Darmstadt, Germany). The membrane was treated with Block Ace (DS Pharma Biomedical, Tokyo, Japan) for 4 h at room temperature and incubated with primary antibodies overnight at 4 °C. Antibodies were detected using horseradish peroxidase-conjugated anti-rabbit and anti-mouse immunoglobulin G (Dako, Glostrup, Denmark) and visualized using an enhanced chemiluminescence system (#1859701, Thermo Fisher Scientific). The primary and secondary antibodies were used at a dilution of 1 : 1000 in 5% BSA in PBST.
Trans-Well Migration and Invasion AssayFor the trans-well migration assay, the filters of a Trans-well cell culture insert (8 µm pore size; Whatman Japan KK, Tokyo, Japan) were pre-coated with fibronectin (Iwaki, Tokyo, Japan, 25 µg/mL) on the lower surfaces. For the trans-well invasion assay, the upper surface of the filters was coated with Matrigel (Becton-Dickinson, Bedford, MA, U.S.A.,10 µg/mL). 4T1-Luc2 or MDA-MB-231 cells (2 × 105 cells/well) were exposed to Russelioside A (200 µM) or 0.1% DMSO for 24 h. The cells were harvested at a concentration of 3 × 105 cells/mL. A 100 µL cell suspension was placed in the upper chambers of trans-wells and incubated for 6 h at 37 °C in 5% CO2 incubator. At room temperature, non-migrated cells on the apical side of the top chambers were removed with a cotton swab and the cells that had migrated to the lower side of the membrane were fixed for 1 min with methanol and stained with hematoxylin for 3 min and eosin for 15 s. The migrated cells in five randomly selected fields were counted under a fluorescence inverted microscope-BZ-X800 (KEYENCE, Osaka, Japan) (magnification, 10×). The results are expressed as the number of invading cells expressed as a percentage of that of the untreated group.
Wound Healing Assay4T1-Luc2 and MDA-MB-231 cells (2 × 105 cells/well) were seeded in 24-well plates. Cells were allowed to produce a confluent monolayer for 24 h. The monolayer was scratched in a straight line with a sterile yellow tip (200 µL) and floated cells were discarded. Cells were treated with a new medium containing Russelioside A at a concentration of 200 µM or vehicle (DMSO) for 24 h. Scratched areas were photographed under the inverted fluorescence microscope-BZ-X800 (KEYENCE) (magnification, 4×) at 0 and 24 h. The percentage wound closure was estimated by the following equation: wound closure % = 100 − (wound area at T = 24/wound area at T = 0) × 100%.
RT-PCR4T1-Luc2 cells (106 cells/well) were cultured in a 6-well plate and exposed to Russelioside A (200 µM) for 24 h. Total cellular RNA was isolated using Qiagen RNeasy Mini kits (50) (# 74104, QIAGEN, Germantown, MD, U.S.A.) and RNA quality was evaluated on a Nanodrop 8000 spectrophotometer (Thermo Fisher Scientific). Quantitative PCR (qPCR) were performed in duplicate by the One-Step TB Green Primer Script PLUS RT-PCR kit (Perfect Real Time) (# RR096A, TaKaRa, Shiga, Japan) on MX3005P Applied Biosystems 7300 Fast Real-Time PCR System (Waltham, CA, U.S.A.). The reaction was performed as follows: Each reaction (10 µL) contained 1 µL of RNA, 1 pmol of each primer, 0.2 µL of internal reference dye, 5 µL of J 2*One-Step SYBR RT-PCR Buffer 4, 0.6 µL of TaKaRa Ex Taq HS Mix, 0.15 µL of PrimeScript PLUS RTase Mix, and 2.25 µL of ribonuclease (RNase)-free water. The amplification program consisted of 1 cycle at 95 °C for 10 s followed by 40 cycles with a denaturing phase at 95 °C for 5 s, an annealing phase at 62 °C for 34 s, and an extension phase starting with the temperature at 95 °C for 15 s, 60 °C for 30 s, and the final stage at 95 °C for 15 s. The amplification’s specificity was established by melt curve analysis. Cycle threshold (Ct) values for target genes were normalized to the endogenous reference gene GAPDH, and the fold change was calculated by dividing the expression in each sample by the control sample. The primers used were (5′-3′): VEGF-b: TGGGCAATGTGGTCAAACAACTA (Forward), TGCATTCACATTGGCTGTGTTC (Reverse), MMP-9: TGTCTGGAGATTCGACTTGAAGTC (Forward), TGAGTTCCAGGGCACACCA (Reverse), GAPDH: AAATGGTGAAGGTCGGTGTG (Forward), TGAAGGGGTCGTTGATGG (Reverse).
Enzyme-Linked Immunosorbent Assay (ELISA)4T1-Luc2 cells (106 cells/well) were cultured in a 6-well plate and pre-treated with Russelioside A (200 µM) or DMSO (0.1%) for 24 h. Cell-free culture supernatants were collected and the level of cytokines in 10-fold diluted supernatants for IL-6 was measured using the ELISA MAX™ standard set mouse IL-6 kit (# B300162, BioLegend, San Diego, CA, U.S.A.) according to the manufacturer’s instructions. The reaction was performed in triplicate.
In Vivo Lung Metastasis AnalysisFemale BALB/c mice (7 weeks old) were purchased from Japan SLC Inc. (Hamamatsu, Japan) and kept in a temperature-controlled laboratory animal room, free from the specific pathogens. The experiment was approved and carried out according to the standard guidelines of the Care and Use of Laboratory Animals of University of Toyama (A2019INM-5). 4T1-Luc2 Cells were used to intravenously inoculate (105 cells/100 mL PBS/ mouse) mice, and 3 d after tumor inoculation, 200 µL of D-luciferin was injected intraperitoneally (10 mg/mL, In Vivo Glo, Promega) into each mouse. After 10 min, lungs were removed for bioluminescence assay using the in vivo imaging system (IVIS Lumina II, Caliper Life Science, Hopkinton, MA, U.S.A.). The data are presented as the total luminescence flux ± standard deviation (S.D.).
Statistical AnalysisResults are presented as the mean ± S.D. of two or three independent experiments unless otherwise stated. Data were analyzed by one-way ANOVA or the t-test using GraphPad Prism 7 (GraphPad, Software, San Diego, CA, U.S.A.).Differences were considered significant at a probability value (*p) < 0.05.
RESULTS
Russelioside A Suppresses Cell-Intrinsic NF-kB Activation in Breast Cancer CellsTo identify a novel anti-cancer agent from natural products by targeting NF-κB activity, we first examined the effect of the three pregnane glycosides (Fig. 1) on NF-κB transcriptional activity using 4T1-NFκB-Luc2 cells. As shown in Fig. 2A, the three pregnane glycosides significantly attenuated NF-κB transcriptional activity in a concentration-dependent manner without directly affecting cell viability at their highest concentration of 200 µM in 4T1 cells (Fig. 2B) or MDA-MB-231 (data not shown) after 24 h. To explain the mechanism by which Russeliosides inhibit the transcriptional activity of NF-κB, we examined the expression of NF-κB (p65) and its phosphorylation status. Despite all three compounds having similar effects on NF-κB transcriptional activity, only Russelioside A strongly inhibited p65 phosphorylation without affecting the expression of total p65 in 4T1-Luc2 cells (Fig. 2C). Furthermore, we assessed the effect of different concentrations of Russelioside A on p65 phosphorylation in both 4T1-Luc2 and MDA-MB-231 cell lines. We observed that Russelioside A significantly suppressed p65 phosphorylation in both murine and human breast cancer cells at 200 µM (Fig. 3).
Russelioside A Exerts Anti-proliferative Activity on Breast Cancer Cell LinesOveractivation of NF-κB on breast cancer cells plays a role in regulating tumor proliferation and survival. Therefore, to evaluate the potency of Russelioside A as an anti-cancer compound, we next examined the effect of Russelioside A on the growth of both murine and human breast cancer cells. As shown in Fig. 4, Russelioside A has no direct cytotoxicity but does have a significant anti-proliferative effect on both 4T1 and MDA-MB-231 cells in a concentration-dependent manner at 48 and 72 h with IC50 values 88.0 and 95.8 µM for 4T1 and MDA-MB-231, respectively.
Russelioside A Attenuates the Metastatic Activity of Breast Cancer CellsAs the importance of NF-κB in breast cancer metastasis is well-known, we next measured the effect of Russelioside A on metastatic prospects of 4T1-Luc2 and MDA-MB-231 cells. Russelioside A treatment at 200 µM for 24 h significantly decreased the invasion (Fig. 5A) or migration (Fig. 5B) of both 4T1-Luc2 and MDA-MB-231 cells in the trans-well assay. In addition, Russelioside A treatment also led to a significant reduction in cell migration of both TNBC cells in the wound-healing assay (Fig. 5C).
Russelioside A Inhibits the Expression of MMP-9, VEGF-b, and IL-6 in 4T1 Breast Cancer CellsPro-tumorigenic factors, such as VEGF, MMPs, and inflammatory cytokines (IL-6) are vital regulators of cancer progression, angiogenesis, and invasion, which are regulated under the control of NF-κB activity.20–22) Therefore, we measured the expression level of MMP-9, VEGF-b, and IL-6 from 4T1 cells with or without Russelioside A. The mRNA expression of MMP-9 (Fig. 6A) and VEGF-b (Fig. 6B) and the protein expression level of the inflammatory cytokine IL-6 (Fig. 6C), which is expressed frequently at a high level in breast cancer, were markedly lower in treated 4T1 cells compared with controls after 24 h.
Russelioside A Suppresses Lung Colonization by 4T1 Breast Cancer CellsFinally, we investigated the anti-metastatic activity of Russelioside A using an experimental lung metastasis model of 4T1 breast cancer cells. As shown in Fig. 7, pre-treatment with Russelioside A significantly inhibited lung colonization by metastatic 4T1 breast cancer cells in vivo. Collectively, our study demonstrated the biological significance of Russelioside A to inhibit the oncogenic activity of NF-κB in breast cancer cells and its ability to control their metastatic potential.
